Gene therapy for ocular conditions

Abstract

The present invention provides compositions and methods for treating Leber's congenital amaurosis (LCA) in a subject. In one aspect, there is provided a recombinant adeno-associated viral vector comprising a nucleic acid molecule comprising a sequence encoding Lebercilin. On the other hand, the Lebercilin has an amino acid sequence SEQ ID NO: 1. In yet another aspect, the nucleic acid molecule has the sequence SEQ ID NO: 3 or a variant thereof. In a desired embodiment, the subject is a human, cat, dog, sheep, or non-human primate.

Description

[0001] This case is a divisional application of Chinese invention patent application No. 201880029279.2, filed on March 1, 2018, entitled "Gene Therapy for Ocular Diseases".

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0003] This invention was made with government support under Grant Nos. R21EY020662 and P30EY001583 awarded by the National Eye Institute (NEI) / National Institutes of Health (NIH). The government has certain rights in this invention.

[0004] Incorporation by reference of materials submitted electronically

[0005] Applicants hereby incorporate by reference the sequence listing material submitted in electronic form. This file is labeled "UPN-16-7696PCT_Seq_Listing_ST25.txt". Background Art

[0006] Leber's congenital amaurosis (LCA; OMIM 204000) is one of the most serious inherited blinding diseases. LCA is rare, occurring in 1:50,000 individuals, usually inherited in an autosomal recessive manner, and can be caused by mutations in any of at least 22 different genes (sph.uth.edu / RetNet / sum-dis.htm). Clinical features include severe visual abnormalities (decreased visual acuity, reduced visual field), nystagmus, and progressive loss of poor vision in infancy or early childhood. Clinical trials reveal lost dark-adapted and light-adapted electroretinogram (ERG) responses, amaurotic pupils, decreased light sensitivity, and pigment changes in the retina. There is currently no approved treatment for LCA.

[0007] The LCA form caused by mutations in the retinal pigment epithelium 65kDa protein encoding gene RPE65 (RedmondTM, Yu S, Lee E, Bok D, Hamasaki D, Chen N et al. Rpe65 is necessary for production of 11-cis-vitamin A in the retinal visual cycle. Nat Genet (1998) 20 (4): 344-51; Redmond T, Hamel C. Genetic analysis of RPE65: from human disease to mouse model. Methods in Enzymol (2000) 317: 705-24, all of which are incorporated herein by reference) has attracted much attention in recent years because it has become a target for multi-gene enhancement therapy clinical trials. By using adeno-associated virus (AAV) serotype 2, several research groups have demonstrated that delivery of wild-type copies of RPE65 cDNA to the retinal pigment epithelium (RPE) is safe and can reverse many defects including night blindness. (3-9) Randomized, multicenter phase 3 studies testing AAV2-hRPE65v2 (or voretigene neparvovec, sponsored by Spark Therapeutics, Philadelphia, PA) have demonstrated that subretinal injection of this agent leads to improvements in light sensitivity, visual field, and even the ability to use visual cues to navigate accurately and quickly under certain brightness conditions. (10,11) The U.S. Food and Drug Administration (FDA) approved the drug, voretigene neparvovec-rzyl, on December 19, 2017, making it one of the first gene therapy drugs approved in the United States. Progress in developing treatments for LCA caused by RPE65 mutations, LCA2, paves the way for the development of treatments for other forms of early-onset retinal degeneration, most of which are caused by mutations in photoreceptor-specific genes rather than just RPE-specific genes.

[0008] One of the most severe forms of this already serious condition (LCA) is caused by mutations in the photoreceptor-specific gene LCA5, which encodes lebercilin (12-20). LCA5 mutations are estimated to account for approximately 2% of LCA cases, although it may be more prevalent in genetically isolated populations. (16) LCA5 mutations are also thought to be responsible for other early-onset forms of retinal degeneration, including cone dystrophies and autosomal recessive retinitis pigmentosa (ARRP). (15, 16, 21)

[0009] Therefore, there is a need for compositions useful for expressing Lebercilin in a subject in need thereof. Summary of the invention

[0010] Embodiments described herein relate to compositions and methods for delivering AAV gene therapy vectors for human LCA5 to subjects in need thereof, which produce long-term, potentially 10 years or more, clinically meaningful correction of Leber's congenital amaurosis (LCA) following intravitreal or subretinal administration of the vectors.

[0011] In one aspect, a codon-optimized, engineered nucleic acid sequence encoding human Lebercilin is provided. In one embodiment, the codon-optimized nucleic acid sequence is a variant of SEQ ID NO: 3 or SEQ ID No: 2. In another embodiment, the codon-optimized nucleic acid sequence is SEQ ID NO: 3. In another embodiment, the nucleic acid sequence is codon-optimized for expression in humans.

[0012] On the other hand, an expression cassette is provided, which comprises a codon-optimized nucleic acid sequence encoding Lebercilin. In one embodiment, the expression cassette comprises a nucleic acid sequence encoding human Lebercilin, SEQ ID NO: 3. In other embodiments, the Lebercilin coding sequence is located between the 5' and 3' AAV ITR sequences.

[0013] On the other hand, a recombinant adeno-associated virus (rAAV) vector is provided. The rAAV comprises an AAV capsid and a vector genome packaged therein. In one embodiment, the vector genome comprises: (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a promoter; (c) a coding sequence encoding human Lebercilin; and (d) an AAV 3'ITR. In one embodiment, the rAAV vector further comprises an expression control sequence directing the expression of Lebercilin in a host cell. In other embodiments, the Lebercilin sequence is the protein sequence SEQ ID NO:1. In one embodiment, the vector genome is the sequence of nt 1-4379 of SEQID NO:8. In another embodiment, the vector genome is the sequence of nt 1-4368 of SEQ ID NO:9. In yet another embodiment, the LCA5 coding sequence in any one of the identified vector genomes is exchanged with another LCA5 coding sequence as described herein.

[0014] In another aspect, an aqueous suspension suitable for administration to a patient with LCA is provided. In one embodiment, the suspension comprises an aqueous suspending fluid and about 1 x 10 10The GC or virus particles of the recombinant adeno-associated virus (rAAV) described herein suitable for use as a LCA therapeutic agent are about 1×10 13 GCs or virus particles.

[0015] In another aspect, a pharmaceutical composition comprises a pharmaceutically acceptable carrier, diluent, excipient and / or adjuvant and a nucleic acid sequence, plasmid, vector or viral vector, such as rAAV as specifically described herein.

[0016] In another aspect, a method for treating Leber's congenital amaurosis caused by a defect in the lebercilin gene (LCA5) and / or restoring visual function in a mammalian subject with LCA comprises delivering a recombinant AAV vector encoding Lebercilin as described herein to a subject in need thereof via intravitreal, subretinal or intravascular injection.

[0017] On the other hand, the use of the AAV vector as described herein for treating Leber's congenital amaurosis caused by a defect in the lebercilin gene (LCA5) and / or restoring visual function in a mammalian subject with LCA is provided. The use comprises delivering a recombinant AAV vector encoding Lebercilin as described herein to a subject in need thereof via intravitreal, subretinal or intravascular injection.

[0018] Other aspects and advantages of the present invention will become readily apparent from the following detailed description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1A The transgene cassettes used to generate AAV7m8.CBA.hopt.LCA5 and AAV7m8.CBA.EGFP as described herein are shown.

[0020] Figure 1B-1D An alignment of the human nucleic acid sequence of LCA5 (Native_LCA5), SEQ ID NO:2, and the codon-optimized LCA5 (CodonOptimized_LCA5), SEQ ID NO:3, is provided.

[0021] Figure 1E-1F A plasmid map and feature list of the pAAV.CMV.CBA.human codon-optimized Lebercilin vector is provided. The nucleic acid sequence is reproduced in SEQ ID NO:8.

[0022] Figure 1G-1H Provided are immunofluorescence analyses of eyes injected with AAV7m8-hopt-LCA5 at P5 and analyzed at P15, showing colocalization of Lebercilin with the base of tubulin-positive outer segments as described in Examples 1, 2, and 4. Figure 1G ) or subretinal injection (SR), lebercilin is distributed throughout the retina, which contains almost no photoreceptors at P95. In contrast, lebercilin is absent in untreated P15 and P95 Lca5- / - retinas. SR: subretinal; IVT: intravitreal; (-) untreated Lca5- / -. A schematic diagram showing the intravitreal injection protocol ( Figure 1G ) and subretinal injection regimen ( Figure 1H ) sketch.

[0023] Fig. 1I Shown is the expression of Lebercilin in wild-type mice and Lca5- / - mice injected subretinaly with AAV.LCA5 vector at P20.

[0024] Figure 2A-2I Normalized pupil reflex amplitudes measured at 3 months of age in AAV7m8.hopt-LCA5 injected mice compared to control (sham injected) eyes of Lca5- / - mice treated at PN5 and PN15 are shown. Results are shown after (A) intravitreal and (B) subretinal injections or (C) in untreated (-) control mice. (D) Relative pupil reflex amplitudes (% of baseline pupil diameter) for the right eyes of animals in each subgroup shown in (AC) plus wild-type (C57B16) positive (+) control mice are shown graphically (E). Figure 2F and 2G is used to generate Figures 2A-2D Representation of the test scenario with the results shown in . Figure 2H and 2I Shown in Figures 2A-2D Comparison of normalized pupillary reflex amplitudes in experimental and control mice shown in , treated via subretinal (SR, I) or intravitreal (IV, H) injection at PN5 vs. PN15. *.p<0.1; **p<0.05; ***p<0.01.

[0025] Figures 3A-3F Shown are the results of water maze testing in AAV7m8.hopt-LCA5 injected versus control (sham injected) eyes of Lca5- / - mice treated at PN5 and PN15 and measured at 3 months of age as described in Example 3. Figure 3A is a table showing the statistical analysis results. Figure 3B is a graphic representation of representative results of the water maze test. Figure 3D is a bar graph showing the number of days before the first success of training Lca5- / - mice treated at birth with AAV7m8.LCA5 vectors intravitreally or subretinally at PN5 or PN15. Wild-type mice were provided as controls. Figure 3Dis a line graph of the success rate of Lca5- / - mice at PN5 treated intravitreally with AAV7m8.LCA5 vector at birth at various light intensities (x-axis). Figure 3E is a line graph of the success rate of Lca5- / - mice at PN5 treated subretinally with AAV7m8.LCA5 vector at birth at various light intensities (x-axis). Figure 3F is a line graph of the success rate of Lca5- / - mice at PN15 treated intravitreally with AAV7m8.LCA5 vector at birth at various light intensities (x-axis).

[0026] Figure 4 is a graph providing representative histological results after delivery of AAV7m8.hopt-LCA5 to Lca5gt / gt retinas at postnatal day (PN) 5. The graph shows the number of rows in the outer nuclear layer (ONL) after IVT or SR treatment with AAV.LCA5 versus sham injection.

[0027] Figure 5A Immunofluorescence results are provided, which show the continued presence of rhodopsin (red) in treated (but not control untreated) photoreceptors through the 3 month time point. Occasional photoreceptor cells were eGFP positive (injection areas identified by co-injection with AAV7m8.eGFP).

[0028] Figures 5B-5DMulti-electrode array (MEA) responses of rods and cones from Lca5gt / gt AAV7m8.hopt-LCA5 treatment are provided that are similar to those of wild-type (WT) retinas. (B) Response amplitudes (difference in discharge rate before and after flash onset) versus flash intensity data measured from each flash average trace (not shown). Responses from treated retinas were up to 70% of those from WT retinas; minimal to eliminated responses were present in untreated retinas. (C) Response amplitudes of Group A retinas from the first and second rounds of intensity series (before / during and after the brightest exposure at the end of the first round, with the stimulus series intensity increasing from dark adaptation to the brightest light adaptation value during each round of intensity series by increments of approximately 0.5 log). (D) Changes in amplitude of transient ON- (difference in discharge rate before and after flash onset), sustained ON- (difference before flash onset and offset), and OFF-responses (difference before and after flash offset) as a function of flash intensity for the first and second rounds of intensity series. Light blue shaded area represents the range of WT reaction (4 retinas, MEAN ± STD), and only the trace of the line gives the average WT reaction amplitude. The horizontal arrow represents the rightward shift of sensitivity caused by exposure to the brightest flash at the end of the first round of intensity series. The Lca5gt / gt and WT retina treated show similar reactions / intensity dependence before and after bleaching, while the untreated Lca5gt / gt retinal reaction flattens. The circle connected with the line represents the LCA5gt / gt for treatment. The triangle connected with the line represents the control LCA5gt / gt.

[0029] Figures 6A-6E Shown is the presence of massive cell death during photoreceptor degeneration early in life in untreated Lca5- / - retinas (and a delay in this degeneration following treatment with AAV.hopt.LCA5), as measured by (A) TUNEL assay ( Fig. 6A ; Figure 6B -E, third row) and (B) rhodopsin immunofluorescence analysis ( Figure 6B -E, lines 1, 3, and 4).

[0030] Figures 7A-7DThe outer segments are shown to be present in AAV7m8.hopt.LCA5 treated Lca5- / - retinas but not in control Lca5- / - retinas. Transmission electron microscopic evaluation of retinas injected with AAV7m8.hopt.LCA5 revealed rod and cone photoreceptor outer segments with stacked discs and connecting cilia in 3 month old Lca5- / -. Such structures were absent in untreated Lca5- / - retinas. (A, B) Representative images at PN80 after intravitreal injection of AAV7m8p643 (codon-optimized Lebercilin) ​​at PN5; (A1-A3): resolution 12K, collage images show rows of photoreceptor cells, rods (arrow heads), cones (arrows), and many mitochondria (asterisks) of photoreceptor cells; (B), resolution 20K; (B1) cross-section of cilium showing 9+0 structure of microtubules, membrane disks from OS of rod cells (arrows); (C) resolution 30K, basal body (arrow); (C1) sagittal section of connecting cilium; (D) resolution 12K, photoreceptor cells do not remain on ONL; (D1) pyknotic nuclei of dead cells (arrow heads); (D2) floating debris of dead cell organelles, including rough ER (arrows).

[0031] Figure 8 Results are shown for pupillary light response of one retina of an adult male with LCA5 (red trace - top line) with similar temporal characteristics to an age-matched male with normal vision (blue trace - bottom line). The magnitude of constriction is reduced in LCA5 patients compared to normal individuals.

[0032] Fig. 9 is a table of various retinal layer thicknesses, which shows that the outer nuclear layer (ONL) thickness in the treated (*) retina remains thicker for at least 3 months compared to the control retina. There is no such obvious trend in the other retinal layers (outer plexiform layer: OPL; inner nuclear layer: INL; inner plexiform layer: IPL). For each time point, the bars from left to right represent the thickness of ONL, OPL, INL and IPL, respectively.

[0033] Fig.10 Results are presented for light-mediated changes in the location of phototransduction-specific molecules following injection with AAV7m8.hopt.LCA5.

[0034] Figures 11A-11B A plasmid map and feature list of the pAAV.CMV.CBA.human native Lebercilin vector is provided. The nucleic acid sequence is reproduced in SEQ ID NO:9.

[0035] Figures 12A-12FThe cilia phenotype rescued in homozygous human LCA5 p.(Q279*) iPSC-RPE after treatment with AAV7m8.hopt-LCA5 is shown. (A) Confocal images show the hexagonal morphology of mature RPE cells and RPE markers ZO-1 and MITF detectable by immunofluorescence. Phase contrast (PC) images show the construction of iPSC-RPE cultures derived from RPE of normal vision people and LCA5 patients; (B) Quantitative real-time PCR (qRT-PCR) of LCA5 mRNA expression in normal vision control RPE and RPE derived from LCA5 patients. GAPDH is used to normalize expression levels. (C) Western blot analysis shows endogenous (*) Lebercilin protein in untreated ("-") normal vision control cells or cells treated ("G") with AAV7m8.eGFP. There is no endogenous lebercilin in untreated or AAV7m8.GFP-treated LCA5 affected cells. Robust levels of lebercilin are present following infection of cells from normal-vision and LCA5 individuals treated with AAV7m8.LCA5 ("L"). Immunofluorescence analysis shows the presence of Arl13b-positive primary cilia in normal-vision (D) and LCA5-derived (E) iPSC-RPE. Lebercilin is present in normal-vision control and AAV7m8.LCA5-treated (but not AAV7m8.eGFP-treated) LCA5-affected cells. (F) Quantitative analysis of the number of cilia per cell in normal-vision versus LCA5-iPSC-RPE shows a rescue effect of cilia formation following treatment of LCA5-iPSC-RPE cells with AAV7m8.LCA5 (but not with AAV7m8.eGFP). DETAILED DESCRIPTION

[0036] The methods and compositions described herein relate to compositions and methods for delivering LCA5 nucleic acid sequences encoding Lebercilin proteins to subjects in need thereof to treat Leber's congenital amaurosis (LCA). In one embodiment, such compositions relate to codon optimization of Lebercilin coding sequences. It is desirable to improve the efficacy of the product, thereby improving safety, because lower doses of agents can be used. Compositions comprising a natural Lebercilin coding sequence as shown in SEQ ID NO: 2 are also contemplated herein.

[0037] Technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs and reference is made to the published literature, which provides those skilled in the art with a general guide to many of the terms used in this application. The definitions contained in this specification are provided for the purpose of clearly describing the components and compositions herein and are not intended to limit the claimed invention.

[0038] "Lebercilin" is encoded by the LCA5 gene on chromosome 6q14 and is a ciliary protein that localizes to the connecting cilia of photoreceptors and to the microtubules, centrioles, and primary cilia of cultured mammalian cells.

[0039] Lebercilin is widely expressed during development and is found in the cilia of cultured cells as well as in the connecting cilia of mature photoreceptor cells. The connecting cilium is a narrow structure between the inner segment of the photoreceptor, which carries the cell's biosynthetic machinery, and the outer segment, which contains the opsin-driven visual cascade. The connecting cilium serves as a conduit, supporting the bidirectional transport of proteins and vesicles along the ciliary microtubule track in a process called intraflagellar transport (IFT). By applying quantitative affinity proteomics to a genetically engineered Lca5 mouse model, Boldt et al. demonstrated that loss of Lca5 function disrupts IFT, thereby causing defects in photoreceptor outer segment development and failure of arrestin and opsin transport. Lca5 null (Lca5gt / gt) mice lack cone and rod ERG responses and undergo early and progressive retinal degeneration, with only a single row of dispersed nuclei (compared to 8-10 adjacent rows of cells in the retina of wild-type mice) present in the outer nuclear layer (ONL) by 2 months of age19.

[0040] Mutations in LCA5 result in an inherited form of retinal degeneration called Leber's congenital amaurosis (LCA). The phenotype in affected individuals is limited to the eyes and causes blindness. In 5 of the 6 families studied by den Hollander, homozygous nonsense and frameshift mutations were present and in one family LCA5 transcripts were completely absent. The nucleic acid encoding the Lebercilin cDNA or a codon-optimized version thereof is of appropriate size to fit into an adeno-associated virus (AAV) vector. See, e.g. Figure 1A and 1E To 1F and Figures 11A-11B As described in the examples below, using rAAV-mediated gene enhancement strategies, it was shown that retinal degeneration caused by LCA5 mutations can be corrected. This therapy is particularly advantageous if a wild-type or optimized copy of the gene is delivered early in life (e.g., in infancy or early postnatal life). In addition, in one embodiment, the intravitreal or subretinal administration used effectively delivers the gene to target cells (e.g., photoreceptors).

