Coenzyme regeneration system as well as preparation method and application thereof
By using heat-resistant chromium reductase and aldehyde dehydrogenase, or building a fusion protein with dual functions, the problems of poor thermal stability of enzymes and complex construction of dual enzyme systems are solved, efficient coenzyme regeneration and reduction of hexavalent chromium are achieved, and environmental repair costs are reduced.
Patent Information
- Application Number
- CN202411641440.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-18
- Publication Date
- 2025-04-04
AI Technical Summary
In the prior art, the thermal stability of enzymes is poor and the construction process of the dual enzyme system is complicated, resulting in low coenzyme regeneration efficiency and increasing the cost in the repair process of environmental pollutants.
The heat-resistant chromium reductase and aldehyde dehydrogenase are used, and the construction process of the coenzyme reductase and aldehyde dehydrogenase is simplified by constructing fusion proteins with chromium reductase and aldehyde dehydrogenase functions, and the construction process of the coenzyme regeneration is simplified, using hexavalent chromium and aldehyde as substrates to achieve coenzyme regeneration.
It improves the thermal stability of the coenzyme regeneration system, simplifies the construction process, reduces the cost of pollutant repair, and achieves an efficient hexavalent chromium reduction rate in the environment, reaching 86.1%.
Smart Images
Figure CN119752824A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a coenzyme regeneration system and a preparation method and application thereof, belonging to the field of biotechnology. Background Art
[0002] Oxidoreductase catalytic reactions have been widely used in fields such as chiral synthesis, pharmaceuticals, food additives, flavoring agents, pesticides, and environmental pollutant degradation. Many oxidoreductases are coenzyme-dependent enzymes. Adding exogenous coenzymes during biotransformation will increase production costs, and the lack of coenzymes will directly affect the catalytic efficiency of the enzyme. The coenzyme regeneration system is to regenerate the coenzyme from the oxidized state to the reduced state, or vice versa, so that the coenzyme is maintained at a certain level. In recent years, the coenzyme regeneration methods established include chemical, photochemical, enzymatic and electrochemical regeneration systems, among which the enzymatic regeneration system has received widespread attention.
[0003] The regeneration enzymes used for enzymatic regeneration of reduced coenzymes include formate dehydrogenase (FDH), glucose dehydrogenase (GDH), alcohol dehydrogenase and hydrogenase, etc. Enzymatic regeneration of oxidized coenzymes commonly used enzymes include lactate dehydrogenase, glutamate dehydrogenase, NADH oxidase, etc. Enzyme coupling method coenzyme regeneration uses two parallel redox reaction enzyme systems to achieve the recycling of coenzymes. Therefore, the enzyme coupling method coenzyme regeneration system usually contains only two enzymes, which is a coenzyme regeneration system composed of two enzymes. However, the construction process of the two-enzyme system is complicated, and the stability of the enzyme affects the coenzyme regeneration efficiency.
[0004] Chromium is a chemical element widely present in nature and industry. In many industrial production processes, it is often released into the surrounding environment in the form of hexavalent chromium. Hexavalent chromium is a hydrophilic heavy metal. When it enters the soil, it will cause soil ecosystem imbalance and affect plant growth. At the same time, the discharge of hexavalent chromium wastewater into rivers or lakes will affect the health of aquatic organisms and the ecological balance of the entire food chain. Chromium reductase can use the coenzyme NADH or NADPH to reduce the more toxic hexavalent chromium to less toxic trivalent chromium. In addition, wastewater from chemical companies, plastics industry, synthetic fiber industry and pharmaceutical industry contains high concentrations of aldehyde compounds, and aldehyde dehydrogenase can use the coenzyme NAD + or NADP + Oxidation of aldehydes to the corresponding acids.