[0041] The Lebercilin gene LCA5 encoding Lebercilin (i.e., a 697 amino acid protein) is believed to be involved in centrosome or ciliary function and minus-end-directed microtubule transport. As used herein, the terms "LCA5" and "Lebercilin" are used interchangeably when referring to coding sequences. The natural nucleic acid sequence encoding human Lebercilin is reported in the NCBI reference sequences NM_181714.3 (transcript variant 1), NM_001122769.2 (transcript variant 2), XM_011535504.1 (transcript variant X1), and XM_005248665.4 (transcript variant X2), and is reproduced herein in SEQ ID NOs: 4, 5, 6, and 7, respectively. The natural human amino acid sequence of Lebercilin is reproduced herein in SEQ ID NO: 1 (NCBI Reference Sequence: NP_001116241.1 or NP_859065.2 and UniProtKB / Swiss-Prot ID: Q86VQ0-1). Mutations in the LCA5 gene are associated with Leber congenital amaurosis (LCA). In certain embodiments, the terms "LCA5" and "Lebercilin" are used interchangeably.

[0042] Leber congenital amaurosis (LCA) is an eye disorder that primarily affects the retina, a specialized tissue at the back of the eye that detects light and color. People with this condition usually have severe vision impairment beginning in infancy. The vision impairment tends to be stable, although it may worsen very slowly over time. LCA is also associated with other vision problems, including increased sensitivity to light (photophobia), involuntary eye movements (nystagmus), and extreme farsightedness (hyperopia). The pupils, which normally dilate and contract with the amount of light entering the eye, do not react normally to light. Instead, they dilate and contract more slowly than normal, or they do not react to light at all. In addition, the clear covering in front of the eye (cornea) may be cone-shaped and abnormally thin, a condition called keratoconus. A specific behavior called the Freund's finger-eye sign is characteristic of LCA. This sign consists of poking, pressing, and rubbing the eye with the knuckles or fingers. Researchers suspect that this behavior may lead to the deep-set eyes and keratoconus in affected children. In rare cases, developmental delays and intellectual disability have been reported in people with features of Leber congenital amaurosis. However, researchers are not sure whether these individuals truly have Leber congenital amaurosis or another syndrome with similar signs and symptoms. At least 13 types of Leber congenital amaurosis have been described. These types differ by their genetic causes, patterns of vision loss, and associated eye abnormalities.

[0043] The terms "percent identity (%)", "sequence identity", "percent sequence identity" or "percent identity" in the context of nucleic acid sequences refer to the residues of the same two sequences when aligned. The length of the sequence identity comparison can be optionally over a full-length genome, a full-length gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides. However, identity in smaller fragments, such as at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.

[0044] The percent identity of an amino acid sequence of a full-length protein, a polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof, or a corresponding nucleic acid sequence encoding sequence can be readily determined. Suitable amino acid fragments can be at least about 8 amino acids in length, and can be up to about 700 amino acids. Typically, when referring to "identity," "homology," or "similarity" between two different sequences, the "identity," "homology," or "similarity" is determined with reference to an "aligned" sequence. An "aligned" sequence or "alignment" refers to a plurality of nucleic acid sequences or protein (amino acid) sequences that typically contain corrections for deletions or extra bases or amino acids compared to a reference sequence.

[0045] Identity can be determined by preparing sequence alignments and by using a variety of algorithms and / or computer programs known or commercially available in the art [e.g., BLAST, ExPASy; ClustalO; FASTA; using, for example, the Needleman-Wunsch algorithm, the Smith-Waterman algorithm]. Alignment is performed using any of a variety of public or commercially available multiple sequence alignment programs. For amino acid sequences, sequence alignment programs such as "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME" and "Match-Box" programs can be used. Typically, any of these programs are used under default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can utilize another algorithm or computer program that provides at least the identity or alignment level provided by the reference algorithm and program. See, eg, JD Thomson et al., Nucl. Acids. Res., “A comprehensive comparison of multiple sequence alignments”, 27(13): 2682-2690 (1999).

[0046] Multiple sequence alignment programs can also be used for nucleic acid sequences. Examples of such programs include "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "BLAST", "MAP", and "MEME", which can be obtained through web servers on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, vector NTI utility is also used. Many algorithms are also known in the art for measuring nucleotide sequence identity, including those included in the programs described above. As another example, polynucleotide sequences can be compared using FastA TM (i.e., GCG version 6.1 program) for comparison. Fasta TM The alignment and sequence identity percentage of the best overlapping region between the query and search sequences are provided. For example, the sequence identity percentage between nucleic acid sequences can be calculated using Fasta with its default parameters as provided in GCG version 6.1 (word length of 6 and scoring matrix of NOPAM factor). TM to determine, which is incorporated by reference.

[0047] In one aspect, a codon-optimized, engineered nucleic acid sequence encoding human Lebercilin is provided. Preferably, the codon-optimized Lebercilin coding sequence has less than about 80% identity, preferably about 75% identity or less identity ( Figure 1B-1D, SEQ ID NO: 2). In one embodiment, the codon-optimized Lebercilin coding sequence has about 74% identity to the native Lebercilin coding sequence SEQ ID NO: 2. In one embodiment, the codon-optimized Lebercilin coding sequence is characterized by an improved translation rate after AAV-mediated delivery (e.g., rAAV) compared to native Lebercilin. In one embodiment, the codon optimized Lebercilin coding sequence shares less than about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61% or less identity with the full-length native Lebercilin coding sequence SEQ ID NO: 2. In one embodiment, the codon optimized nucleic acid sequence is a variant of SEQ ID NO: 3. In another embodiment, the codon optimized nucleic acid sequence is a sequence having about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61% or greater identity to SEQ ID NO: 3. In one embodiment, the codon optimized nucleic acid sequence is SEQ ID NO: 3. In another embodiment, the nucleic acid sequence is a codon optimized for expression in humans. In another embodiment, the lebercilin coding sequence is nt 1883 to nt 3976 of SEQ ID NO: 8. In other embodiments, a different Lebercilin coding sequence is selected.

[0048] Codon optimized coding region can be designed by various methods.This optimization can use the method (for example, GeneArt) that can be obtained online, disclosed method or the company that provides codon optimization service such as DNA2.0 (Menlo Park, CA) to perform.For example, in U.S. International Patent Publication No. WO 2015 / 012924, a kind of codon optimization method is described, and described patent is incorporated herein by reference in its entirety.Also referring to for example U.S. Patent Publication No. 2014 / 0032186 and U.S. Patent Publication No. 2006 / 0136184.Suitably, the whole length of the open reading frame (ORF) of the modified product.However, in some embodiments, the fragment of ORF can only be changed.By using one of these methods, frequency can be applied to any given peptide sequence, and produce the nucleic acid fragment of the codon optimized coding region of coded polypeptide.

[0049] Many selections can be used to perform actual changes in codons or for synthesizing the coding region of codon optimization designed as described herein. Such modifications or synthesis can be performed using standard and conventional molecular biological operations well known to those of ordinary skill in the art. In one method, a series of complementary oligonucleotide pairs each of 80 to 90 nucleotides in length and spanning the desired sequence length are synthesized by standard methods. These oligonucleotide pairs are synthesized so that they form double-stranded fragments containing sticky ends of 80 to 90 base pairs when annealed, for example, each oligonucleotide in the pair is synthesized to extend beyond the region complementary to another oligonucleotide in the pair 3, 4, 5, 6, 7, 8, 9, 10 or more bases. The single-stranded ends of each pair of oligonucleotides are designed to anneal together with the single-stranded ends of another pair of oligonucleotides. The oligonucleotide pairs are annealed, and then about five to six of these double-stranded fragments are annealed together via sticky single-stranded ends, then they are joined together and cloned into standard bacterial cloning vectors, such as those available from Invitrogen Corporation, Carlsbad, Calif. Vector. The construct is then sequenced by standard methods. Several of these constructs are prepared, which consist of 5 to 6 fragments of 80 to 90 base pair fragments joined together (i.e., fragments of about 500 base pairs) so that the entire desired sequence is presented in a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and joined together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and sequenced. Other methods are obvious to the skilled person. In addition, gene synthesis is readily available commercially.

[0050] "Engineering" means assembling and placing the nucleic acid sequence encoding the Lebercilin protein described herein in any suitable genetic element, such as naked DNA, bacteriophage, transposon, cosmid, episome, etc., which transfers the Lebercilin sequence carried thereon into a host cell, for example, for producing a non-viral delivery system (e.g., RNA-based system, naked DNA, etc.) or for producing a viral vector in a packaging host cell and / or for delivery to a host cell of a subject. In one embodiment, the genetic element is a plasmid. Methods for preparing such engineered constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0051] As used herein, the term "host cell" may refer to a packaging cell line in which a recombinant AAV is produced by a production plasmid. In an alternative, the term "host cell" may refer to any target cell in which the coding sequence needs to be expressed. Therefore, "host cell" refers to a prokaryotic or eukaryotic cell containing exogenous or heterologous DNA, which has been introduced into the cell by any of the following means, such as electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion technology, high-speed DNA coating precipitation, viral infection and protoplast fusion. In certain embodiments herein, the term "host cell" refers to a cell used to produce and package a viral vector or a recombinant virus. In other embodiments herein, the term "host cell" refers to a culture of eye cells of various mammalian species used for in vitro evaluation of the compositions described herein. Also, in other embodiments, the term "host cell" is intended to refer to the eye cells of a subject treated in vivo for LCA.

[0052] As used herein, the term "ocular cell" refers to any cell in the eye or associated with ocular function. The term can refer to any photoreceptor, including rod photoreceptors, cone photoreceptors, and photosensitive ganglion cells, retinal pigment epithelial (RPE) cells, Mueller cells, choroid cells, bipolar cells, horizontal cells, and amacrine cells. In one embodiment, the ocular cell is a photoreceptor. In another embodiment, the ocular cell is a cone photoreceptor. In another embodiment, the ocular cell is a rod photoreceptor.

[0053] In one embodiment, the nucleic acid sequence encoding Lebercilin further comprises a nucleic acid encoding a tag polypeptide covalently linked thereto. The tag polypeptide can be selected from known "epitope tags", including but not limited to myc tag polypeptides, glutathione-S-transferase tag polypeptides, green fluorescent protein tag polypeptides, myc-pyruvate kinase tag polypeptides, His6 tag polypeptides, influenza virus hemagglutinin tag polypeptides, flag tag polypeptides, and maltose binding protein tag polypeptides.

[0054] In another aspect, an expression cassette is provided, comprising a nucleic acid sequence encoding Lebercilin. In one embodiment, the sequence is a codon-optimized sequence. In another embodiment, the codon-optimized nucleic acid sequence is SEQ ID NO: 3 encoding human Lebercilin.

[0055] As used herein, "expression cassette" refers to a nucleic acid molecule comprising a coding sequence of a Lebercilin protein, a promoter, and may include other regulatory sequences, and the cassette may be packaged into a capsid of a viral vector (e.g., a virion). Typically, such an expression cassette for producing a viral vector comprises an LCA5 sequence as described herein, which is flanked by a packaging signal and other expression control sequences of a viral genome, such as those described herein. For example, for an AAV viral vector, the packaging signal is a 5' inverted terminal repeat (ITR) and a 3'ITR. When packaged into an AAV capsid, the ITR together with the expression cassette may be referred to herein as a "recombinant AAV (rAAV) genome" or "vector genome". In one embodiment, the expression cassette comprises a codon-optimized nucleic acid sequence encoding a Lebercilin protein. In one embodiment, the cassette provides a codon-optimized LCA5 operably combined with an expression control sequence, and the expression control sequence directs the expression of a codon-optimized nucleic acid sequence encoding Lebercilin in a host cell. In one embodiment, the vector genome is a sequence of nt 1-4379 of SEQ ID NO:8. In another embodiment, the vector genome is the sequence of nt 1-4368 of SEQ ID NO: 9. In yet another embodiment, the LCA5 coding sequence in any one of the identified vector genomes is exchanged with another LCA5 coding sequence as described herein.

[0056] In another embodiment, an expression cassette for use in an AAV vector is provided. In that embodiment, the AAV expression cassette includes at least one AAV inverted terminal repeat (ITR) sequence. In another embodiment, the expression cassette comprises a 5'ITR sequence and a 3'ITR sequence. In one embodiment, the 5' and 3'ITR flanks the codon-optimized nucleic acid sequence encoding Lebercilin, optionally with another sequence for instructing the expression of the codon-optimized nucleic acid sequence encoding Lebercilin in a host cell. Therefore, as described herein, the AAV expression cassette is intended to describe an expression cassette as described above that is flanked by a 5'AAV inverted terminal repeat (ITR) at its 5' end and by a 3'AAV ITR at its 3' end. Therefore, this rAAV genome contains the minimum sequence required for packaging the expression cassette into an AAV virion (i.e., AAV 5' and 3'ITR). AAV ITR can be obtained from the ITR sequence of any AAV as described herein. These ITRs may have the same AAV source as the capsid used in the resulting recombinant AAV or have different AAV sources (to produce an AAV pseudotype). In one embodiment, for the sake of convenience and accelerated regulatory approval, an ITR sequence from AAV2 or a deleted form thereof (ΔITR) is used. However, ITRs from other AAV sources can be selected. When the source of ITR is from AAV2 and the AAV capsid is from another AAV source, the resulting vector can be referred to as pseudotyped. Typically, the AAV vector genome comprises AAV 5'ITR, Lebercilin coding sequence and any regulatory sequence, and AAV 3'ITR. However, other configurations of these elements may be suitable. A shortened form of 5'ITR (called ΔITR) has been described in which the D-sequence and the terminal melting site (trs) are missing. In other embodiments, full-length AAV 5' and 3'ITR are used. Each rAAV genome can then be introduced into a production plasmid.

[0057] As used herein, the terms "regulatory sequence," "transcription control sequence," or "expression control sequence" refer to DNA sequences, such as initiator sequences, enhancer sequences, and promoter sequences, which induce, repress, or otherwise control the transcription of a protein-coding nucleic acid sequence to which it is operably linked.

[0058] As used herein, the term "operably linked" or "operably associated" refers to an expression control sequence adjacent to a nucleic acid sequence encoding Lebercilin and / or an expression control sequence that acts in trans or at a certain distance to control its transcription and expression.

[0059] In one aspect, a vector is provided comprising any expression cassette described herein. As described herein, such vectors can be plasmids from a variety of sources and in certain embodiments, are suitable for generating recombinant replication-defective viruses as further described herein.

[0060] As used herein, a "vector" is a nucleic acid molecule into which an exogenous or heterologous or engineered nucleic acid transgene can be inserted, which can then be introduced into an appropriate host cell. The vector preferably has one or more origins of replication and one or more sites into which the recombinant DNA can be inserted. Vectors often have a means for selecting vector cells from vector-free cells, for example, they encode drug resistance genes. Common vectors include plasmids, viral genomes, and (mainly in yeast and bacteria) "artificial chromosomes." Certain plasmids are described herein.

[0061] In one embodiment, the vector is a non-viral plasmid comprising the expression cassette, such as "naked DNA", "naked plasmid DNA", RNA and mRNA; coupled to various compositions and nanoparticles, including, for example, micelles, liposomes, cationic lipid-nucleic acid compositions, polysaccharide compositions and other polymers, lipid and / or cholesterol-based nucleic acid conjugates, and other constructs, as described herein. See, for example, X. Su et al., Mol. Pharmaceutics, 2011, 8(3), pp. 774-787; Web publication: March 21, 2011; WO2013 / 182683, WO 2010 / 053572 and WO 2012 / 170930, all of which are incorporated herein by reference. Such non-viral Lebercilin vectors can be administered by the routes described herein. Viral or non-viral vectors can be formulated with physiologically acceptable carriers for use in gene transfer and gene therapy applications.

[0062] In another embodiment, the vector is a viral vector comprising the expression cassette described therein. "Viral vector" is defined as a replication-defective virus containing an exogenous or heterologous LCA5 nucleic acid transgene. In one embodiment, the expression cassette as described herein can be engineered onto a plasmid, which is used for drug delivery or production of a viral vector. Suitable viral vectors are preferably replication-defective and selected from those targeting ocular cells. Viral vectors may include any virus suitable for gene therapy, including but not limited to adenovirus; herpes virus; lentivirus; retrovirus; parvovirus, etc. However, for ease of understanding, adeno-associated virus is cited as an exemplary viral vector in this article.

[0063] "Replication-defective virus" or "viral vector" refers to a synthetic or recombinant virus particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, wherein any viral genomic sequences also packaged in the viral capsid or envelope are replication-defective; that is, they cannot produce progeny virions, but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding enzymes required for replication (the genome can be engineered to be "gutless" - containing only the transgene of interest, flanked by signals required for amplification and packaging of the artificial genome), but these genes can be supplied during production. Therefore, it is considered safe for use in gene therapy because, in addition to the presence of the viral enzymes required for replication, replication and infection by progeny virions will not occur.

[0064] In another embodiment, a recombinant adeno-associated virus (rAAV) vector is provided. The rAAV comprises an AAV capsid and a vector genome packaged therein. In one embodiment, the vector genome comprises: (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a promoter; (c) a coding sequence encoding human Lebercilin; and (d) an AAV 3'ITR. In another embodiment, the vector genome is an expression cassette as described herein. In one embodiment, the LCA5 sequence encodes a full-length Lebercilin protein. In one embodiment, the Lebercilin sequence is the protein sequence SEQ ID NO: 1. In another embodiment, the coding sequence is SEQ ID NO: 3 or a variant thereof.

[0065] Adeno-associated virus (AAV), a member of the parvovirus family, is a small non-enveloped icosahedral virus with a single-stranded linear DNA genome of 4.7 kilobases (kb) to 6 kb. Known AAV serotypes are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, etc. ITR or other AAV components can be easily separated or engineered from AAV using techniques available to those skilled in the art. Such AAV can be separated, engineered or obtained from academic, commercial or public sources (e.g., American Type Culture Collection, Manassas, VA). Alternatively, AAV sequences can be engineered by synthesis or other suitable means, with reference to public sequences (such as those available in literature or databases such as GenBank, PubMed, etc.). AAV viruses can be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell-specific delivery of nucleic acid sequences, minimization of immunogenicity, adjustment of stability and particle life, effective degradation, precise delivery to the nucleus, etc.

[0066] AAV fragments can be easily used in a variety of vector systems and host cells. Ideal AAV fragments are cap proteins, including vp1, vp2, vp3 and hypervariable regions; rep proteins, including rep 78, rep 68, rep 52 and rep 40; and sequences encoding these proteins. Such fragments can be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs with non-naturally occurring capsid proteins. Such an artificial capsid can be produced by any suitable technique using the novel AAV sequences of the present invention (e.g., fragments of the vp1 capsid protein) in combination with heterologous sequences that can be obtained from another AAV serotype (known or novel), non-contiguous parts of the same AAV serotype, non-AAV viral sources, or non-viral sources. Artificial AAV serotypes may be, but are not limited to, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. In one embodiment, the vector contains the AAV8 cap and / or rep sequences of the invention. See, e.g., U.S. Patent Application Publication No. US2009 / 02270030, which is incorporated herein by reference.

[0067] As used herein, the term "AAV" or "AAV serotype" refers to many naturally occurring and available adeno-associated viruses and artificial AAVs. Among the AAVs isolated or engineered and fully characterized from humans or non-human primates (NHPs), human AAV2 is the first AAV developed as a gene transfer vector; it has been widely used in effective gene transfer experiments in different target tissues and animal models. Unless otherwise specified, AAV capsids, ITRs, and other selected AAV components described herein can be easily selected from any AAV, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8, and AAVAnc80, known or mentioned AAVs, or variants or mixtures thereof of any of the AAVs to be discovered. See, for example, WO 2005 / 033321, which is incorporated herein by reference. In another embodiment, the AAV capsid is an AAV8bp capsid, which preferentially targets bipolar cells. See, WO 2014 / 024282, which is incorporated herein by reference. In another embodiment, the AAV capsid is an AAV7m8 capsid, which has been shown to preferentially deliver to the outer retina. The AAV7m8 capsid nucleic acid sequence is reproduced in SEQ ID NO: 11 and the amino acid sequence is reproduced in SEQ ID NO: 12. See, Dalkara et al., In Vivo-Directed Evolution of a New Adeno-Associated Virus for Therapeutic OuterRetinal Gene Delivery from the Vitreous, Sci Transl Med 5, 189ra76 (2013), which is incorporated herein by reference.

[0068] As used herein, an "AAV7m8 capsid" is a self-assembled AAV capsid composed of multiple AAV7m8 vp (variable protein) proteins. The AAV7m8 vp protein is generally represented as an alternative splice variant encoded by at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% of the nucleic acid sequence SEQ ID NO: 11 or its encoding vp1 amino acid sequence SEQ ID NO: 12. These splice variants produce proteins of different lengths of SEQ ID NO: 12. In certain embodiments, an "AAV7m8 capsid" includes an AAV having an amino acid sequence that is 99% identical to SEQ ID NO: 12.

[0069] In another embodiment, the rAAV capsid is selected from AAV8 capsid or a variant thereof, AAV6 capsid or a variant thereof, AAV9 capsid or a variant thereof, AAV7 capsid or a variant thereof, AAV5 capsid or a variant thereof, AAV2 capsid or a variant thereof, AAV1 capsid or a variant thereof, AAV3 capsid or a variant thereof, and AAV4 capsid or a variant thereof. In one embodiment, a recombinant adeno-associated virus (rAAV) vector is provided, which comprises an AAV7m8 capsid and an expression cassette as described herein, wherein the expression cassette comprises a nucleic acid sequence encoding Lebercilin, an inverted terminal repeat sequence, and an expression control sequence directing the expression of Lebercilin in a host cell.

[0070] In still another embodiment, a recombinant adeno-associated virus (AAV) vector is provided for delivering LCA5 constructs and optimized sequences described herein. Adeno-associated virus (AAV) viral vectors are AAV DNase-resistant particles having an AAV protein capsid and a nucleic acid sequence packaged therein for delivery to target cells. The AAV capsid is composed of 60 capsid protein subunits VP1, VP2, and VP3, which are arranged in an icosahedral symmetry at a ratio of about 1:1:10 to 1:1:20 depending on the selected AAV. AAV can be selected as the source of the AAV viral vector capsid identified above. See, for example, U.S. Published Patent Application No. 2007-0036760-A1; U.S. Published Patent Application No. 2009-0197338-A1; EP 1310571. See also WO 2003 / 042397 (AAV7 and other monkey AAVs), U.S. Pat. No. 7,790,449 and U.S. Pat. No. 7,282,199 (AAV8), WO 2005 / 033321 and US 7,906,111 (AAV9), and WO 2006 / 110689, and WO 2003 / 042397 (rh.10) and (Dalkar a D, Byrne LC, Klimczak RR, Visel M, Yin L, Merigan WH et al. In vivo-directed evolution of a new adeno-associated virus for thera peutic outer retinal gene delivery from the vitreous. Sci Transl Med (2013) 5(189):189ra76. doi:10.1126 / scitranslmed.3005708.) (AAV7m8). Each of these documents is incorporated herein by reference. These documents also describe other AAV capsids, which can be selected for the production of AAV, and the documents are incorporated by reference. In some embodiments, the AAV cap used in the viral vector can be produced by mutagenesis (i.e., by insertion, deletion or substitution) of one of the above-mentioned AAV capsids or its encoding nucleic acid. In some embodiments, the AAV capsid is chimeric and contains domains from two or three or four or more of the above-mentioned AAV capsid proteins. In some embodiments, the AAV capsid is a chimera of Vp1, Vp2 and Vp3 monomers from two or three different AAVs or recombinant AAVs. In some embodiments, the rAAV composition comprises more than one of the above-mentioned Caps.

[0071] As used herein, with respect to AAV, the term variant means any AAV sequence derived from a known AAV sequence, including those sequences that share at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or greater sequence identity with an amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes a variant that may contain up to about 10% variation with any of the described or known AAV capsid sequences. That is, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity, or about 97% to about 98% identity with the AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with the AAV capsid. When determining the percent identity of the AAV capsid, any variable protein (e.g., vp1, vp2, or vp3) can be compared. In one embodiment, the AA V capsid shares at least 95% identity with AAV7m8 on vp1, vp2 or vp3. In another embodiment, the capsid is an AAV8 capsid with Y447F, Y733F and T494V mutations (also referred to as "AAV8 (C&G+T494V) and rep2-cap8 (Y447F+733F+T494V)") as described by Kay et al., Targeting Photoreceptors via Intravitreal Delivery Using Novel, Capsid-Mutated AAV Vectors, PLoS One. 2013; 8(4): e62097. Published online April 26, 2013, which is incorporated herein by reference.

[0072] In one embodiment, it is necessary to utilize AAV capsids, which demonstrate tropism to desired target cells such as photoreceptors (e.g., rods and / or cones), RPE or other eye cells. In one embodiment, the AAV capsid is a tyrosine capsid-mutant, in which some surface-exposed tyrosine residues are replaced by phenylalanine (F). This AAV variant is described in, for example, Mowat et al., Tyrosine capsid-mutant AAV vectors for gene delivery to the canineretina from a subretinal or intravitreal approach, Gene Therapy 21, 96-105 (January 2014), which is incorporated herein by reference.

[0073] As used herein, "artificial AAV" means, but is not limited to, AAV with a non-naturally occurring capsid protein. Such an artificial capsid can be produced by any suitable technique using a selected AAV sequence (e.g., a fragment of the vp1 capsid protein) in combination with a heterologous sequence, which can be obtained from a different selected AAV, a non-contiguous portion of the same AAV, a non-AAV viral source, or a non-viral source. Artificial AAV can be, but is not limited to, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. Pseudotyped vectors are suitable for use in the present invention, in which the capsid of one AAV is replaced by a heterologous capsid protein. In one embodiment, AAV2 / 5 and AAV2 / 8 are exemplary pseudotyped vectors.

[0074] In another embodiment, self-complementary AAV is used. "Self-complementary AAV" refers to a plasmid or vector with an expression cassette in which the coding region carried by the recombinant AAV nucleic acid sequence has been designed to form an intramolecular double-stranded DNA template. Once infected, the two complementary halves of scAAV will combine to form a double-stranded DNA (dsDNA) unit ready for immediate replication and transcription, rather than waiting for cell-mediated synthesis of the second chain. See, for example, DM McCarty et al., "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", Gene Therapy, (August 2001), Vol. 8, No. 16, pp. 1248-1254. Self-complementary AAV is described in, for example, U.S. Pat. Nos. 6,596,535; 7,125,717; and 7,456,683, each of which is incorporated herein by reference in its entirety.

[0075] The term "exogenous" is used to describe a nucleic acid sequence or protein, meaning that the nucleic acid or protein does not naturally exist in the location in which it exists in a chromosome or host cell. An exogenous nucleic acid sequence also refers to a sequence that is derived from and inserted into the same host cell or subject, but the sequence exists in a non-natural state, such as a different copy number, or under the control of a different regulatory element.

[0076] The term "heterologous" is used to describe a nucleic acid sequence or protein and means that the nucleic acid or protein originates from a different organism or a different species of the same organism than the host cell or subject in which the nucleic acid or protein is expressed. The term "heterologous" when used with respect to a protein or nucleic acid in a plasmid, expression cassette or vector means that the protein or nucleic acid is present with another sequence or subsequence to which the protein or nucleic acid in question does not occur in the same relationship in nature.

[0077] In yet another embodiment, an expression cassette, including any of those described herein, is used to produce a recombinant AAV genome.

[0078] In one embodiment, the expression cassette described herein is engineered into a suitable genetic element (vector), which is suitable for producing a viral vector and / or delivering to a host cell, such as naked DNA, bacteriophage, transposon, cosmid, episome, etc., which transfers the LCA5 sequence carried thereon. The selected vector can be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion technology, high-speed DNA coating precipitation, viral infection and protoplast fusion. The method for preparing such a construct is known to those skilled in the art of nucleic acid manipulation and includes genetic engineering, recombinant engineering and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.

[0079] With respect to packaging of the expression cassette or rAAV genome or production plasmid into virions, the ITRs are the only AAV components required in cis in the same construct as the expression cassette. In one embodiment, coding sequences for replication (rep) and / or capsid (cap) are removed from the AAV genome and supplied in trans or by a packaging cell line to produce an AAV vector.

[0080] Methods for producing and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, e.g., U.S. Pat. No. 7,790,449; U.S. Pat. No. 7,282,199; WO 2003 / 042397; WO 2005 / 033321; WO 2006 / 110689; and US 7,588,772 B2]. In one system, a production cell line is transiently transfected with a construct encoding a transgene flanked by ITRs and a construct encoding rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transiently transfected with a construct encoding a transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus herpes virus, thereby requiring separation of rAAV from contaminating viruses. More recently, systems have been developed that do not require infection with a helper virus to recover AAV - systems that also provide the desired helper functions in transit (i.e., adenovirus E1, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase). In these more recent systems, the helper functions can be provided by transiently transfecting cells with constructs encoding the desired helper functions, or cells can be engineered to stably contain genes encoding the helper functions, whose expression can be controlled at the transcriptional or post-transcriptional level.

[0081] The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it occurs in nature). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all coexisting materials in the natural system, is isolated, even if later reintroduced into the natural system. Such polynucleotides could be part of a vector and / or such polynucleotides or polypeptides could be part of a composition and they would still be isolated because such a vector or composition is not part of its natural environment.

[0082] In another system, an expression cassette flanked by ITRs and rep / cap genes is introduced into insect cells by infection with a baculovirus-based vector. For a review of these production systems, see, for example, Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of which are incorporated herein by reference in their entirety. Methods for making and using these and other AAV production systems are also described in the following U.S. Patents, the contents of each of which are incorporated herein by reference in their entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. See generally, e.g., Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol. 99: 119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J. Gene Med. 10: 717-733; and the references cited below, each of which is incorporated herein by reference in its entirety.

[0083] Methods for constructing any embodiment of the present invention are known to those with skills in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012). Similarly, methods for generating rAAV virions are well known, and selection of an appropriate method does not limit the present invention. See, e.g., K. Fisher et al., (1993) J. Virol., 70: 520-532 and U.S. Pat. No. 5,478,745.

[0084] "Plasmids" are generally designated herein by a lowercase p in front and / or followed by uppercase letters and / or numbers according to standard nomenclature conventions well known to those skilled in the art. Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those skilled in the art. In addition, the skilled artisan can readily construct any number of other plasmids suitable for use in the present invention. The properties, construction, and use of such plasmids, as well as other vectors in the present invention, will be readily apparent to those skilled in the art from this disclosure.

[0085] In one embodiment, the production plasmid is as described herein or as described in WO2012 / 158757, which is incorporated herein by reference. Various plasmids for producing rAAV vectors are known in the art and are suitable for use herein. The production plasmid is cultured in a host cell expressing AAV cap and / or rep proteins. In the host cell, each rAAV genome is rescued and packaged into capsid proteins or envelope proteins to form infectious virions.

[0086] In one aspect, a production plasmid is provided, comprising an expression cassette as described above. In one embodiment, the production plasmid is as shown in SEQ ID NO: 8 and Figure 1E-1F As shown in, it is called p643. This plasmid is used in the example of generating a rAAV-human codon-optimized Lebercilin vector. This plasmid is a plasmid containing a 5'AAV ITR sequence; a selected promoter; a polyA sequence; and a 3'ITR; in addition, it also contains a stuffer sequence, such as λ. In another embodiment, the stuffer sequence keeps the rAAV vector genome at the following size: between about 3 kilobases (kb) to about 6 kb, about 4.7 kb to about 6 kb, about 3 kb to about 5.5 kb, or about 4.7 kb to 5.5 kb. In one embodiment, the non-coding λ stuffer region is included in the vector backbone. An example of p643 containing a Lebercilin coding sequence can be found in SEQ ID NO:8. In another embodiment, the production plasmid is as Figures 11A-11B and SEQ ID NO:9. In another embodiment, the production plasmid is modified to optimize the vector plasmid production efficiency. Such modifications include adding other neutral sequences, or deleting one or more portions of the entire lambda stuffer sequence to adjust the supercoiling level of the vector plasmid. Such modifications are contemplated herein. In other embodiments, terminators and other sequences are included in the plasmid.

[0087] In certain embodiments, the rAAV expression cassette, vector (such as rAAV vector), virus (such as rAAV), production plasmid comprises AAV inverted terminal repeat sequence, codon-optimized nucleic acid sequence encoding Lebercilin, and expression control sequence directing the expression of the encoded protein in the host cell. In other embodiments, the rAAV expression cassette, virus, vector (such as rAAV vector), production plasmid further comprises one or more of the following: intron, Kozak sequence, polyA, post-transcriptional regulatory element, etc. In one embodiment, the post-transcriptional regulatory element is a woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE).

[0088] Expression cassettes, vectors and plasmids contain other components that can be optimized for a specific species using techniques known in the art, including, for example, codon optimization as described herein. Components of cassettes, vectors, plasmids and viruses or other compositions described herein contain a promoter sequence as part of an expression control sequence. In another embodiment, the promoter is cell-specific. The term "cell-specific" means that a specific promoter selected for a recombinant vector can direct the expression of an optimized Lebercilin coding sequence in a specific ocular cell type. In one embodiment, the promoter is specific for expression of a transgene in photoreceptor cells. In another embodiment, the promoter is specific for expression in rods and cones. In another embodiment, the promoter is specific for expression in rods. In another embodiment, the promoter is specific for expression in cones. In one embodiment, the photoreceptor-specific promoter is the human rhodopsin kinase promoter. The rhodopsin kinase promoter has been shown to be active in both rods and cones. See, e.g., Sun et al., Gene Therapy with a Promoter Targeting Both Rods and Cones Rescues Retinal Degeneration Caused by AIPL1 Mutations, Gene Ther. 2010 Jan; 17(1): 117-131, which is incorporated herein by reference in its entirety. In one embodiment, the promoter is modified to add one or more restriction sites, thereby facilitating cloning.

[0089] In another embodiment, the promoter is the human rhodopsin promoter. In one embodiment, the promoter is modified to include terminal restrictions for cloning. See, for example, Nathans and Hogness, Isolation and nucleotide sequence of the gene encoding human rhodopsin, PNAS, 81:4851-5 (August 1984), which is incorporated herein by reference in its entirety. In another embodiment, the promoter is a portion or fragment of the human rhodopsin promoter. In another embodiment, the promoter is a variant of the human rhodopsin promoter.

[0090] Other exemplary promoters include the human G protein coupled receptor protein kinase 1 (GRK1) promoter (Genbank accession number AY327580). In another embodiment, the promoter is a 292nt fragment (positions 1793-2087) of the GRK1 promoter (see, Beltran et al., Gene Therapy 2010 17: 1162-74, which is incorporated herein by reference in its entirety). In another preferred embodiment, the promoter is the human inter-photoreceptor retinoid binding protein proximal (IRBP) promoter. In one embodiment, the promoter is a 235nt fragment of the hIRBP promoter. In one embodiment, the promoter is the RPGR proximal promoter (Shu et al., IOVS, May 2102, which is incorporated herein by reference in its entirety). Other promoters suitable for use in the present invention include, but are not limited to, the rod opsin promoter, the red and green opsin promoter, the blue opsin promoter, the cGMP-β-phosphodiesterase promoter (Qgueta et al., IOVS, Invest Ophthalmol Vis Sci. 2000 Dec; 41(13):4059-63), the mouse opsin promoter (Beltran et al. 2010 cited above), the rhodopsin promoter (Mussolino et al., Gene Ther, 2011 Jul, 18(7):637-45); the alpha subunit of cone transducin (Morrissey et al., BMCDev, Biol, 2011 Jan, 11:3); the beta phosphodiesterase (PDE) promoter; the retinitis pigmentosa (RP1) promoter (Nicord et al., J. Gene Med, 2007 Dec, 9(12):1015-23); the NXNL2 / NXNL1 promoter (Lambard et al., PLoS One, October 2010, 5(10):el3025), RPE65 promoter; chronic retinal degeneration / peripheral protein 2 (Rds / perph2) promoter (Cai et al., Exp Eye Res. 2010 August; 91(2):186-94); and VMD2 promoter (Kachi et al., Human Gene Therapy, 2009(20:31-9)). Each of these documents is incorporated herein by reference in its entirety. In another embodiment, the promoter is selected from the human EF1α promoter, rhodopsin promoter, rhodopsin kinase, inter-photoreceptor binding protein (IRBP), cone opsin promoter (red, green, blue), cone opsin upstream sequence containing red and green cone locus control region, cone transduction and transcription factor promoter (neural retinal leucine zipper (Nrl) and photoreceptor-specific nuclear receptor Nr2e3, bZIP).

[0091] In another embodiment, the promoter is a ubiquitous or constitutive promoter. An example of a suitable promoter is a hybrid chicken β-actin (CBA) promoter with a cytomegalovirus (CMV) enhancer element, such as Figure 1E-1F In another embodiment, the promoter is the CB7 promoter. Other suitable promoters include human β-actin promoter, human elongation factor-1α promoter, cytomegalovirus (CMV) promoter, simian virus 40 promoter and herpes simplex virus thymidine kinase promoter. See, for example, Damdindorj et al., (August 2014) A Comparative Analysis ofConstitutive Promoters Located in Adeno-Associated Viral Vectors.PLoS ONE 9(8):e 106472. Still other suitable promoters include viral promoters, constitutive promoters, and regulatable promoters [see, for example, WO 2011 / 126808 and WO 2013 / 04943]. Alternatively, promoters responsive to physiological triggers can be used in expression cassettes, rAAV genomes, vectors, plasmids and viruses described herein. In one embodiment, the promoter has a small size, under 1000 bp, due to the size limitation of the AAV vector. In another embodiment, the promoter is under 400 bp. Other promoters can be selected by those skilled in the art.

[0092] In yet another embodiment, the promoter is selected from the group consisting of the SV40 promoter, the dihydrofolate reductase promoter, and the phosphoglycerol kinase (PGK) promoter, the rhodopsin kinase promoter, the rod opsin promoter, the red-green opsin promoter, the blue opsin promoter, the inter-photoreceptor binding protein (IRBP) promoter, and the cGMP-β-phosphodiesterase promoter, the bacteriophage lambda (PL) promoter, the herpes simplex virus (HSV) promoter, the tetracycline-controlled transactivator responsive promoter (tet) system, the long terminal repeat (LTR) promoter such as RSV LTR, MoMLV LTR, BIV LTR, or HIV LTR, U3 region promoter of Moloney murine sarcoma virus, granzyme A promoter, regulatory sequences of metallothionein genes, CD34 promoter, CD8 promoter, thymidine kinase (TK) promoter, B19 parvovirus promoter, PGK promoter, glucocorticoid promoter, heat shock protein (HSP) promoter such as HSP65 and HSP70 promoter, immunoglobulin promoter, MMTV promoter, Rous sarcoma virus (RSV) promoter, lac promoter, CaMV 35S promoter, nopaline synthase promoter, MND promoter or MNC promoter. The promoter sequences thereof are known to those skilled in the art or are publicly available, such as in the literature or in databases such as GenBank, PubMed, etc.