[0005] The reduction of hexavalent chromium requires the participation of NADH or NADPH, while the oxidation of aldehydes requires the coenzyme NAD + or NADP +However, these coenzymes are often expensive, have poor stability, and are difficult to reuse, resulting in high reaction costs in the process of water environment remediation, thus limiting the application of these enzymes in the process of environmental remediation. Therefore, in order to improve the efficiency and cost of environmental pollutant remediation, it is necessary to explore new, environmentally friendly, low-cost, and simple-to-operate coenzyme regeneration systems that play a role in the process of environmental remediation. Summary of the invention
[0006] In view of some deficiencies in the prior art, the purpose of the present invention is to provide a coenzyme regeneration system and its preparation method and application. In view of the problems of poor enzyme thermal stability, easy inactivation, and complex dual enzyme system construction process, the present invention provides a coenzyme regeneration system and its preparation method, which mainly involves chromium reductase and aldehyde dehydrogenase, and uses hexavalent chromium and aldehyde as substrates to achieve coenzyme regeneration, and provides a system involving fusion protein, and uses hexavalent chromium and aldehyde as substrates to achieve coenzyme regeneration.
[0007] In order to achieve the above technical objectives, the present invention provides the following technical solutions:
[0008] The present invention first provides a coenzyme regeneration system, which comprises chromium reductase and aldehyde dehydrogenase, or a fusion protein having the functions of chromium reductase and aldehyde dehydrogenase.
[0009] Furthermore, the coenzyme regeneration system also includes NAD + , NADH, NADP + or NADPH coenzyme.
[0010] The coenzyme regeneration system also includes a reaction substrate, which includes hexavalent chromium and an aldehyde substance, and the aldehyde substance includes glutaraldehyde or acetaldehyde.
[0011] The fusion protein with chromium reductase and aldehyde dehydrogenase functions uses recombinant plasmids pET-Cr and pET-Aldh as templates, amplifies sequence fragments containing chromium reductase genes and sequence fragments containing aldehyde dehydrogenase genes, and connects the amplified sequence fragments after enzyme digestion to construct a fusion protein expression plasmid, introduces the plasmid into a host bacterium for expression, and purifies to obtain the fusion protein with chromium reductase and aldehyde dehydrogenase functions.
[0012] The nucleotide sequence of the chromium reductase gene is shown in SEQ ID No: 1, the nucleotide sequence of the aldehyde dehydrogenase gene is shown in SEQ ID No: 2, and the amino acid sequence of the fusion protein having the functions of chromium reductase and aldehyde dehydrogenase is shown in SEQ ID No: 3.
[0013] The present invention also provides a method for preparing a coenzyme regeneration system, the method comprising:
[0014] A. constructing genetically engineered bacteria expressing chromium reductase and aldehyde dehydrogenase respectively, and obtaining enzyme solutions containing chromium reductase and aldehyde dehydrogenase by fermentation expression; purifying the obtained enzyme solutions containing chromium reductase and aldehyde dehydrogenase to obtain chromium reductase and aldehyde dehydrogenase, mixing the obtained purified chromium reductase and aldehyde dehydrogenase, and adding NAD + , NADH, NADP + or any one of NADPH coenzymes, reaction substrate, and calcium ions as activator, to obtain the coenzyme regeneration system, wherein the reaction substrate includes hexavalent chromium and aldehyde substances;
[0015] or
[0016] B. constructing a genetically engineered bacterium that expresses a fusion protein having the functions of chromium reductase and aldehyde dehydrogenase, obtaining an enzyme solution containing the fusion protein having the functions of chromium reductase and aldehyde dehydrogenase through fermentation expression, purifying the obtained enzyme solution containing the fusion protein having the functions of chromium reductase and aldehyde dehydrogenase to obtain a fusion protein having the functions of chromium reductase and aldehyde dehydrogenase, and reacting the obtained fusion protein having the functions of chromium reductase and aldehyde dehydrogenase with NAD + , NADH, NADP + Or any one of the NADPH coenzymes, the reaction substrates are mixed, and calcium ions are added as an activator to obtain the coenzyme regeneration system, and the reaction substrates include hexavalent chromium and aldehyde substances;.
[0017] Wherein, the host bacteria of the genetically engineered bacteria described in A or B are both E. coli BL21 (DE3).
[0018] The purification is as follows: the enzyme solution is heat treated at 75° C. for 5 minutes and then centrifuged, and the obtained supernatant is purified by His-tag affinity chromatography; the usage ratio of the purified chromium reductase and aldehyde dehydrogenase in step A is 1:1.