[0093] In another embodiment, the promoter is an inducible promoter. The inducible promoter can be selected from known promoters, including rapamycin / rapamycin analog promoters, ecdysone promoters, estrogen-responsive promoters, and tetracycline-responsive promoters, or heterodimerization repressor switches. See Sochor et al., An Autogenously Regulated Expression System for Gene Therapeutic Ocular Applications. Scientific Reports, November 24, 2015; 5: 17105 and Daber R, Lewis M., A novel molecular switch. J Mol Biol. August 28, 2009; 391 (4): 661-70, Epub June 21, 2009, both of which are incorporated herein by reference in their entirety.

[0094] In yet another embodiment, the promoter is a chicken β-actin promoter having a nucleic acid sequence of nt 546 to nt 283 of SEQ ID NO.8.

[0095] In other embodiments, expression cassettes, vectors, plasmids and viruses described herein contain other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; TATA sequences; sequences that stabilize cytoplasmic mRNA; sequences that improve translation efficiency (i.e., Kozak consensus sequences); introns; sequences that improve protein stability; and, when desired, sequences that increase secretion of the encoded product. An expression cassette or vector may not contain any one or more of the elements described herein.

[0096] Examples of suitable polyA sequences include, for example, synthetic polyA or polyA from bovine growth hormone (bGH), human growth hormone (hGH), SV40, rabbit β-globulin (RGB) or modified RGB (mRGB). In another embodiment, poly A has a nucleic acid sequence of nt 3993 to nt 4200 of SEQ ID NO:8.

[0097] Examples of suitable enhancers include, for example, CMV enhancer, RSV enhancer, alpha-fetoprotein enhancer, TTR minimal promoter / enhancer, LSP (TH binding globulin promoter / α1-microglobulin / bikunin enhancer), APB enhancer, ABPS enhancer, αmic / bik enhancer, TTR enhancer, en34, ApoE, etc. In one embodiment, the enhancer has a nucleic acid sequence of nt 241 to nt 544 of SEQ ID NO: 8.

[0098] In one embodiment, a Kozak sequence is included upstream of the Lebercilin coding sequence to enhance translation from the correct start codon. In another embodiment, CBA exon 1 and introns are included in the expression cassette. In one embodiment, the Lebercilin coding sequence is placed under the control of a hybrid chicken beta actin (CBA) promoter. This promoter is composed of the cytomegalovirus (CMV) immediate early enhancer, the proximal chicken beta actin promoter, and CBA exon 1 flanked by intron 1 sequences.

[0099] In another embodiment, the intron is selected from CBA, human beta globulin, IVS2, SV40, bGH, alpha-globulin, beta-globulin, collagen, ovalbumin, p53, or a fragment thereof.

[0100] In one embodiment, the expression cassette, vector, plasmid and virus contain a 5'ITR, a chicken beta-actin (CBA) promoter, a CMV enhancer, CBA exon 1 and introns, a human codon-optimized Lebercilin sequence, bGH poly A and a 3'ITR. In another embodiment, the expression cassette comprises nt 1 to 4379 of SEQ ID NO:8. In still another embodiment, the 5'ITR has a nucleic acid sequence of nt 1 to nt 130 of SEQ ID NO:8 and the 3'ITR has a nucleic acid sequence of nt 4250 to nt 4379 of SEQ ID NO:8. In yet another embodiment, the CBA exon 1 and introns have a nucleic acid sequence of nt 824 to nt 1795 of SEQ ID NO:8. In yet another embodiment, the production plasmid has the sequence SEQ ID NO:8, also shown in Figure 1E-1F In yet another embodiment, the production plasmid has the sequence SEQ ID NO: 9, also shown in Figures 1A-11B middle.

[0101] On the other hand, a method for treating Leber's congenital amaurosis caused by a lebercilin gene defect and / or restoring visual function in a subject with LCA comprises delivering a vector (such as rAAV) encoding Lebercilin as described herein to a subject in need thereof. In one embodiment, a method for treating a subject with LCA using rAAV as described herein is provided.

[0102] "Administering" as used in the method means delivering the composition to selected target cells characterized as LCA. In one embodiment, the method involves delivering the composition to RPE, photoreceptor cells or other ocular cells by subretinal injection. In another embodiment, intravitreal injection is performed to the subject. In another embodiment, subretinal injection is performed to the subject. In still another method, intravascular injection can be used, such as injection via a palpebral vein. Those skilled in the art may select other methods of administration in view of the present disclosure.

[0103] "Administration" or "route of administration" is the delivery of the compositions described herein to a subject, with or without a pharmaceutical carrier or excipient. If desired, routes of administration may be combined. In some embodiments, the administration is repeated regularly. The pharmaceutical compositions described herein are designed to be delivered to a subject in need thereof by any suitable route or a combination of different routes. In some embodiments, delivery is adopted directly to the eye (optionally via ocular delivery, subretinal injection, intraretinal injection, intravitreal, topical) or via systemic routes, such as intravascular, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal and other parenteral routes of administration. Nucleic acid molecules, expression cassettes and / or vectors described herein may be delivered in a single composition or in multiple compositions. Optionally, two or more different AAVs, or multiple viruses [see, e.g., WO20 2011 / 126808 and WO 2013 / 049493] may be delivered, and in another embodiment, multiple viruses may contain different replication-defective viruses (e.g., AAV and adenovirus) alone or in combination with proteins.

[0104] Also provided herein are pharmaceutical compositions. The pharmaceutical compositions described herein are designed to be delivered to a subject in need thereof by any suitable route or combination of different routes. These delivery means are designed to avoid direct systemic delivery of a suspension containing an AAV composition described herein. Suitably, this may have the following benefits: reduced dosage compared to systemic administration, reduced toxicity, and / or reduced undesirable immune responses to AAV and / or transgenic products.

[0105] In still other aspects, these nucleic acid sequences, vectors, expression cassettes and rAAV viral vectors are suitable for use in pharmaceutical compositions, which also contain pharmaceutically acceptable carriers, excipients, buffers, diluents, surfactants, preservatives and / or adjuvants, etc. This pharmaceutical composition is used to express optimized Lebercilin in host cells by delivery via this recombinantly engineered AAV or artificial AAV.

[0106] In order to prepare these pharmaceutical compositions containing nucleic acid sequences, vectors, expression cassettes and rAAV viral vectors, the sequences or vectors or viral vectors are preferably evaluated for contamination by conventional methods and then formulated into pharmaceutical compositions suitable for administration to the eye. Such preparations involve the use of pharmaceutically and / or physiologically acceptable vehicles or carriers, particularly those suitable for administration to the eye, such as buffered saline or other buffers, such as HEPES, so that pH is maintained at an appropriate physiological level, and optionally other pharmaceutical agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, diluents, surfactants or excipients, etc. With regard to injection, the carrier is generally a liquid. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free phosphate buffered saline. A variety of such known carriers are provided in U.S. Patent Publication No. 7,629,322, which is incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is a balanced salt solution. In one embodiment, the carrier includes tween. If the virus is to be stored long term, it can be frozen in the presence of glycerol or Tween 20.

[0107] In certain embodiments, for administration to a human patient, the rAAV is suitably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or salt mixture. Suitably, the formulation is adjusted to a physiologically acceptable pH, for example, in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8. Since the pH of cerebrospinal fluid is about 7.28 to about 7.32, a pH within this range may be required for intrathecal delivery, while a pH of 6.8 to about 7.2 may be required for intravitreal or subretinal delivery. However, for other delivery routes, other pHs within this broadest range or these subranges may be selected.

[0108] Suitable surfactants or combinations of surfactants can be selected from non-toxic nonionic surfactants. In one embodiment, a difunctional block copolymer surfactant with primary hydroxyl groups as terminal groups is selected, such as F68 [BASF], also known as poloxamer 188, has a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers, i.e., nonionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)) may be selected; SOLUTOL HS15 (Macrogol-15 hydroxystearic acid); LABRASOL (polyoxycaprylyl glyceride); polyoxyl 10 oleyl ether; TWEEN (polyoxyethylene sorbitan fatty acid esters); ethanol and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are generally named with the letter "P" (for poloxamer) followed by three numbers: the first two numbers x 100 give the approximate molecular weight of the polyoxypropylene core, and the last number x 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005% to about 0.001% of the suspension.

[0109] In one embodiment, the formulation may contain, for example, a buffered saline solution comprising one or more of the following in water: sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate-7H2O), potassium chloride, calcium chloride (e.g., calcium chloride-2H2O), disodium phosphate, and mixtures thereof. Suitably, for intrathecal delivery, the osmotic pressure is within a range compatible with cerebrospinal fluid (e.g., about 275 to 290); see, e.g., emedicine.medscape.com / article / 2093316-overview. Optionally, for intrathecal delivery, a commercially available diluent may be used as a suspending agent or combined with another suspending agent and other optional excipients. See, e.g., Elliotts solution [Lukare Medical]. In other embodiments, the formulation may contain one or more penetration enhancers. Examples of suitable penetration enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, or EDTA.

[0110] In another embodiment, the composition comprises a carrier, a diluent, an excipient and / or an adjuvant. Taking into account the indications for which the transfer virus is intended, a person skilled in the art can easily select a suitable carrier. For example, a suitable carrier includes saline, which can be prepared with a variety of buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should include components that prevent rAAV from sticking to the infusion tube but do not hinder the in vivo binding activity of rAAV.

[0111] Optionally, the composition of the present invention may contain other conventional pharmaceutical ingredients in addition to rAAV and a carrier, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol, and p-chlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0112] The composition according to the invention may comprise a pharmaceutically acceptable carrier as defined above. Suitably, the composition described herein comprises an effective amount of one or more AAVs suspended in a pharmaceutically suitable carrier and / or mixed with a suitable excipient designed for delivery to a subject via injection, an osmotic pump, an intrathecal catheter, or by another device or route. In one embodiment, the composition is formulated for intravitreal delivery. In one embodiment, the composition is formulated for subretinal delivery.

[0113] In an exemplary specific embodiment, the composition of the carrier or excipient contains 180 mM NaCl, 10 mM NaPi, pH 7.3, with 0.0001%-0.01% Pluronic F68 (PF68). The exact composition of the saline component of the buffer is in the range of 160 mM to 180 mM NaCl. Optionally, a different pH buffer (perhaps HEPES, sodium bicarbonate, TRIS) is used instead of the specifically described buffer. Alternatively, a buffer containing 0.9% NaCl is useful.

[0114] In the case of AAV viral vectors, quantification of genome copies ("GC"), vector genomes ("VG") or viral particles can be used as a measure of the dose contained in the formulation or suspension. Any method known in the art can be used to determine the number of genome copies (GC) of the replication-defective viral composition of the present invention. One method of titrating the number of AAV GC is as follows: first, a purified AAV vector sample is treated with DNase to remove unencapsulated AAV genomic DNA or contaminating plasmid DNA from the production process. The DNase-resistant particles are then subjected to heat treatment to release the genome from the capsid. The released genome is then quantified by real-time PCR using a primer / probe set targeting a specific region of the viral genome (usually a poly A signal). In another method, the effective dose of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding an optimized Lebercilin coding sequence is measured as described in SKMcLaughlin et al., 1988 J. Virol., 62: 1963, which is incorporated herein by reference in its entirety.

[0115] As used herein, the term "dose" may refer to the total dose delivered to a subject during treatment or the amount delivered in a single unit (or multiple units or divided doses) administration. The pharmaceutical viral composition may be formulated in a dosage unit so that each dose contains the following amount of a replication-defective virus carrying a codon-optimized nucleic acid sequence encoding Lebercilin as described herein: at about 1.0 x 10 9 GC to about 1.0x10 15 In one embodiment, the composition is formulated so that each dose contains at least 1x10 9 , 2x10 9 , 3x10 9 , 4x10 9 , 5x10 9 , 6x10 9 , 7x10 9 , 8x10 9 or 9x10 9 GC, including all integer or fractional amounts within the range. In another embodiment, the composition is formulated so that each dose contains at least 1x10 10 , 2x10 10 , 3x10 10 , 4x10 10 , 5x10 10 , 6x10 10 , 7x10 10 , 8x10 10 or 9x10 10 GC, including all integer or fractional amounts within the range. In another embodiment, the composition is formulated so that each dose contains at least 1x10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 or 9x10 11 GC, including all integer or fractional amounts within the range. In another embodiment, the composition is formulated so that each dose contains at least 1x10 12 , 2x10 12 , 3x10 12 , 4x10 12 , 5x10 12 , 6x10 12 , 7x10 12 , 8x10 12 or 9x10 12GC, including all integer or fractional amounts within the range. In another embodiment, the composition is formulated so that each dose contains at least 1x10 13 , 2x10 13 , 3x10 13 , 4x10 13 , 5x10 13 , 6x10 13 , 7x10 13 , 8x10 13 or 9x10 13 GC, including all integer or fractional amounts within the range. In another embodiment, the composition is formulated so that each dose contains at least 1x10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 or 9x10 14 GC, including all integer or fractional amounts within the range. In another embodiment, the composition is formulated so that each dose contains at least 1x10 15 , 2x10 15 , 3x10 15 , 4x10 15 , 5x10 15 , 6x10 15 , 7x10 15 , 8x10 15 or 9x10 15 GC, including all integer or fractional amounts within the range. In one embodiment, for human use, the dosage may be 1x10 10 About 1x10 12 The range of GC, including all integer or fractional amounts within the range. All doses can be measured by any known method, including by oqPCR or droplet digital PCR (ddPCR), as described in, for example, M. Lock et al., Hum Gene Ther Methods. April 2014; 25 (2): 115-25. doi: 10.1089 / hgtb.2013.131, which is incorporated herein by reference.

[0116] In one embodiment, an aqueous suspension suitable for administration to a LCA patient is provided. The suspension comprises an aqueous suspending fluid and about 1 x 10 10 The GC or virus particles of the recombinant adeno-associated virus (rAAV) described herein are about 1×1012 The recombinant adeno-associated virus is suitable for use as a therapeutic agent for LCA.

[0117] It may also be desirable to administer multiple "booster" doses of the pharmaceutical compositions of the invention. For example, booster doses may be delivered at 6 month intervals, or annually after the first administration, depending on the duration of the transgene within the ocular target cells. The fact that AAV neutralizing antibodies cannot be generated by administration of rAAV vectors should allow for additional booster administrations.

[0118] Such booster doses and the need therefor can be monitored by the attending physician using, for example, retinal and visual function tests and visual behavioral tests described in the examples below. Other similar tests can be used to determine the status of the treated subject over time. The appropriate test can be selected by the attending physician. Alternatively, the methods of the present invention can also involve injecting larger volumes of virus-containing solutions in single or multiple infections to allow visual function levels to approach those seen in the wild-type retina.

[0119] In another embodiment, the amount of the vectors, viruses and replication-defective viruses described herein carrying the codon-optimized nucleic acid sequence encoding Lebercilin is about 1.0 x 10 7 VG to about 1.0x10 per eye 15 In one embodiment, the amount is at least 1x10 per eye. 7 , 2x10 7 , 3x10 7 , 4x10 7 , 5x10 7 , 6x10 7 , 7x10 7 , 8x10 7 or 9x10 7 VG, including all integer or fractional amounts within the range. In one embodiment, the amount is at least 1x10 8 , 2x10 8 , 3x10 8 , 4x10 8 , 5x10 8 , 6x10 8 , 7x10 8 , 8x10 8 or 9x10 8 VG, including all integer or fractional amounts within the range. In one embodiment, the amount is at least 1x10 9 , 2x10 9 , 3x10 9 , 4x10 9, 5x10 9 , 6x10 9 , 7x10 9 , 8x10 9 or 9x10 9 VG, including all integer or fractional amounts within the range. In one embodiment, the amount is at least 1x10 10 , 2x10 10 , 3x10 10 , 4x10 10 , 5x10 10 , 6x10 10 , 7x10 10 , 8x10 10 or 9x10 10 VG, including all integer or fractional amounts within the range. In one embodiment, the amount is at least 1x10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 or 9x10 11 VG, including all integer or fractional amounts within the range. In one embodiment, the amount is at least 1x10 12 , 2x10 12 , 3x10 12 , 4x10 12 , 5x10 12 , 6x10 12 , 7x10 12 , 8x10 12 or 9x10 12 VG, including all integer or fractional amounts within the range. In one embodiment, the amount is at least 1x10 13 , 2x10 13 , 3x10 13 , 4x10 13 , 5x10 13 , 6x10 13 , 7x10 13 , 8x10 13 or 9x10 13 VG, including all integer or fractional amounts within the range. In one embodiment, the amount is at least 1x10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x1014 , 6x10 14 , 7x10 14 , 8x10 14 or 9x10 14 VG, including all integer or fractional amounts within the range. In one embodiment, the amount is at least 1x10 15 , 2x10 15 , 3x10 15 , 4x10 15 , 5x10 15 , 6x10 15 , 7x10 15 , 8x10 15 or 9x10 15 GC, including all integer or fractional amounts within the range. In one embodiment, the method comprises 1x10 9 About 1x10 13 In another embodiment, the method comprises delivering the carrier in an aqueous suspension. In another embodiment, the method comprises delivering the carrier in a volume of about or at least 150 microliters at 1×10 9 Up to 1x10 13 The rAAV described herein is administered at a dose of 100 GC to restore visual function in the subject. All doses can be measured by any known method, including by oqPCR or droplet digital PCR (ddPCR), as described in, for example, M. Lock et al., Hum Gene Ther Methods. 2014 April; 25(2): 115-25. doi: 10.1089 / hgtb.2013.131, which is incorporated herein by reference.

[0120] These doses described above can be administered in different volumes of carrier, excipient or buffer formulations, ranging from about 25 to about 1000 microliters, including all values ​​within this range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient or buffer is at least about 25 μL. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 75 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In still another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 225 μL. In still another embodiment, the volume is about 250 μL. In still another embodiment, the volume is about 275 μL. In still another embodiment, the volume is about 300 μL. In still another embodiment, the volume is about 325 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 375 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 550 pL. In another embodiment, the volume is about 600 pL. In another embodiment, the volume is about 650 pL. In another embodiment, the volume is about 700 μL. In another embodiment, the volume is about 800 μL. In another embodiment, the volume is between about 150 and 800 μL. In another embodiment, the volume is between about 700 and 1000 μL. In another embodiment, the volume is between about 250 and 500 μL.

[0121] In one embodiment, the viral construct may be at least 1x10 9 to at least 1x10 11 A dose of GC is delivered to a small animal subject such as a mouse in a volume of about 1 μL to about 3 μL. For larger veterinary subjects with eyes that are roughly the same size as human eyes, larger human doses and volumes are useful. For a discussion of good practices for administering substances to various veterinary animals, see, e.g., Diehl et al., J. Applied Toxicology, 21: 15-23 (2001). This document is incorporated herein by reference.

[0122] It is best to use the lowest effective concentration of virus or other delivery vehicle to reduce the risk of undesirable effects (such as toxicity, retinal dysplasia and detachment). Still other dosages within these ranges may be selected by the attending physician after considering the following factors: the physical condition of the subject (preferably a human) being treated, the age of the subject, the extent of LCA and the development of the disorder (if progressive).

[0123] Another aspect described herein is a method for treating, delaying or stopping the progression of LCA in a mammalian subject. In one embodiment, a rAAV carrying a natural, modified or codon-optimized sequence of Lebercilin, preferably suspended in a physiologically compatible carrier, diluent, excipient and / or adjuvant, may be administered to a desired subject, including a human subject. This method includes administering any of the following to a subject in need: a nucleic acid sequence, an expression cassette, an rAAV genome, a plasmid, a vector or an rAAV vector or a composition containing them. In one embodiment, the composition is delivered subretinal. In another embodiment, the composition is delivered intravitreally. In still another embodiment, the composition is delivered using a combination of administration routes suitable for treating LCA, and may also involve administration via the palpebral vein or other intravenous or conventional administration routes.

[0124] With regard to use in these methods, the volume and viral titer of each dose are determined separately, as further described herein, and may be the same or different from other treatments performed in the ipsilateral or contralateral eye. The attending physician may determine dosage, administration, and regimen after considering the teachings of this specification. In one embodiment, the composition is administered in a single dose selected from those listed above in the affected eye. In another embodiment, the composition is administered simultaneously or sequentially as a single dose selected from those listed above in two affected eyes. Sequential administration may mean that the time interval between administrations from one eye to the other is minutes, hours, days, weeks, or months. In another embodiment, the method involves administering two or more doses (e.g., divided doses) of a composition to the eye. In another embodiment, multiple injections are performed in different parts of the same eye. In another embodiment, the second administration of rAAV comprising a selected expression cassette (e.g., a cassette containing LCA5) is performed at a later time point. Such time points may be weeks, months, or years after the first administration. In one embodiment, this second administration is performed with an rAAV having a capsid different from that of the rAAV administered for the first time. In another embodiment, the rAAV administered for the first and second times has the same capsid.

[0125] In still other embodiments, the compositions described herein may be delivered in a single composition or in multiple compositions. Optionally, two or more different AAVs, or multiple viruses [see, e.g., WO 2011 / 126808 and WO 2013 / 049493] may be delivered, and in another embodiment, the multiple viruses may contain different replication-defective viruses (e.g., AAV and adenovirus).

[0126] In certain embodiments of the present invention, non-invasive retinal imaging and functional studies are required to identify the area of ​​rod and cone photoreceptors that the therapy will target and test the efficacy of the treatment. In these embodiments, clinical diagnostic tests are used to determine the precise location of one or more subretinal injections. These tests may include electroretinograms (ERGs), perimetry, topographic mapping of the retinal layers, and measurement of the thickness of each layer by means of confocal laser tomography ophthalmoscopy (cSLO) and optical coherence tomography (OCT), cone density topographic mapping via adaptive optics (AO), functional ophthalmology, multi-electrode arrays (MEA), pupil light response, etc., depending on the type of subject being treated, its physical condition and health, and dosage. In view of imaging and functional studies, in some embodiments of the present invention, one or more injections are performed in the same eye to target different areas of the affected eye. The volume and viral titer of each injection are determined separately, as further described herein, and may be the same or different from other injections performed in the ipsilateral or contralateral eye. In another embodiment, a single larger volume injection is performed to treat the entire eye. In one embodiment, the volume and concentration of the rAAV composition are selected so that only areas of damaged ocular cells are affected. In another embodiment, the volume and / or concentration of the rAAV composition is a larger amount so as to reach more parts of the eye, including non-damaged photoreceptors.

[0127] In another embodiment, the method includes performing additional studies, e.g., functional and imaging studies, to determine therapeutic efficacy. For examination in animals, such tests include retinal and visual function assessment via electroretinogram (ERG) to investigate rod and cone photoreceptor function, optokinetic nystagmus, pupillometry, water maze test, light-dark preference, optical coherence tomography (to measure the thickness of the various layers of the retina), histology (retinal thickness, rows of nuclei in the outer nuclear layer, immunofluorescence to document transgene expression, cone photoreceptor counts, staining of retinal sections with peanut agglutinin - which identifies cone photoreceptor sheaths).

[0128] Specifically, for human subjects, after administration of the doses of the compositions described in this specification, the subjects are tested for treatment efficacy using the following means: electroretinogram (ERG) to check rod and cone photoreceptor function, pupillometry visual acuity, contrast sensitivity color vision test, visual field test (Humphrey visual field / Gotmann visual field), visual field test mobility test (obstacle course), and reading speed test. Other useful post-treatment efficacy tests to which the subjects are exposed after treatment with the pharmaceutical compositions described herein are functional magnetic resonance imaging (fMRI), full-field light sensitivity test, retinal structure studies, including optical coherence tomography, fundus photography, fundus autofluorescence, adaptive optics laser scanning ophthalmoscopy, mobility test, reading speed and accuracy test, microperimetry and / or ophthalmoscopy. These and other efficacy tests are described in U.S. Pat. No. 8,147,823; co-pending International Patent Application Publication Nos. WO 2014 / 011210 or WO 2014 / 124282, which are incorporated by reference.

[0129] In one embodiment of the methods described herein, a one-time intraocular delivery of a composition as described herein (e.g., an optimized AAV delivery of an LCA5 cassette) is suitable for treating LCA in a subject. In another embodiment of the methods described herein, a one-time intraocular delivery of a composition as described herein (e.g., an optimized AAV delivery of an LCA5 cassette) is suitable for treating LCA in a subject at risk.

[0130] Therefore, in one embodiment, the composition is applied before the onset of the disease. In another embodiment, the composition is applied before the onset of visual impairment or loss. In another embodiment, the composition is applied after the onset of visual impairment or loss. In still another embodiment, compared with non-diseased eyes, when less than 90% of the rods and / or cones or photoreceptors function normally or are retained, the composition is applied. In one embodiment, neonatal treatment is defined as applying the Lebercilin coding sequence, expression cassette or vector as described herein within 8 hours, the first 12 hours, the first 24 hours or the first 48 hours of delivery. In another embodiment, especially for primates (human or non-human), neonatal delivery is within a period of about 12 hours to about 1 week, 2 weeks, 3 weeks or about 1 month or after about 24 hours to about 48 hours. In another embodiment, the composition is delivered after the onset of symptoms. In one embodiment, treatment of the patient (e.g., first injection) begins before the first year of life. In another embodiment, treatment begins after 1 year old, or after 2 to 3 years old, after 5 years old, after 11 years old or at a greater age. In one embodiment, treatment begins at about 4 years old to about 12 years old. In one embodiment, treatment begins at or after about 4 years of age. In one embodiment, treatment begins at or after about 5 years of age. In one embodiment, treatment begins at or after about 6 years of age. In one embodiment, treatment begins at or after about 7 years of age. In one embodiment, treatment begins at or after about 8 years of age. In one embodiment, treatment begins at or after about 9 years of age. In one embodiment, treatment begins at or after about 10 years of age. In one embodiment, treatment begins at or after about 11 years of age. In one embodiment, treatment begins at or after about 12 years of age. However, treatment may begin at or after about 15 years of age, about 20 years of age, about 25 years of age, about 30 years of age, about 35 years of age, or about 40 years of age. In one embodiment, intrauterine treatment is defined as administering a composition described herein to a fetus. See, e.g., David et al., Recombinant adeno-associated virus-mediated in utero gene transfer gives therapeutic transgene expression in the sheep, Hum Gene Ther. 2011 Apr;22(4):419-26. doi:10.1089 / hum.2010.007. Epub 2011 Feb 2, which is incorporated herein by reference.

[0131] In another embodiment, the composition is re-administered at a later date. Optionally, more than one re-administration is permitted. Such re-administration may be with the same type of vector, a different viral vector, or via non-viral delivery as described herein. In one embodiment, the vector is re-administered to a different portion of the retina to which the patient was initially injected. In one embodiment, the vector is re-administered to the same portion of the retina to which the patient was initially injected.

[0132] In still another embodiment, any of the above methods may be combined with another or second therapy. The second therapy may be any currently known or so far unknown therapy that helps prevent, prevent or improve these mutations or defects or any effects related thereto. The second therapy may be administered before, at the same time as, or after the administration of the composition as described above. In one embodiment, the second therapy involves non-specific methods for maintaining retinal cell health, such as administering neurotrophic factors, antioxidants, anti-apoptotic agents. Non-specific methods are achieved by injecting proteins, recombinant DNA, recombinant viral vectors, stem cells, fetal tissue, or genetically modified cells. The latter may include encapsulated genetically modified cells.

[0133] In one embodiment, a method for producing recombinant rAAV comprises obtaining a plasmid containing an AAV expression cassette as described above and culturing a packaging cell carrying the plasmid in the presence of viral sequences sufficient to allow packaging of the AAV viral genome into an infectious AAV envelope or capsid. Specific methods for rAAV vector generation are described above and can be used to produce rAAV vectors that can deliver codon-optimized LCA5 in an expression cassette and genome as described above and in the Examples below.

[0134] In certain embodiments of the invention, the subject suffers from Leber's congenital amaurosis (LCA), and the components, compositions and methods of the invention are designed to treat the condition. As used herein, the term "subject" means a mammal, including humans, veterinary or farm animals, livestock or pets, and animals commonly used in clinical studies. In one embodiment, the subject of these methods and compositions is a human. Still other suitable subjects include, but are not limited to, rodents, rats, dogs, cats, pigs, cattle, sheep, non-human primates, and the like. As used herein, the terms "subject" and "patient" are used interchangeably.

[0135] As used herein, the term "treatment" or "treating" is defined to encompass the administration of one or more compounds or compositions described herein to a subject for the purpose of improving one or more symptoms of LCA. "Treatment" may therefore include one or more of the following in a given subject: reducing the onset or progression of LCA; preventing the disease; reducing the severity of disease symptoms; or slowing its progression, including the progression of blindness; eliminating disease symptoms; delaying the onset of the disease or monitoring the progression of the disease or the efficacy of therapy.

[0136] It should be noted that the term "a / an" refers to one or more. Therefore, the terms "a / an", "one or more", and "at least one" are used interchangeably herein.

[0137] The words "comprise / comprises / comprising" are to be interpreted inclusively rather than exclusively. The words "consist / consisting" and variations thereof are to be interpreted exclusively rather than inclusively. Although various embodiments in the specification are presented using "comprising" language, in other cases, the relevant embodiments are also intended to be interpreted and described using "consisting of" or "consisting essentially of" language.

[0138] As used herein, "disease," "disorder," and "condition" are used interchangeably to refer to an abnormal state in a subject.

[0139] Unless otherwise indicated, the terms "about" or "~" as used herein refer to a 10% difference from a given reference value.

[0140] As used herein, the term "modulate" or variations thereof refers to the ability of a composition to inhibit one or more components of a biological pathway.

[0141] Unless otherwise defined in this specification, technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art and with reference to the published text, which provides a general guide for those skilled in the art to many of the terms used in this application.

[0142] Example

[0143] The following examples are for illustrative purposes only and are not intended to limit the present invention.

[0144] Example 1: Recombinant rAAV and in vitro expression studies

[0145] Retinal gene transfer has been carried out using the most fully studied recombinant AAV serotype AAV2 in >310 eyes of human subjects and in 29 different clinical trials (clinicaltrials.gov). These trials target different diseases, including autosomal defects (retinitis pigmentosa, choroideremia, achromatopsia caused by RPE65 defects, MERTK mutations), mitochondrial diseases (Leber's hereditary optic neuropathy), complications (choroidal neovascularization) of age-related macular degeneration and late retinal degeneration (using optogenetic therapy). In most of these studies (18 / 29 or 18 in 22 studies using AAV and subretinal injection), the goal is to effectively target RPE cells. The final result is to obtain a large amount of safety data about intraocular injection of AAV. Subretinal injection is the same surgical method, which will be necessary for the photoreceptors in targeting LCA5 patients.

[0146] Based on the information obtained, great efforts have been made to develop a way to defeat LCA5 and other diseases involving primary photoreceptor defects. Unfortunately, AAV2 vectors cannot effectively target photoreceptors, and as mentioned above, photoreceptors comprise the major cell type in LCA5 and most other inherited retinal degenerations. For this reason, AAV7m8, a vector generated by evolutionary design, was chosen. This vector has been shown to effectively target photoreceptors in different species (mouse and non-human primates (NHPs)) and using different routes of administration.

[0147] The efficacy reported herein included improvements in the ability of treated animals to navigate using visual cues, restoration of visual pathways to the brain as shown by pupillometry, reduction in photoreceptor apoptosis, and preservation of functional photoreceptors with morphology and markers characteristic of this cell type, including the presence of rhodopsin in the outer retina. Treated Lca5gt / gt photoreceptors showed a thicker outer nuclear layer, well-preserved outer segments, and stacked outer segment disks. This was in stark contrast to untreated Lca5gt / gt retinas, which were reduced to a single row of noncontiguous photoreceptor nuclei by 3 months of age19. The improvements were not permanent. However, they persisted for at least 3 months, at which time no photoreceptors were preserved in untreated Lca5gt / gt mice. Electroretinogram and MEA results showed successful transduction of photoreceptors, with LCA5 gene therapy able to at least partially restore responses mediated by rod and cone photoreceptors. Cellular responses had near-normal kinetics, including responses that reflected the activity of multiple ganglion cell types and a reversal of the dominant melanopsin responses observed in untreated retinas. These results complement the pupillometry and visual behavior studies and will provide a framework for future studies aimed at further characterizing and optimizing the therapeutic effect, including visual behavior studies under low light conditions. These data offer hope that genetic enhancement approaches similar to those used in Lca5gt / gt mice can improve vision in humans. Interventions may be further optimized to achieve even more durable rescue effects. Modifications of the components of the transgenic cassette (promoter, etc.) and of the retinal area treated may provide additional benefits. Dosing studies should identify the optimal dose for therapeutic effect. The fact that LCA5 null patients retain photoreceptors until adulthood (whereas photoreceptors are lost early in life in mice) suggests that there may be a wider window of opportunity in LCA5 humans compared with Lca5- / - mice. Photoreceptors have been documented in the foveal outer nuclear layer of LCA5 null humans for up to 30 years. This is important because successful gene therapy requires the presence of affected cells. We were able to show that the photoreceptors retained in adults with LCA5 mutations exhibited a similar pattern of light response times (although with reduced amplitude) as those in normal-sighted individuals. These results suggest that despite the structural and physiological defects in LCA5 patients, the remaining photoreceptors are still functional. iPSC-RPE derived from LCA5 mutant patients had far fewer primary cilia than those from control cells. The fact that ciliary defects in photoreceptors of Lca5gt / gt mice could be corrected by gene enhancement therapy and the number of cilia could be increased to normal levels suggests that it may be possible to improve ciliary defects present in humans with this condition.

[0148] A. Recombinant AAV

[0149] At the Center for Advanced Retinal and Ocular Therapeutics (CAR OT), recombinant AAV was produced using the AAV7m8 capsid, which is known to infect photoreceptors more efficiently than AAV2 (Dalkara D, Byrne LC, Klimczak RR, Vis el M, Yin L, Merigan WH et al. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous. Sci Transl Med (2013) 5(189):189ra76. doi:10.1126 / scitranslmed.3005708.) An optimized cDNA encoding human (h) wild-type lebercilin (hopt.LCA5) was custom designed for optimal codon usage and synthesized by DNA2.0 (Menlo Park, CA). The LCA5 cDNA was placed under the control of the hybrid chicken β-actin (CBA) exon 1 flanked by intron 1 sequences and possessing a cytomegalovirus (CMV) immediate early enhancer ( Figure 1A and 1E ). The bovine growth hormone poly (A) is after the cDNA. To prevent the packaging (i.e., non-transgene containing) vector from reversing the AAV2 inverted terminal repeats, a long stuffer sequence was included. The vector was made by triple transfection and formulated in an excipient consisting of phosphate buffered saline (PBS) containing 0.001% Pl uronic F68 (PF68). See, e.g., Mizukami, Hiroaki et al. A Protocol for AAV vector production and purification. Diss. Division of Genetic Therapeutics, Center for Molecular Medicine, 1998. A control vector was incorporated with enhanced green fluorescent protein (eGFP) cDNA instead of LCA5 cDNA.

[0150] rAAV was tested by Western blot for expression of transgenic protein of appropriate size. 8431 cells were plated at 2x10 6 Two days after plating, AAV7m8.hopt.LCA5 (or AAV7m8.CBA.EGFP as a control) was used at 1×10 5or 5x10 5 Cells were transduced at 400 μg. After 48 hours, cells were harvested and processed for electrophoresis and Western blotting. Antibodies included LCA5 rabbit polyclonal antibody (Proteintech, Rosemont, IL) and signals were quantified, with each value corrected for background and protein loading differences by normalization with GAPDH immunosignal.

[0151] The AAV7m8.CBA.hopt.LCA5 virus was able to drive efficient expression of the LCA5 transgene in 8431 cells. Production of the predicted ~81 kDA Lebercilin protein following infection with AAV7m8.CBA.hopt.LCA5 demonstrated a dose-dependent response.

[0152] Example 2: Study on LCA Mouse Model Lca5- / - Mice

[0153] Developing proof-of-concept gene augmentation therapy in the Lca5gt / gt mouse model requires several challenges: 1) Because retinal degeneration begins early and progresses rapidly, intervention must be performed in newborn mice; 2) Because this is a photoreceptor-specific disease, photoreceptors must be effectively targeted using recombinant AAV vectors. The AAV2 vectors that target RPE cells, which are widely used in animal and human studies, do not target photoreceptors as effectively as other AAV serotypes, as shown by comparing transduction of different serotypes after infection with equal doses. Ideally, therapies that can ultimately advance to human clinical trials should be developed; and 3) outcome measures that can accurately identify and quantify improvements in retinal and visual function must be developed, which are so low at baseline that they are difficult to score. Here, a recombinant AAV vector (AAV7m8) designed by directed evolution was used to deliver a codon-optimized cDNA encoding human lebercilin. By using AAV7m8 to deliver LCA5 to diseased photoreceptors early in life, we found that gene augmentation therapy resulted in both structural improvements in the retina and functional improvements in vision in Lca5gt / gt mice.

[0154] Lebercilin is localized to the connecting cilia of photoreceptor cells (22). The connecting cilium is a transition zone between the inner segment of the photoreceptor cell and the antenna-like outer segment, supporting the selective transport of proteins and membrane vesicles. Thus, the connecting cilium serves as a conduit that supports bidirectional protein transport along the ciliary microtubule track, or intraflagellar transport (IFT). Using quantitative affinity proteomics (affinity purification, mass spectrometry, and bioinformatic analysis) and genetically engineered mouse models, Boldt et al. demonstrated that LCA5 mutations impair IFT, (22) thereby causing early-onset defects in photoreceptor outer segment development and an inability to properly transport two different proteins specifically expressed in photoreceptors, namely arrestins and opsins. Knockout of the Lca5 gene in mice produces a retinal degeneration phenotype. Lca5- / - mice develop depigmented retinal patches, never develop outer segments, and lack cone and rod ERG responses to light. There is early and rapidly progressive retinal degeneration and only a single (pathological) row of nuclei is present in the ONL by 2 months of age. (22) Therefore, Lca5- / - mice were used as an animal model of LCA.