[0019] Specifically, the preparation methods of the chromium reductase, aldehyde dehydrogenase and fusion protein are as follows:
[0020] Preparation of chromium reductase:
[0021] According to the nucleotide sequence of the chromium reductase gene shown in SEQ ID No: 1, the whole gene was synthesized by Shanghai Biotechnology and cloned into the expression vector pET-28a(+) (Novagen, Darmstadt Germany), and the recombinant plasmid pET-Cr was constructed, which was introduced into E. coli BL21 (DE3) for expression and purified to obtain the recombinant chromium reductase;
[0022] Preparation of aldehyde dehydrogenase:
[0023] According to the nucleotide sequence of the aldehyde dehydrogenase gene shown in SEQ ID No: 2, the whole gene was synthesized by Shanghai Biotechnology and cloned into the expression vector pET-28a(+) (Novagen, Darmstadt Germany), and the recombinant plasmid pET-Aldh was constructed, which was introduced into E. coli BL21 (DE3) for expression and purified to obtain the recombinant aldehyde dehydrogenase;
[0024] Preparation of fusion protein:
[0025] The recombinant plasmid pET-Cr was used as a template, and the primer pair N1: GAGATATCAAAGGCCCTCTGGTACTGCGG and C1: GGTTCTAGACACCACCACCACCACCACTGA were used to amplify the linear fragment 1 (including the chromium reductase gene sequence shown in SEQ ID No: 1); the plasmid pET-Aldh was used as a template, and the primer pair N2: CGCAAGGCGGCAGGCAAGTAC and C2: CTTTCTAGAGTAGCCCGTGTCCATCTGGG were used to amplify the linear fragment 2 (the aldehyde dehydrogenase gene sequence shown in SEQ ID No: 2). The fragment 1 and the fragment 2 were connected after enzyme digestion to construct the fusion protein expression plasmid pET-Cr-Aldh. The plasmid was introduced into E. coli BL21 (DE3) for expression, and the recombinant enzyme fusion protein Cr-Aldh was purified. The amino acid sequence of the fusion protein Cr-Aldh is shown in SEQ ID No: 3.
[0026] The present invention also provides the use of the coenzyme regeneration system or the coenzyme regeneration system obtained by the preparation method of the coenzyme regeneration system in environmental remediation, wherein the environmental remediation includes reducing hexavalent chromium in the environment to trivalent chromium.
[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0028] (1) The present invention provides a coenzyme regeneration system. The coenzyme regeneration system of the present invention is constructed using heat-resistant chromium reductase and aldehyde dehydrogenase, which greatly enhances the thermal stability of the coenzyme regeneration system and can still perform coenzyme regeneration reaction at 75°C.
[0029] (2) The present invention also provides a method for preparing a coenzyme regeneration system. Based on the proposal of constructing coenzyme regeneration using chromium reductase and aldehyde dehydrogenase, the coenzyme regeneration system is further constructed using a bifunctional fusion protein having chromium reductase function and aldehyde dehydrogenase function, which greatly simplifies the construction process of the coenzyme regeneration system.
[0030] (3) The coenzyme regeneration system provided by the present invention can utilize the pollutant hexavalent chromium and aldehyde compounds as substrates for coenzyme regeneration. Experimental verification shows that the coenzyme regeneration system of the present invention can achieve a reduction rate of 86.1% for hexavalent chromium in the environment, indicating that the coenzyme regeneration system provided by the present invention can reduce the cost of pollutant remediation and has application prospects in environmental remediation. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 This is the SDS-PAGE polyacrylamide gel electrophoresis analysis of the thermostable chromium reductase expressed and purified in Example 1.
[0032] Figure 2 This is the SDS-PAGE polyacrylamide gel electrophoresis analysis of the thermostable aldehyde dehydrogenase expressed and purified in Example 2.
[0033] Figure 3 This is the SDS-PAGE polyacrylamide gel electrophoresis analysis of the fusion protein expressed and purified in Example 3.
[0034] Figure 4 This is a graph analyzing the chromium reduction efficiency of the dual enzyme system composed of chromium reductase and aldehyde dehydrogenase in Example 4 at different reaction times.