[0155] Adult Lca5 gt / gt (Lca5- / -) mice were purchased from Jackson Labs (Bar Harbor, ME) and the strain was generated by crossbreeding of brother and sister. The genotypes of all animals used in the study were verified (see Supplementary Methods). Mice were kept on a 12-hour light / 12-hour dark cycle and food / water were provided ad libitum. These studies were conducted in compliance with federal and institutional regulations.

[0156] Subretinal injections were performed unilaterally in neonatal mice as described previously (28) in a cohort of pups. Mice were anesthetized with hypothermia on postnatal day 5 (PN5). Animals were anesthetized with ketamine / xylazine on postnatal day 15 (PN15). Table 1 shows the number of animals used per cohort.

[0157] Intravitreal injections of AAV7m8 were also performed, as this vector has been previously shown to penetrate the mouse retina from the vitreous surface to reach target photoreceptors. (25) In cohort 1, a total of 9.20 x 10 9 vg injection of AAV7m8.CBA.hopt.LCA5. The injection solution contained 5% v / v of AAV7m8.CBA.EGFP so that the injection area could be positively confirmed at a later time point by the presence of enhanced green fluorescent protein (EGFP). Additional animals received a sham injection (cohort 2), received an injection of AAV7m8.CBA.EGFP alone (cohort 3), or remained uninjected as a control (cohort 4). After injection, pups were returned to their mothers until weaning.

[0158] Table 1. Cohorts of neonatal Lca5- / - mice injected at the indicated postnatal days (PN) and studied in vivo. ROA - route of administration.

[0159]

[0160] Ophthalmoscopy was performed approximately 1 month after injection and confirmed a clear stroma, no retinal detachment, and therefore no surgical complications. Any animal with corneal or vitreous opacities was excluded from further studies.

[0161] The mouse cohorts were housed and studied and injected at early postnatal (PN5) and juvenile (PN15) time points (Table 1). The injections were largely free of complications. After PN5 injections, most animals were found to have no corneal or vitreous opacities that would have interfered with further testing. The few animals with opacities were excluded from further analysis.

[0162] AAV7m8.CβA.hopt-LCA5 virus can be administered intravitreally (IVT) and subretinally (SR), respectively. Figure 1C and 1D ) and then drive the efficient expression of human LCA5 transgene in the mouse retina ( Figure 1A and 1B Western blot analysis showed production of the predicted ~81 kDa LCA5 protein following intraocular delivery of AAV7m8.CβA.hopt-LCA5 at PN20 in Lca5gt / gt and wild-type mice ( Figure 1B Immunofluorescence analysis showed the presence of lebercilin protein in the ONL, inner segment (IS), and connecting cilium (CC) of wild-type adult retinas ( Figure 1E After intravitreal or subretinal injection of AAV7m8.CβA.hopt-LCA5 in Lca5gt / gt retinas, lebercilin was found in the CC as well as in the IS and ONL ( Figure 1G and 1H In contrast, lebercilin was absent in sham-injected Lca5gt / gt retinas ( Figure 1F In addition, after IVT injection, a large number of Muller cells produced lebercilin ( Figure 1G ).

[0163] Example 3: Retinal / visual function testing

[0164] Tests of vision and retinal function included the light-cued water maze (2-3 months post-injection), pupillometry (2.5 months post-injection), multi-electrode array (3 months post-injection), and electroretinography using mice as indicated and described in Example 2. The retina was then evaluated for histopathology and immunofluorescence as described in Example 4. A comprehensive histological analysis was subsequently performed.

[0165] A. Electroretinogram

[0166] We recorded ERGs from 8 Lca5gt / gt mice, 5 wild-type animals, and 16 Lca5gt / gt mice whose left eyes had been injected intravitreally with vehicle at PN5 and whose right eyes had been injected intravitreally with AAV7m8.CβA.hopt-LCA5. None of the Lca5gt / gt uninjected control eyes or the Lca5gt / gt eyes injected with vehicle (32 eyes total) produced detectable ERG responses. Of the 16 eyes injected with AAV7m8.CβA.hopt-LCA5, four showed ERG responses to dim flashes consistent with rod mediation of the signal in the dark-adapted state and mixed rod-cone responses to brighter flashes that resembled a smaller, reduced version of the wild-type (WT) mixed rod-cone ERG waveform (Fig. S2). Light-adapted ERGs were also detectable in these eyes, suggesting cone mediation of the light-adapted response. The amplitude of detectable ERGs after treatment ranged from 20 to 25% of WT amplitude (Fig. S2). The results suggest restoration of rod and cone photoreceptor function in some animals after gene therapy. The inconsistency of full-field ERG results may reflect incomplete retinal coverage and / or tissue damage (cataracts, unresolved detachments, etc.) maintained after these technically challenging subretinal injections (performed early postnatally). The results were significantly different from the undetectable ERGs observed in untreated Lca5gt / gt eyes, but were variable or uncommon in extent. B. Water maze navigation studies

[0167] By water maze test, the ability of each animal to identify the chamber containing the submerged platform in a 5-chamber water maze was assessed (Figure 11). Before the test, the device was kept in a room without external light and the light source was placed directly on the platform. The dark-adapted mice were released at the center of the maze and given 60 seconds without interruption to find and place all four paws on the light platform.

[0168] Training was performed under room light (about 200 Lux), then the mice were adapted to the dark and tested under dim light. During training, if the mice could not find the platform at the end of 60 seconds, the experimenter guided the mice to the platform. In each trial, the light and platform were randomly placed in different chambers.

[0169] The training pass criterion was defined as the ability of the mouse to independently enter the correct chamber within 60 seconds without straying to a different chamber and to step onto the platform in more than 5 out of 9 consecutive trials. All mice were trained for 5 days, regardless of the day on which the training pass criterion was met. A 4-day test was performed using the same procedure used in training, but the brightness of the light source was further reduced by a series of filters. By using filters, the brightness was: 1.06x10 5 ,8.69x10 3 ,5.87x10 2 scot cd m 2 , or with the lights off, the brightness is 0scot cd m 2 .

[0170] Animals were trained at 2-2.5 months of age and then tested in a light-cued water maze. The light-cued water maze test showed that the groups injected subretinal or intravitreal with AAV7m8.CBA.hopt.LCA5 performed significantly better than controls (Table 2B; see bold values; Figure 3). Figure 2A The raw data, i.e., the number of animals analyzed in each cohort, were then tested using the water maze at the indicated light levels. Table 2B shows the results of the statistical analysis using one-way analysis of variance (ANOVA). The treated animals were able to 3 scot cd m 2 passed the test, whereas animals from the control vehicle-injected cohort did not (p<0.01).

[0171] Table 2. Results of water maze test in Lca5- / - mice

[0172]

[0173] C. pupillary light reflex

[0174] The amplitude of pupil constriction was measured during a series of 10 flashes in each eye. The flash intensity was 1,000 scotlux. The PLR ​​was defined as the maximum amplitude of the pupil constriction response in the time interval 0.6-1.2 seconds after the flash, exceeding 3 standard deviations of the pre-stimulus diameter. A scientist blinded to the treatment modality evaluated the data of each animal before analysis to ensure that each pupil was accurately tracked. If not, the specific animal was excluded from further analysis.

[0175] For statistical analysis, compare the normalized pupil diameter of the control (left) Lca5- / -eye from the treatment (right) and contralateral sham injection at each light intensity. By dividing the normalized contraction amplitude of the treated eye by the amplitude of the untreated eye, the maximum difference amplitude (MDAR) percentage of the reaction can be obtained. The higher the percentage of MDAR, the stronger the reaction to the intervention. Other age-matched untreated Lca5- / - and wild-type (C57B1 / 6) mice are used as positive and negative controls, respectively. The MDAR of untreated Lca5- / - and C57B1 / 6 mice is about 0, due to the minimum difference between the two eyes.

[0176] Additional analyses assessed the magnitude of pupil constriction in the right eyes of the different cohorts of mice. Thus, the magnitude of constriction could be compared between treated and untreated Lca5- / - mice and untreated C57Bl / 6 mice.

[0177] Analysis of the amplitude of the pupillary light reflex produced by stimulation of treated vs. control eyes revealed a significant (p<0.05) improvement in pupillary reflex amplitude in eyes of Lca5- / - mice treated subretinally or intravitreally with AAV7m8.hopt-LCA5 compared to untreated control Lca5- / - animals (Figure 2). Figure 2A , 2B , 2H, and 2I) and a significant improvement in pupillary light reflex (PLR) was detected in animals injected with subretinal delivery at PN15, but there was also a trend towards improvement with intravitreal delivery ( Figure 2H and 2I ).

[0178] D. Multi-electrode array

[0179] Five animals received a unilateral intravitreal injection of AAV7m8.CMV / CBA.hopt.LCA5 spiked with 5% (v / v) AAV7m8.CBA.GFP (approximately 9.87 x 10 10vg / eye) 2.5-3.5 months after, these animals were tested by multi-electrode array (MEA). The contralateral eye was sham-injected and used as a negative control. Five untreated age-matched wild-type (WT) C57B1 / 6 mice served as positive controls. The retinas of light-adapted mice were dissected under red light, and ganglion cells were fixed unilaterally downward in a multi-hole MEA chamber. The presence of GFP in the explants confirmed the exposure of photoreceptors to AAV. Calibrated full-field flashes of 455nm light of different intensities (efficiency of pigment excitation is about 40%: rhodopsin and M-opsin; about 0.2%: S-opsin) were used for light stimulation (2s flash at 0.1Hz or 50ms flash at 4Hz). Data were analyzed using custom code in Matlab (MatLab, Natick, MA); spike potential sorting was performed in Plexon Offline Sorter (Plexon, Dallas, TX). AAV7m8.CβA.hopt-LCA5 was probed using multi-electrode array (MEA) analysis at PN5. The rationale for using MEA is that it measures the output signals sent by the retina to the brain and, therefore, provides information about retinal wiring in addition to testing photoreceptor function. Of the 5 retinas / animal tested with MEA, two had clearly detectable rod and cone ERGs (see representative recordings in Figure S2), one had residual subtle, ~10 V ERGs, and two did not have any detectable ERGs. Three of the 5 AAV7m8.CBA.hopt.LCA5-injected retinas had strong light responses on MEA testing, one showed a median response, and 1 showed a minimal response ( Figure 5A -D). The response becomes detectable at dark-adapted intensities (42-112 photons*s -1 *μm -2 Or on average, 8.28e1 hv / μm 2 ; 455nm) and passes 2.00e9 photons*s -1 *μm -2Assuming that the collecting area of ​​rods and cones for endpoint illumination is about 1 μm at the wavelength of peak sensitivity2,23,24 (note that in the ERG and our MEA experiments, light enters the retina from the ganglion cell side) and that the efficiency of stimulation of rhodopsin and M- and S-cone opsins by 455 nm light is about 60%, 50%, and 0.3%, respectively,25-27 dim light that produced clearly detectable responses in our experiments produced less than 70 photoisomerizations per cell per second in rods, less than 60 in M-cones, and about 0.3 photoisomerizations per second in S-cones. Pipette recording data show that at this pigment firing rate, rods can generate detectable light responses (response amplitudes exceeding 20% ​​of the maximum), whereas cone responses are expected to be at least 20-fold smaller than under the most favorable conditions (dark-adapted Mcones in rod-transducin knockout retinas) and should be undetectable in rod-dominated mouse retinas25,26,28 (note that the collection area at lateral illumination in pipette recordings is approximately 0.5 μm-2 for rods and 0.2 μm-2 for cones). Thus, in our experiments, the observation of light responses at a dimmer range of intensities confirms the restoration of rod function in treated Lca5gt / gt retinas. Responses at the brighter end of the intensity should originate from cones (in M- and S-cones, the brightest intensities should exceed the capacity of M- and S-cones to generate approximately 1.00e9 and 6.00e6 photoisomerizations per cell per second, respectively). As expected for rod / cone driven responses, dark-adapted responses disappeared, but light-adapted responses were not significantly affected, following exposure to the brightest stimulus series at the end of the first intensity series (photosensitive retinas were subjected to at least 2 intensity series ranging from dim dark-adapted to brightest light-adapted intensities in ∼0.5 log increments) ( Figure 5C and D). WT and treated Lca5gt / gt retinas also responded to 4 Hz flicker stimulation at intensities expected to drive cone responses (data not shown). Retinas from sham-injected contralateral eyes showed minimal to absent responses, with high spontaneous discharges and a prominent melanopsin response.

[0180] Slow melanopsin-driven responses were also detected in AAV7m8.CβA.hopt-LCA5-treated Lca5gt / gt retinas and retinas from wild-type mice (manifested as an increase in firing rate at the onset of the second flash, attributed to slow recovery after the first flash in a series), and the melanopsin response appeared to be abrogated in treated retinas compared to untreated ones.

[0181] Table 3. Summary of MEA responses in treated and control Lca5- / - mice

[0182]

[0183] Both treated Lca5- / - retinas had signs of post-injection damage and exhibited no light responses despite strong spontaneous discharges.

[0184] The responses of AAV7m8.CBA.hopt.LCA5 treated retinas were similar to those of untreated wild-type retinas. One treated retina tested after the shortest post-injection period showed reduced light sensitivity and the absence of OFF-responses and sustained ON-responses ( Figure 5D The development of OFF-responses appeared to require a longer time post-injection than ON-responses, consistent with the increased variability in the amplitude of OFF-responses across the 10 treated retinas. Functionality of all ganglion cell types identified in WT retinas under full-field stimulation was detected in Lca5gt / gtAAV-treated retinas after spike sorting (Fig. S10). Both dark-adapted and light-adapted stimulation (up to the brightest intensity, approximately 100 mW / cm 2 As expected for rod / cone driven responses, dark-adapted responses disappeared after exposure to the brightest light, whereas light-adapted responses were not significantly affected (data not shown).

[0185] The responses of AAV7m8.hopt.LCA5 treated retinas became detectable at dark adaptation intensities (42-112 photons*s-1*μm-2 or on average, 8.28e1 hv / μm2; 455nm) and strong responses were observed by the brightest light adaptation intensity of 2.00e9 photons*s-1*μm-2. The retinas of the sham injected contralateral eyes showed minimal to abolished responses (data not shown. Control Lca5- / -). The responses in AAV7m8.hopt.LCA5 treated retinas were similar to those in the wild-type mouse retinas. The flicker responses showed that the light adaptation responses were not significantly affected after exposure to the brightest light (2E9hv / cm2) (data not shown, Lca5- / - treated). A representative series of flicker response intensities of AAV7m8.CBAhopt.LCA5 treated retinas (3.53E2-1.52E6 hv / cm2) showed that the amplitude of the response increased with increasing light intensity. Rod and cone endurance response tests after the brightest flashes showed persistence of cone responses similar to those seen in wild-type retinas. Flicker response tests showed similar responses in treated Lca5- / - retinas compared to retinas of wild-type mice. The firing rates of rods and cones in treated Lca5- / - retinas approached those of wild-type retinas (compared to control untreated Lca5- / - retinas) as a function of light intensity.

[0186] The response kinetics were similar to those in WT retinas (data not shown). Light sensitivity was slightly lower in treated Lca5- / - compared to the most sensitive WT retinas, with the first response at 8-21 photons*s -1 *μm -2 All ganglion cell types identified in the WT retina under full-field stimulation (ON, OFF, and ON / OFF types) were detected in the Lca5- / - treated retina after spike sorting. The WT and treated Lca5- / - retinas were detected at 3.53e2-2.00e9 photons*s -1 *μm -2 All untreated Lca5- / - retinas showed a slow melanin-driven response at brighter intensities, which was absent in the photosensitivity-treated Lca5- / - retinas. A summary of the study results is shown in Table 3.

[0187] Although the results obtained by electroretinography and MEA experiments showed restoration of rod and cone function in at least some animals, these methods were insufficient to assess the efficiency of the intervention in most animals, as only a quarter of the treated mice produced useful ERG signals. Therefore, we evaluated the intervention effect based on two other methods, analysis of pupillary light reflex (PLR) and visual behavior, which firstly provided a higher sensitivity than electrophysiology and secondly verified that the treatment of Lca5gt / gt retinas with AAV7m8.CβA.hopt-LCA5 resulted in light-induced signals being transmitted beyond the retina through the visual pathway to the brain.

[0188] The pupillary light reflex (PLR) relies on the transmission of signals that are initially transmitted from photoreceptors to retinal ganglion cells, then to the nucleus of Epstein-Barr in the brain, and finally back to the pupillary sphincter via the ciliary ganglion, which controls the diameter of the iris. Analysis of the PLR ​​in treated versus control eyes after stimulation revealed a significant (p<0.05) increase in PLR amplitude in eyes of Lca5gt / gt mice treated with AAV7m8.CpA.hopt-LCA5 compared to sham-injected controls ( Figure 2C There was a significant improvement in the PLR ​​measured in animals injected intravitreally or subretinally at PN5 ( Figure 2A-2B and 2E-2F) so that a near wild-type response was observed ( Figure 2D Statistically significant improvements in PLR amplitude were also demonstrated by comparing the maximum difference amplitude of the response (MDAR; Figure 2G-2I Animals that received AAV7m8.CpA.hopt-LCA5 by IVT or SR delivery also exhibited significantly improved PLR, as quantified by MDAR ( Figure 2H and 2I ).

[0189] Since the PLR ​​indicates retinal signals and function but does not provide formative visual information, we used the light-cued water maze test as described above to measure functional vision. Most untreated wild-type (normal-vision) mice were able to successfully navigate the water maze at all light levels, whereas untreated Lca5gt / gt mice were severely impaired (Table 2, Figure 3A ). Water maze test results showed that IVT and subretinal AAV7m8.CβA.hopt-LCA5 injected Lca5gt / gt animals performed better than uninjected controls in a statistically significant manner in at least one light condition (Table 2; Figure 3). Animals treated subretinal at PN5 demonstrated significantly improved pass rates compared to the control vehicle injected cohort (p<0.01) in each light test condition (1.06E+05, 8.69E+03 and 5.87E+02scot cd m-2). The improvement was minimal when animals were injected at PN15 (IVT or SR) (Figure 3). To confirm that mice only used the given light cues, they were tested under no light conditions (0.00scot cd m2), and more than 90% of the mice failed the test (including mice with normal vision; Figure 3B ).

[0190] Example 4: Ocular histology, histopathology, immunofluorescence and TUNEL assays

[0191] Histological rescue of Lca5gt / gt photoreceptors following treatment with AAV7m8.CβA.hopt-LCA5 at PN5 was assessed by evaluating molecular and structural measurements associated with proper function of the phototransduction cascade. Animals were euthanized at 3 months of age as described in Examples 2 and 3. Eyes were enucleated and retinal sections were evaluated by a modification of the method described by Boldt et al. (22) Tissues were fixed with 4% paraformaldehyde in PBS and then cryoprotected in 30% sucrose / PBS before freezing and cryosections were generated. Histopathological analysis was performed by examination of sections stained with 4',6-diamino-2-phenylindole (DAPI, Thermo Fisher Scientific, Philadelphia, PA) and / or by staining with hematoxylin and eosin. For immunofluorescence studies, sections were incubated with anti-lebercilin (1:300, (12, 22) in the presence of blocking solution, washed, and then treated with Cy3-conjugated secondary antibodies. Additional antibodies used were anti-rhodopsin (1:500, Leico Technologies), anti-red / green cone opsin (1:250, Chemicon), and anti-acetylated tubulin (1:1,000, Sigma-Aldrich). Stained sections were coverslipped with Citifluor mounting medium containing DAPI (Electron Microscopy Services, Hatsfield, PA). TUNEL staining was performed using the terminal deoxynucleotidyl transferase (TdT) dUTP nick end labeling (TUNEL) assay kit according to the manufacturer's recommendations (Vector Laboratories, Burlingame, CA). Images were acquired using a Zeiss Axio Imager M2 microscope equipped with epifluorescence and Axio-Vision 4.6 software and a confocal laser scanning microscope (Olympus Fluoview 1000, Center Transmission electron microscopy (TEM) was performed on the indicated tissue samples using a FEI-Tecnai T12 S / TEM.

[0192] Immunofluorescence analysis of eyes injected with AAV7m8-hopt-LCA5 at PN5 and analyzed at PN15 showed colocalization of Lebercilin with the base of tubulin-positive outer segments. Following intravitreal injection, Lebercilin was distributed throughout the retina, which contained almost no photoreceptors at PN95. In contrast, Lebercilin was absent in PN15 and PN95 Lca5- / - retinas.

[0193] Comparison of PN40 vs. PN99 of hematoxylin and eosin-stained treated and control retinal sections following intravitreal (IVT) or subretinal (SR) injection of AAV7m8.hopt-LCA5 (containing 5% v / v AAV7m8.eGFP) was comparable to sham injections. Micrographs of hematoxylin and eosin-stained (H&E) retinas showed that the inner segment / outer segment (IS / OS) and ONL were preserved up to the 3-month time point (PN99) following IVT or SR injection of AAV7m8.hopt-LCA5 (data not shown). In contrast, sham-injected control retinas lacked such layers at PN99 (data not shown). In addition, lebercilin was detected in treated retinas but not sham-treated control retinas (data not shown). Persistent expression of rhodopsin in the ONL was also confirmed by immunofluorescence analysis (data not shown), but only in treated eyes.

[0194] The thickness of the photoreceptor cell layer in the retinas treated with AAV7m8.CβA.hopt-LCA5 by IVT or SR injection at PN5 was significantly greater than that in the control retinas ( Figure 4 There was also a significant boundary in thickness between areas of the retina that were or were not exposed to AAV in the retinas treated by subretinal injection (data not shown). The preservation of the photoreceptor layer persisted until the most recent time point (PN99). The increase in thickness was due to an increase in the number of rows in the outer nuclear layer and the presence of inner and outer segments ( Figure 4 Consistent with this, there was a much higher proportion of photoreceptor death in control compared with AAV.LCA5-treated retinas, as judged by TUNEL labeling, particularly within the first month after intervention (data not shown).

[0195] Evaluation of the retinas of Lca5- / - mice injected with AAV7m8.hLCA5 at PN5 at 1-3 months post-injection revealed an increase in outer nuclear layer thickness ( Figure 5A and Fig. 9 ). Immunofluorescence analysis revealed colocalization of Lebercilin with the base of tubulin-positive outer segments in AAV7m8.hOP.LCA5-treated Lca5- / - retinas. There were many TUNEL-positive cells in the first month of life in untreated Lca5- / - retinas, but significantly fewer in AAV7m8.hOPT.LCA5-treated retinas ( Figure 6B and 6C The number of TUNEL-positive cells decreased when the animals reached 3 months of age ( Fig.6D and 6EThe majority of cells that degenerated in control (untreated) retinas over time in untreated Lca5- / - retinas were photoreceptors, as indicated by the fact that rhodopsin-positive cells were only seen in AAV-treated retinas ( Figure 6B Immunofluorescence analysis confirmed this result (see blue DAPI staining of ONL) and showed an increase in rhodopsin (red staining) that persisted at the 3-month time point ( Fig.6D There is evidence for light-mediated changes in the location of phototransduction-specific molecules following injection with AAV7m8.hopt.LCA5 ( Fig.10 ).

[0196] Transmission electron microscopy (TEM) of AAV7m8.hopt.LCA5-treated retinas showed the sophistication of the outer segments, including stacked outer segment discs, primary cilia ( Figure 7B ) and connecting cilia (Figure 7). In contrast, untreated Lca5- / - retinas lacked connecting cilia and outer segments. Untreated retinas lacked outer segments and showed extensive degeneration of photoreceptors, with only pyknotic nuclei and remnants of photoreceptor organelles. In control untreated or sham-injected retinas, only disorganized, degenerated photoreceptor cell bodies were present.

[0197] Light stimulation of dark-adapted adult Lca5gt / gt retinas treated with AAV7m8.hopt-LCA5 at PN5 resulted in a normal translocation pattern of phototransducin into the outer segments. Arrestin was appropriately translocated following light exposure in AAV7m8.hopt-LCA5 treated retinas. This activity could not be assessed in control retinas due to denaturation of the IS / OS. These data reflect restoration of the intraflagellar transport defect in mouse retinas following delivery of wild-type (WT) hLCA5 cDNA.

[0198] Developing proof-of-concept gene augmentation therapy in the Lca5- / - mouse model presents several challenges: 1) Because retinal degeneration progresses rapidly early in life, intervention must be performed in newborn mice; 2) Because this is a photoreceptor-specific disease, photoreceptors must be effectively targeted using recombinant AAV vectors. The AAV2 vector, which has been widely used to target RPE cells in animal and human studies, is not as effective at targeting photoreceptors as other AAVs. (23,24). Ideally, agents that can ultimately be used in human clinical trials should be used; and 3) outcome measures must be developed that reflect improvements in retinal and visual function levels that are so low at baseline that they are difficult to measure. Here, a recombinant AAV designed by directed evolution (i.e., AAV7m8) (25) was used to test efficacy after delivery of a native human lebercilin-encoding cDNA. Other studies have shown that this vector can effectively target photoreceptors after intravitreal delivery. (25-27). By delivering hLCA5 cDNA to diseased photoreceptors using AAV7m8 early in life, gene enhancement therapy resulted in structural and functional improvements in the retina and improved vision in Lca5- / - mice.

[0199] In Examples 3 and 4, it was demonstrated that AAV7m8-mediated gene enhancement therapy rescued retinal and visual function as well as retinal structure in Lca5- / - mice.

[0200] Efficacy reported in this example includes improvements in the model's ability to navigate using visual cues; restoration of rod and cone photoreceptor responses as shown by multi-electrode arrays (MEAs); reduction in apoptotic cell death (and thus preservation of photoreceptors); and the presence of cell biological and physical features characteristic of functional photoreceptors, such as the presence of rhodopsin in the outer retina and development of normally appearing outer segments, with stacked outer segment disks. The MEA results indicate that given successful injections and sufficient post-injection time to express the transgenic protein and restore rod / cone outer segment function, gene therapy restored degenerating retinal cells to a state virtually indistinguishable from WT conditions. Furthermore, delivery of wild-type LCA5 prevented photoreceptor degeneration. Untreated Lca5- / - retinas were reduced to a single row of pathological photoreceptors by 3 months of age, while AAV-treated areas had thick outer cores, including both inner and outer segments. This increase persisted for at least 3 months, a very important finding, especially given that at this age, there were no remaining photoreceptors in the retinas of untreated Lca5- / - mice. These data suggest that vision could be improved in humans using a genetic enhancement approach similar to that used in Lca5- / - mice.

[0201] Example 5: Human Study: Pupillary Light Reflex Test

[0202] The test was performed after written informed consent was obtained under an IRB-approved protocol (#815348). The pupillary responses of both eyes were recorded simultaneously using a Procyon P3000 pupillometer and PupilFit6 software (Monmouthshire, UK). The pupillary response to light was recorded after the right eye was stimulated with 10 lux green light for 0.2 seconds followed by a dark interval. An infrared-sensitive camera captured 25 frames of video images per second, allowing the diameter of the pupils of both eyes to be measured every 40 ms.

[0203] Pupillary light reflex testing was performed to determine if there was any evidence of residual photoreceptor function in adults homozygous for the LCA5 mutation. Figure 8 As shown, the pupillary light reflex is present in this individual and its timing is identical to that in individuals with normal vision. However, the amplitude of the response is greatly reduced compared to individuals with normal vision.

[0204] Example 6: Induced Pluripotent Stem Cell (iPSC) Model of LCA5

[0205] To aid translation of rescue studies in mice to humans, we investigated human induced pluripotent stem cell (iPSC) lines generated for research purposes from individuals with normal vision and LCA patients affected by LCA5 mutations. In recent years, iPSC-derived retinal pigment epithelium (RPE) has been shown to recapitulate the functional phenotype of a polarized epithelium, with secretory, gene expression, and maturation features comparable to fetal and adult RPE29. These cells show great promise for understanding disease mechanisms associated with defects in ciliary biology30,31. Here, we differentiated iPSCs into RPE cells ( Fig. 12A ), a process that allows assessment of ciliated cells in a shorter time and is more efficient than generating neurons / photoreceptor cells (Fig. S12). We assessed LCA5 gene expression and showed that LCA5 mRNA was expressed in unaffected iPSC-derived RPE and that LCA5 expression levels in RPE from LCA patients were significantly lower than those in controls ( Fig. 12B When measuring cilia distribution, iPSC-RPE derived from LCA5 patients had significantly fewer cilia than RPE from normal-sighted individuals ( Fig.12D -E). Treatment of LCA5-iPSC-RPE with AAV7m8.hopt-LCA5 resulted in the production of lebercilin protein ( Fig. 12C ) and produced comparable numbers of cilia in RPE cells from AAV7m8.LCA5-treated and normal-sighted individuals ( Fig.12D -F).

[0206] Peripheral blood mononuclear cells (PBMCs) were collected after two different probands with LCA5 mutations signed informed consent (IRB approved protocol #808828). One proband (i.e., JB605) was a compound heterozygote of LCA5 Gln279Stop CAG>TAGhet and Lys172del4ctcAAAG het; the other (i.e., JB590) was a homozygote of LCA5 c.835C>T p.Q279X. Wild-type cells were from individual PBWT4.6. The induced pluripotent stem cell line was generated from each of three individuals. PBMCs were cultured in an expansion medium consisting of QBSF-60 (Invitrogen, Carlsbad, CA) medium supplemented with cytokines and hormones. The medium was supplemented every 2-3 days for a period of 7-9 days until the cells entered the exponential growth phase.

[0207] For reprogramming, expanded PBMCs were transduced with rTTA lentivirus and doxycycline inducible "stem cell box" in a lentiviral vector that delivers OCT4, KLF4, SOX2 and cMyc cDNA and microRNA 302 / 367 cluster driven by TetO / CMV promoter. Cells were grown in expansion medium supplemented with polybrene (5 μg / ml; Sigma-Aldrich, St. Louis, MO). Cells were incubated at 37°C for 20-24h. The infected cells were then washed and placed in expansion medium supplemented with 1 μg / ml doxycycline (DOX). After 48 h, the cells were resuspended in Iscove's modified Dolbecco's medium (IMDM) containing the following: 10% fetal bovine serum (FBS), penicillin / streptomycin, L-glutamine, β-mercaptoethanol, non-essential amino acids, 4 ng / ml basic fibroblast growth factor (bFGF) and 1 μg / ml DOX (Sigma-Aldrich, St. Louis, MO), and then transferred to Matrigel-coated (BD Biosciences, San Jose, CA) mouse embryonic fibroblast plates (MEF plates). Cells remained in this medium for 10 days and were then transferred to human embryonic stem cell (hESC) medium (DMEM / F12, 20% knockout serum replacement, nonessential amino acids, 4 ng / ml bFGF, 0.001% β-mercaptoethanol, penicillin / streptomycin, L-glutamine, and 1 μg / ml DOX (Invitrogen, Carlsbad, CA). After 4 weeks, iPSC-like colonies were manually picked and expanded on Matrigel-coated MEF plates for 6 passages and then transitioned to 0.1% gelatin-coated MEF plates for at least 15 passages. Characterization of iPSCs was based on the use of ELISA kits for SSEA3+, SSEA4+, TRA-1-60, and TRA-1-81 (Biolegend, San Diego, CA). Diego, CA) antibodies were used to measure surface antigen expression by flow cytometry, and RT-qPCR analysis included pluripotency expression markers: DMNT3B, ABCG2, REX1, OCT4, SOX2, NANOG, cMYC, KLF4. iPSCs were karyotyped by G-banding to obtain a visible karyotype. The ability of cells to differentiate into multiple different lineages was studied using PCR germ layer analysis (Qiagen. Germantown, MD, USA).

[0208] The iPSCs characterized were differentiated into RPE by activating the Wnt signaling pathway, inhibiting the fibroblast growth factor signaling pathway, and inhibiting the Rho-related coiled-coil protein kinase signaling pathway. The pigment cells amplified were purified by flat adhesion on an 8-chamber slide on a geltrex matrix. The enriched cells were cultured until they developed into a paving stone appearance with a rectangular shape. The characteristics of iPS-RPE were confirmed by gene expression, immunocytochemistry, and microscopy. The cilia length was measured after fixation and staining for ARL13B and pericentriolar proteins. The cilia length was measured in three dimensions using custom designed software designed by Wistar Imaging Facility (Wistar Institute, Philadelphia, PA).

[0209] The density and length of cilia were assessed in control and LCA5 iPSC-RPE cell lines. Significantly fewer cilia were present on RPE cells from two LCA5 patients than on the wild-type cell line. In addition, cilia on the LCA5-derived lines were significantly shorter than on wild-type cells.

[0210] It has been previously observed that LCA5 patients are able to retain photoreceptors included in the foveal outer nuclear layer for up to 30 years. (21,29). Since successful gene therapy requires the presence of cells (even if they are pathological), LCA5 photoreceptors may be suitable for treatment. The following fact is encouraging: the present example shows that the photoreceptors retained in adults with LCA5 exhibit similar light reaction time patterns (although reduced in amplitude) to those of normal-sighted individuals. These results further support the fact that the photoreceptors remaining in these abnormal retinas are viable, but their structure and function are defective. In addition, the cilia of iPSC-RPE cells derived from LCA patients are significantly shorter than those of wild-type control cells. The fact is that the ciliary defects in the photoreceptors of Lca5- / - mice can be corrected by gene enhancement therapy, suggesting that the ciliary defects present in people with this condition may be improved. Studies on the correction of in vitro ciliary defects in iPSC-derived RPE cells are currently underway.

[0211] Gene augmentation therapy is currently being tested for safety and efficacy in humans with LCA5. In addition to the need to develop appropriate outcome measures for this severe blinding condition, the present application provides solutions to several issues in planning human clinical trials, including developing constraints to achieve rescue. In Lca5- / - mice, the examples demonstrate rescue in newborn (PN5) and juvenile (PN15) mice. In this mouse model, no rescue was observed later in the disease due to early photoreceptor loss. Developmental abnormalities in the mouse model (consistent with degeneration of photoreceptors) suggest the presence of a developmental component to the disease. There may also be a developmental component in the human condition. As described above, in humans with LCA5, there is evidence of some persistence of macular photoreceptors even in adults. (21) Research is ongoing to determine how to improve the function of these photoreceptors and determine whether visual pathways can be resuscitated in humans with LCA5 given the fact that resuscitation of cortical vision has been successful in humans recruited into RPE65 gene therapy clinical trials, even after decades of limited vision. (4,30,31)

[0212] Example 7: Genotyping of Lca5- / - mice

[0213] Genomic DNA was PCR amplified using the following oligos: LCA-13F6 (common F) GCCTGTTCCTGCTTGCTTAC (attached with SEQ ID NO: 13); LCA-13R2 (WT reverse) TGCTTTCCAAAGTAAGCACAAA (attached with SEQ ID NO: 14)

[0214] en2.8r (mutant reverse) CCTGGCCTCCAGACAAGTAG (attached with SEQ ID NO: 15). 35 cycles of PCR were performed with an annealing temperature of 50° C. and an extension step at 72° C. The predicted products were 353 bp (wild type) and 439 bp (Lca5- / -).

[0215] Example 8: Intravitreal injection of AAV7m8.hLCA5 restores photoreceptor function in Lca5- / - mice to near WT levels

[0216] Early-onset vision loss is caused by mutations in the LCA5 gene, which encodes Lebercilin, a protein that is essential for the health and function of photoreceptors. Due to the relative preservation of photoreceptors, LCA5 disease may be amenable to gene augmentation therapy. We tested the possibility that gene augmentation therapy delivered intravitreally using AAV7m8.CMV / CBA.hLCA5 restored photoreceptor and retinal function in the Lca5 mouse model (Lca5- / -) using a multielectrode array (MEA).

[0217] AAV7m8.CMV / CBA.hLCA5 (approximately 9.87 x 10 10 vg / eye) were injected intravitreally into Lca5- / - mice on the 5th day after birth. The contralateral eye was not injected and used as a negative control. Three months after the intervention and under light adaptation conditions, Lca5- / - retinas were dissected under red light and ganglion cells were fixed unilaterally downward in a multi-hole MEA chamber. The same dissection and preparation procedures were performed on untreated age-matched wild-type mice (C57B1 / 6) as positive controls. The presence of GFP confirmed the exposure of photoreceptors to AAV. Calibrated full-field flashes of 455nm light within the dark-adapted and light-adapted intensity range (10 2s flashes at 0.1Hz or 400 50ms flashes at 4Hz) were used for light stimulation (blue light was used to maximize the chance of reaction detection by targeting M- and S- cones, and the efficiency of M- and S- cone excitation was about 40% and 0.2% respectively). Data were analyzed using custom code in Matlab and spike potential sorting was performed using Pllexon OfflineSorting.

[0218] Three months later, in eyes with intact retinas, 3 of 5 showed strong light responses, 1 showed a median response, and 1 showed a minimal response when tested using MEA recordings. In the 3 retinas with strong responses, light responses were within the dark-adapted range (42 to 112 photons x s -1 xμm -2 ) and strong responses were observed up to 2.00×10 9 Photon xs -1 xμm -2The brightest light adaptation intensity of . Meanwhile, the retina of the uninjected contralateral eye showed minimal to eliminated responses. As expected for rod / cone driven responses, after exposure to the brightest stimulus series, dark adaptation responses disappeared, while responses within the light adaptation range were not significantly affected. Reaction kinetics and sensitivity were very similar to those observed in the 5 WT retinas tested under the same protocol (the sensitivity of the treated retina was slightly lower than that of the most sensitive WT retina, which produced the darkest flash of a rod-driven response at 8-21 photons xs -1 xμm -2 One treated retina tested two months after injection showed lower photosensitivity (reaction onset at 1.52 x 10 4 Photon xs -1 xμm -2 The responses were mostly lost after the brightest exposure (within 3 mos) and the responses were mostly lost after the brightest exposure. This may indicate that 3 mos are required for adequate expression of the target protein and generation of functional rod / cone outer segments. All ganglion cell types identifiable in the WT retina under full-field stimulation (ON-, OFF-, and ON / OFF-type) were detected in the Lca5- / - treated retina after spike sorting. As with the WT retina, the treated Lca5- / - retina showed a significant increase in the peak potential at 3.53x10 2 -2.00x10 9 Photon xs -1 xμm -2 Only one of seven control untreated Lca5- / - retinas showed a very weak light response to bright photopic stimulation, possibly indicating residual cone function. All untreated Lca5- / - retinas showed slow melanopsin-driven responses at brighter intensities, which were absent in photosensitivity-treated Lca5- / - retinas.

[0219] Two treated Lca5- / - retinas had signs of post-injection damage and exhibited no light responses despite strong spontaneous discharges. One treated retina showed no obvious signs of post-injection damage but exhibited a strong spontaneous discharge at the brighter end of the stimulus intensity (8.07x10 8 Photon xs -1 xμm -2 and higher), which may indicate low expression of the target protein and / or weak remaining cone function.