[0035] Figure 5 This is a graph analyzing the chromium reduction efficiency of the coenzyme regeneration system composed of the fusion protein in Example 5 at different reaction times. Specific embodiments
[0036] In order to make those skilled in the art better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with specific embodiments and drawings. It should be understood that these embodiments are only for illustrating the present invention, and are not intended to limit the scope of protection of the present invention in any way.
[0037] Unless otherwise specified, the terms used in the following examples generally have the meanings commonly understood by those of ordinary skill in the art; various processes and methods not described in detail in the examples are conventional methods known in the art, and reference may be made to the standard methods in the third edition of Handbook of Molecular Cloning (Sambrook and Russell, 2001, CSHL Press, Cold Spring Harbor, New York); the characteristic preparations used have been described in the invention summary section, and the sources, trade names, and components of other conventional reagents, if necessary, are indicated when they first appear, and the same reagents used thereafter, unless otherwise specified, are the same as those first indicated; reagents and vectors whose sources are not specifically indicated are all publicly known and commonly used materials in the field.
[0038] Example 1: Preparation of chromium reductase
[0039] (1) The chromium reductase gene (specific sequence information is shown in SEQ ID No: 1) was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. and constructed into the expression vector pET-28a(+) (Novagen, Darmstadt Germany) to obtain the Escherichia coli recombinant expression plasmid pET-Cr.
[0040] (2) The recombinant plasmid pET-Cr was introduced into E. coli BL21 (DE3), and the expression was induced by adding IPTG. The bacterial liquid was collected by centrifugation, and the crude enzyme liquid obtained after cell disruption was heat-treated at 75°C for 5 min. The supernatant obtained after centrifugation was purified by His-tag affinity chromatography to obtain recombinant chromium reductase.
[0041] (3) The recombinant chromium reductase obtained in step (2) was dialyzed against 1 mM DTT, 20 mM Tris-HCl buffer, pH 7.0, and stored at -20°C.
[0042] Figure 1 The SDS-PAGE polyacrylamide gel electrophoresis analysis diagram of the expression and purification of chromium reductase, wherein lane M: protein molecular weight standard; lane 1: control group, total protein of E. coli BL21 (DE3); lane 2: total protein of E. coli BL21 (DE3) containing the recombinant expression plasmid pET-Cr; lane 3: protein of total protein of E. coli BL21 (DE3) containing the recombinant expression plasmid pET-Cr after heat treatment at 75°C; lane 4: recombinant chromium reductase purified by His-tag affinity chromatography. Figure 1 It can be concluded from lane 2 that chromium reductase was successfully expressed; and from lane 4 that chromium reductase was purified.
[0043] SEQ ID No: 1:
[0044]
[0045] Example 2: Preparation of aldehyde dehydrogenase
[0046] (1) The aldehyde dehydrogenase gene (specific sequence information is shown in SEQ ID No: 2) was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. and constructed into the expression vector pET-28a(+) (Novagen, Darmstadt Germany) to obtain the Escherichia coli recombinant expression plasmid pET-Aldh.
[0047] (2) The recombinant plasmid pET-Aldh was introduced into E. coli BL21 (DE3), IPTG was added to induce expression, the crude enzyme solution obtained after cell disruption was collected by centrifugation, and heat-treated at 75° C. for 5 min. The supernatant of the centrifugation was purified by His-tag affinity chromatography to obtain recombinant aldehyde dehydrogenase. The recombinant aldehyde dehydrogenase was dialyzed in Tris-HCl buffer with a pH value of 7.0 and stored at -20° C.
[0048] Figure 2 This is an SDS-PAGE polyacrylamide gel electrophoresis analysis of the expression and purification of aldehyde dehydrogenase, where lane M: protein molecular weight standard; lane 1: control group, total protein of E. coli BL21 (DE3); lane 2: total protein of E. coli BL21 (DE3) / pET-Aldh; lane 3: protein after 75℃ heat treatment; lane 4: recombinant chromium reductase purified by His-tag affinity chromatography. Figure 2 Lane 4 shows that aldehyde dehydrogenase was purified.