[0220] Given successful injections and sufficient post-injection time to allow for expression of the target protein and restoration of rod / cone outer segment function, gene therapy restored the degenerated retinal cells to a state that was nearly indistinguishable from WT conditions.

[0221] In summary, LCA itself is one of the most severe retinal degenerative diseases, and LCA5 is one of the most severe subtypes of this disease. Typically, LCA5 patients have only light perception early in life, and even structural studies and specialized visual function tests are difficult to perform in these extremely low-vision subjects due to nystagmus. Therefore, this disease is considered difficult to approach. However, the phenotype of Lca5- / - mice reflects many clinical findings in people with LCA5 mutations. The rescue data in Lca5- / - mice have raised hopes that similar gene enhancement approaches in humans can improve vision. In parallel with preclinical studies for human clinical trials, it is important to develop a method to accurately measure the structure and function of the LCA5 retina so that the effects of gene therapy can be reliably and accurately captured in clinical trials. Such studies and gene therapy clinical trials will not only enable treatments for this devastating disease, but they can also provide a framework for measuring the effects of interventions on other severe, early-onset blinding conditions.

[0222] Example 9: Preliminary Analysis of LCA5 Disease in Humans

[0223] The PLR ​​test was performed to determine if there was any evidence of residual photoreceptor function in an adult homozygous for the LCA5 mutation. As shown in Figure S11, the PLR ​​was present in this individual and its temporal sequence was identical to that in individuals with normal vision. However, the amplitude of the response was greatly reduced compared to individuals with normal vision.

[0224] Example 10: Loss of Lebercilin causes dysregulation of RPE maturation and ciliary function in cell and animal models

[0225] We investigated the pathological changes in the visual system of Leber congenital amaurosis 5 (LCA5), a disease caused by loss of expression of the gene encoding lebercilin, LCA5. Previous studies have elucidated the deleterious effects of lebercilin deficiency on the optic retina, especially on photoreceptors. This study aimed to further elucidate the pathogenesis of LCA5 by investigating the effects of normal LCA5 expression on retinal pigment epithelium (RPE) development and function.

[0226] Two independent experimental paradigms were employed: one used RPE cells generated from induced pluripotent stem cells (iPSCs) from normal-sighted individuals and LCA5 patients. RPE cell morphology, pigmentation, cell-specific markers, and characteristics of primary cilia were measured. The second approach evaluated the retina of wild-type mice and a murine model of LCA5 deficiency (LCA5gt / gt mice). The spatial-temporal differentiation pattern was characterized in order to describe the degenerative and developmental changes that occur in the visual system due to the lack of LCA5 protein.

[0227] The results showed that LCA5 deficiency in both human RPE cell models and in the RPE of living mice resulted in profound changes in the development of these cells. Gene expression analysis identified dysregulation of key proteins responsible for cilia formation and intraflagellar transport, pigmentation, and developmental WNT signaling. Immunostaining also identified differences in the epithelial barrier, consistent with altered maturation due to loss of LCA5 protein function.

[0228] This work reveals the deleterious effects of LCA5 inhibition in the RPE through altered processes such as pigmentation, possibly due to inhibition of intracellular trafficking or indirectly by delaying the maturational progression of these cells. In this study, we introduce a possible major role for RPE cells in retinal pathologies, traditionally thought to be photoreceptor dysfunction.

[0229] All patents, patent publications and other publications cited in this specification are incorporated herein by reference, as well as priority applications, U.S. Provisional Patent Application No. 62 / 465,649 filed on March 1, 2017 and U.S. Provisional Patent Application No. 62 / 469,642 filed on March 10, 2017. Similarly, the SEQ ID NOs cited herein and appearing in the attached sequence table are incorporated by reference. Although the present invention has been described with reference to specific embodiments, it should be understood that modifications can be made without departing from the spirit of the present invention. Such modifications are intended to fall within the scope of the appended claims.

[0230] (Sequence Listing Free Text)

[0231] The following information is used to contain the numeric identifier <223> The following is a sequence of free text.

[0232]

[0233]

[0234] References

[0235] 1.Redmond TM, Yu S, Lee E, Bok D, Hamasaki D, Chen N, et al. Rpe65 isnecessary for production of 11-cis-vitamin A in the retinal visual cycle. NatGenet (1998) 20(4): 344-51. PubMed PMID: 9843205.

[0236] 2.Redmond T,Hamel C.Genetic analysis of RPE65:from human disease tomouse model.Methods in Enzymol(2000)317:705-24.

[0237] 3.Maguire AM,High KA,Auricchio A,Wright JF,Pierce EA,Testa F,etal.Age-dependent effects of RPE65 gene therapy for Leber′s congenitalamaurosis:a phase l dose-escalation trial.Lancet(2009)374(9701):1597-605.PubMed PMlD:19854499.

[0238] 4.BennettJ.Wellman J,Marshall KA.McCague S,Ashtari M,DiStefano-PappasJ,et al.Safety and durability of effect of contralateral-eye administrationof AAV2 gene therapy in patients with childhood-onset blindness caused byRPE65mutations:a follow-on phase l trial.Lancet(2016)388(10045):661-72.doi:10.1016 / S0140-6736(16)30371-3.PubMed PMID:27375040.

[0239] 5.Jacobson SG,Cideciyan AV,Ratnakaram R,Heon E,Schwartz SB,RomanAJ.et al.Gene Therapy for Leber Congenital Amaurosis Caused by RPE65Mutations:Safety and Efficacy in 15Children and Adults Followed Up to3Years.Arch Ophthalmol(2012)130(1):9-24.Epub 2011 / 09 / 14.doi:archophthalmol.2011.298[pii]

[0240] 10.1001 / archophthalmol.2011.298.PubMed PMID:21911650.

[0241] 6.Cideciyan AV,Jacobson SG,Beltran WA,Sumaroka A,Swider M,Iwabe S,etal.Human retinal gene therapy for Leber congenital amaurosis shows advancingretinal degeneration despite enduring visual improvement.Proc Natl Acad Sci US A(2013).Epub 2013 / 01 / 24doi:1218933110[pii]

[0242] 10.1073 / pnas.1218933110.PubMed PMID:23341635.

[0243] 7.Bainbridge JW,Smith AJ,Barker SS,Robbie S,Henderson R,Balaggan K,etal.Effect of gene therapy on visual function in Leber′s congenitalamaurosis.N Engl J Med(2008)358(21):2231-9.PubMed PMID:18441371.

[0244] 8.Weleber RG,Pennesi ME,Wilson DJ,Kaushal S,Erker LR,Jensen L,etal.Results at 2Years after Gene Therapy for RPE65-Deficient Leber CongenitalAmaurosis and Severe Early-Childhood-Onset Retinal Dystrophy.Ophthalmology(2016)123(7):1606-20.doi:10.1016 / j.ophtha.2016.03.003.PubMed PMID:27102010.

[0245] 9.Banin E,Bandah-Rozenfeld D,Obolensky A,Cideciyan AV,Aleman TS,Marks-Ohana D,et al.Molecular anthropology meets genetic medicine to treatblindness in the north african jewish population:human gene therapy initiatedin Israel.Hum Gene Ther(2010)21(12):1749-57.Epub 2010 / 07 / 08.doi:10.1089 / hum.2010047.PubMed PMID:20604683.

[0246] 10.Maguire A,Russell S,Bennett J,Chung D,Wellman J,High K,editors.Phase 3trial of AAV2-hRPE65v2(SPK-RPE65)to treat RPE65 mutation-associated inherited retinal dystrophies.American Academy of OphthalmologyRetina Subspecialty Day;2015;,Los Vegas,NV.

[0247] 11.Russell S,Bennett J,High K,Chung D,Wellman J,Maguire A.Phase3trial of AAV2-hRPE65v2(SPK-RPE65)to treat RPE65 mutation-associatedinherited retinal dystrophies.Saudi Ophthalmologic Society(2016).

[0248] 12.den Hollander AI,Koenekoop RK,Mohamed MID,Arts HH,Boldt K,TownsKV,et al.Mutations in LCA5,encoding the ciliary protein lebercilin,causeLeber congenital amaurosis.Nat Genet(2007)39(7):889-95.Epub 2007 / 06 / 05.doi:ng2066[pii]10.1038 / ng2066.PubMed PMID:17546029.

[0249] 13.Gerber S,Hanein S,Perrault I,Delphin N,Aboussair N,Leowski C,etal.Mutations in LCA5 are an uncommon cause of Leber congenital amaurosis(LCA)type II.Hum Mutat(2007)28(12):1245.doi:10.1002 / humu.9513.PubMed PMID:18000884.

[0250] 14.Chen X,Sheng X,Sun X,Zhang Y,Jiang C,Li H,et al.Next-generationSequencing Extends the Phenotypic Spectrum for LCA5 Mutations:Novel LCA5Mutations in Cone Dystrophy.Sei Rep(2016)6:24357.doi:10.1038 / srep24357.PubMedPMID:27067258;PubMed Central PMCID:PMCPMC4828721.

[0251] 15.Corton M,Avila-Fernandez A,Vallespin E,Lopez-Molina MI,AlmogueraB,Martin-Garrido E,et al.Involvement of LCA5 in Leber congenital amaurosisand retinitis pigmentosa in the Spanish population.Ophthalmology(2014)121(1):399-407.doi:

[0252] 10.1016 / j.ophtha.2013.08.028.PubMed PMID:24144451.

[0253] 16.Mackay DS,Borman AD,Sui R,van den Born LI,Berson EL,Ocaka LA,etal.Screening of a large cohort of leber congenital amaurosis and retinitispigmentosa patients identifies novel LCA5 mutations and new genotype-phenotype correlations.Hum Mutat(2013)34(11):1537-46.doi:10.1002 / humu.22398.PubMed PMID:23946133;PubMed Central PMCID:PMCPMC4337959.

[0254] 17.Vallespin E,Avila-Fernandez A,Almoguera B,Velez-Monsalve C,Cantalapiedra D,Garcia-Hoyos M,et al.Novel human pathological mutations.Genesymbol:LCA5.Disease:Leber congenital amaurosis.Hum Genet(2010)127(4):487.PubMed PMID:21488265.

[0255] 18.Vallespin E,Avila-Fernandez A,Almoguera B,Cantalapiedra D,Garcia-Hoyos M,Riveiro-Alvarez R,et al.Novel human pathological mutations.Genesymbol:LCA5.Disease:Leber Congenital Amaurosis(LCA).Hum Genet(2010)127(1):118.PubMed PMID:20108395.

[0256] 19.Ahmad A,Daud S,Kakar N,Nurnberg G,Nurnberg P,Babar ME,etal.Identification of a novel LCA5 mutation in a Pakistani family with Lebercongenital amaurosis and cataracts.Mol Vis(2011)17:1940-5.PubMed PMID:21850168;PubMed Central PMCID:PMCPMC3154126.

[0257] 20.Seong MW,Kim SY,Yu YS,Hwang JM,Kim JY,Park SS.LCA5,a rare genetic cause of leber congenital amaurosis in Koreans.Ophthalmic Genet(2009)30(1):54-5.doi:10.1080 / 13816810802592567.PubMed PMID:19172513.

[0258] 21.Jacobson SG,Aleman TS,Cideciyan AV,Sumaroka A,Schwartz SB,WindsorEA,et al.Leber congenital amaurosis caused by Lebercilin(LCA5)mutation:retained photoreceptors adjacent to retinal disorganization.Mol Vis(2009)15:1098-106.Epub 2009 / 06 / 09.doi:116[pii].PubMed PMID:19503738;PubMed CentralPMCID:PMC2690955.

[0259] 22.Boldt K,Mans DA,Won J,van Reeuwijk J,Vogt A,Kinkl N,etal.Disruption of intraflagellar protein transport in photoreceptor ciliacauses Leber congenital amaurosis in humans and mice.J Clin Invest(2011)121(6):2169-80.Epub 2011 / 05 / 25.doi:45627[pii]10.1172 / JCI45627.PubMed PMID:21606596;PubMed Central PMCID:PMC3104757.

[0260] 23.Vandenberghe L,Bell P,Maguire A,Cearley C,Xiao R,Calcedo R,etal.Dosage Thresholds for AAV2 and AAV8 Photoreceptor Gene Therapy inMonkey.Sci Transl Med(2011)3(88):88ra54.Epub 22 June 2011.

[0261] 24.Ramachandran PS,Lee V,Wei Z,Song JY,Casal G,Cronin T,etal.Evaluation of Dose and Safety of AAV7m8 and AAV8BP2 in the Non-HumanPrimate Retina.Hum Gene Ther(2016).doi:10.1089 / hum.2016.111.PubMed PMID:27750461.

[0262] 25.Dalkara D,Byrne LC,Klimczak RR,Visel M,Yin L,Merigan WH,et al.Invivo-directed evolution of a new adeno-associated virus for therapeutic outerretinal gene delivery from the vitreous.Sci Transl Med(2013)5(189):189ra76.doi:10.1126 / scitranslmed.3005708.PubMed PMID:23761039.

[0263] 26.Dalkara D,Kolstad KD,Caporale N,Visel M,Klimczak RR,Schaffer DV,etal.Inner limiting membrane barriers to AAV-mediated retinal transduction fromthe vitreous.Mol Ther (2009)17(12):2096-102.doi:10.1038 / mt.2009.181.PubMedPMID:19672248;PubMed Central PMCID:PMCPMC2814392.

[0264] 27.Mace E,Caplette R,Marre O,Sengupta A,Chaffiol A,Barbe P,etal.Targeting channelrhodopsin-2 to ON-bipolar cells with vitreallyadministered AAV Restores ON and OFF visual responses in blind mice.Mol Ther(2015)23(1):7-16.doi:10.1038 / mt.2014.154.PubMed PMID:25095892;PubMed CentralPMCID:PMCPMC4270733.

[0265] 28.Liang FQ,Anand V,Maguire AM,Bennett J.Intraocular delivery ofrccombinant virus.Methods Mol Med(2001)47:125-39.doi:10.1385 / 1-59259-085-3:125.PubMed PMID:21394582.

[0266] 29.Mohamed M,Topping N,Jafri H,Raashed Y,McKibbin M,InglehearnC.Progression of phenotype in Leber′s congenital amaurosis with a mutation atthe LCA5 locus.Br J Ophthalmol(2003)87(4):473-5.

[0267] 30.Ashtari M,Cyckowski LL,Monroe JF,Marshall KA,Chung DC,Auricchio A,et al.The human visual cortex responds to gene therapy-mediated recovery ofretinal function.J Clin Invest 121(6):2160-8.Epub 2011 / 05 / 25.doi:57377[pii]

[0268] 10.1172 / JCI57377.PubMed PMID:21606598;PubMed Central PMCID:PMC3104779.

[0269] 31.Bennett J,Ashtari M,Wellman J,Marshall KA,Cyckowski LL,Chung DC,etal.AAV2 gene therapy readministration in three adults with congenitalblindness.Sci Transl Med 4(120):120ra15.Epub 2012 / 02 / 11.doi:4 / 120 / 120ra15[pii]

[0270] 10.1126 / scitranslmed.3002865.PubMed PMID:22323828.

Claims

1. A recombinant adeno-associated virus (rAAV), the rAAV comprising an AAV capsid and a vector genome packaged therein, the vector genome comprising: (a) AAV 5' inverted terminal repeat (ITR) sequence; (b) promoter; (c) a coding sequence encoding human Lebercilin; (d) AAV 3'ITR, Wherein the coding sequence comprises a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

2.

2. The rAAV of claim 1, wherein the coding sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

2.

3. The rAAV of claim 2, wherein the coding sequence comprises SEQ ID NO:

2.

4. The rAAV of claim 1, wherein the rAAV capsid comprises AAV7m8 or a variant thereof, AAV8 capsid or a variant thereof, AAV6 capsid or a variant thereof, AAV9 capsid or a variant thereof, AAV7 capsid or a variant thereof, AAV5 capsid or a variant thereof, AAV2 capsid or a variant thereof, AAV 1 capsid or a variant thereof, AAV3 capsid or a variant thereof, or AAV4 capsid or a variant thereof.

5. The rAAV of claim 3, wherein the rAAV capsid comprises an AAV8 capsid.

6. The rAAV of claim 5, wherein the promoter comprises a hybrid promoter.

7. The rAAV of claim 6, wherein the hybrid promoter comprises a cytomegalovirus (CMV) promoter sequence and a chicken beta-actin (CBA) promoter sequence.

8. The rAAV according to claim 7, wherein the hybrid promoter comprises SED ID NO:

10.

9. The rAAV of claim 8, wherein the AAV 5'ITR or the AAV 3'ITR is from AAV2.

10. The rAAV of claim 8, wherein the vector genome further comprises a polyA sequence.

11. The rAAV of claim 10, wherein the vector genome comprises a nucleotide sequence having at least 90% sequence identity to nucleotides 1-4368 of SEQ ID NO:

9.

12. An aqueous suspension suitable for treating Leber's congenital amaurosis (LCA), comprising: an aqueous suspending liquid and at least about 1×10 10 A recombinant adeno-associated virus (rAAV) virus particle, wherein the rAAV has an AAV capsid and a vector genome packaged therein, wherein the rAAV has an AAV capsid and has a vector genome packaged therein, wherein the vector genome comprises: (a) AAV 5' inverted terminal repeat (ITR) sequence; (b) promoter; (c) a coding sequence encoding human Lebercilin; and (d) AAV 3'ITR, Wherein the coding sequence comprises a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

2.

13. The aqueous suspension of claim 12, wherein the coding sequence comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

2.

14. The aqueous suspension of claim 13, wherein the coding sequence comprises SEQ ID NO:

2.

15. The aqueous suspension of claim 14, wherein the aqueous suspension is suitable for subretinal or intravitreal injection.

16. The aqueous suspension of claim 12, wherein the promoter comprises SEQ ID NO:

10.

17. An aqueous suspension according to claim 12, wherein the rAAV capsid comprises AAV7m8 or a variant thereof, AAV8 capsid or a variant thereof, AAV6 capsid or a variant thereof, AAV9 capsid or a variant thereof, AAV7 capsid or a variant thereof, AAV5 capsid or a variant thereof, AAV2 capsid or a variant thereof, AAV 1 capsid or a variant thereof, AAV3 capsid or a variant thereof, or AAV4 capsid or a variant thereof.

18. An aqueous suspension according to claim 17, wherein the rAAV capsid comprises AAV8 or a variant thereof.

19. The aqueous suspension of claim 18, wherein the vector genome comprises a nucleotide sequence having at least 90% sequence identity to nucleotides 1-4368 of SEQ ID NO:

9.

20. A composition comprising: a) the rAAV of claim 1 or the aqueous suspension of claim 12, and b) a pharmaceutically acceptable carrier or excipient suitable for delivery to the eye of a subject.

21. Use of the rAAV according to any one of claims 1-11, the aqueous suspension according to any one of claims 12-19, or the composition according to claim 20 in the preparation of a medicament for treating Leber's congenital amaurosis (LCA) in a subject in need thereof.

22. The use according to claim 21, wherein the dose of rAAV comprises at least about 1×10 10 vector genome.

23. The use according to claim 21, wherein the rAAV is administered subretinal or intravitreally.

24. The use according to claim 21, wherein the rAAV is present in a volume of at least 1×10 11 A dose of rAAV is administered to the eye of the subject.

Images