[0049] SEQ ID No: 2:
[0050]
[0051] Example 3: Preparation of a fusion protein having chromium reductase function and aldehyde dehydrogenase function
[0052] (1) Using the recombinant plasmid pET-Cr described in Example 1 as a template, primer pair N1: GAA GATATC AAAGGCCCTCTGGTACTGCGG and C1:GGT TCTAGA CACCACCACCACCACCACTGA, amplified linear fragment 1 (sequence fragment of recombinant plasmid pET-Cr, including pET vector sequence and chromium reductase gene sequence as shown in SEQ ID No: 1); using the plasmid pET-Aldh in Example 2 as a template, using primer pair N2: CGCAAGGCGGC AGGCAAGTAC and C2: CTT TCTAGA GTAGCCCGTGTCCATCTGGG, linear fragment 2 (aldehyde dehydrogenase gene sequence shown in SEQ ID No: 2) was amplified. Linear fragment 1 was digested with EcoR V and Xba I, linear fragment 2 was digested with Xba I, and the digested fragments were connected using T4 DNA ligase to construct the fusion protein expression plasmid pET-Cr-Aldh.
[0053] (2) The recombinant plasmid pET-Cr-Aldh was introduced into E. coli BL21 (DE3), IPTG was added to induce expression, the crude enzyme solution obtained after cell disruption was collected by centrifugation, and heat-treated at 75°C for 5 minutes. The supernatant of the centrifugation was purified by His-tag affinity chromatography to obtain the fusion protein Cr-Aldh, the amino acid sequence of which is shown in SEQ ID No: 3. The purified fusion protein Cr-Aldh was dialyzed in a Tris-HCl buffer with a pH value of 7.0 and stored at -20°C.
[0054] Figure 3 The SDS-PAGE polyacrylamide gel electrophoresis analysis diagram of the expression and purification of the fusion protein, wherein lane M: protein molecular weight standard; lane 1: control group, total protein of E. coli BL21 (DE3); lane 2: total protein of E. coli BL21 (DE3) / pET-Cr-Aldh; lane 3: protein after 75℃ heat treatment; lane 4: fusion protein Cr-Aldh purified by His-tag affinity chromatography. Figure 3 As can be seen from lane 4, the fusion protein was purified.
[0055] SEQ ID No: 3:
[0056] MDGLLFTPLELRGLRLKNRLAMSPMCQYSATEGGEVTDWHLLHYPTRALGGVGLVIVEATAVLPEGRISPFDLGIWSEDHLPGLRELARRIREAGAVPGIQLAHAGRKAGTARPWEGGRPLGWKVVGPSPIPFAEGYPVPEALDEAGMARVLEAFVEGAKRALRAGFLVVELHMAHGYLLSSFLSPLANRREDAYGGSRENRMRFPLEVARAVREAIPPELPLFVRVSATDWAEGGWGLEDTLAFAERLKALGVDLLDLSSGGVVPGVRVPVAPGFQVPFADAVRKRVGMPTGAVGLLTTPEQAETVLQAGSADLVLLGRVLLRDPYFPLKAAKALGAEAPVPPQYQRAFDIFRKAAGKYGNTLEFGHLVGGEEVLEGPLLERRNPSDREDVVARFPEADKDLVRKAALKAREAFAEWSRTPAPIRGQVLFNLVKILEREKPTLTRLMVREVGKTPKEAAGDVQEAIDTALFFASEGRRLYGQTVPSEMRDKELFTFRRPLGVVGIITAGNFPIAVPSWKLIPAVLTGNAVVWKPSEDAPTLSFVFAKLFEEAGLPPGVLNVVFGGGKGSTGQWMVELMDEGLFQKFAFTGSTQVGRWIGEVAGRNLIRPTLELGGKNPLVVMRDADLDLAVEGAWWSAFATGGQRCTSAGNILVDAPIYEEFKRRFLERVEATLVGNPLLHPEVTYGPFINERFFARWQEHYRVGEAEGARLLFGRGRITRENPYPRFLGDPEAGLYGWPTVWEVRPGTRLFTEEVFGPTINLVKVDGIEEAIAVANSTPYGLSSAIYTNHRHWAYLFKVGIRAGMTSINNATVGAEAHLPFGGVKASGNGGRESGIWVLEEYTYWHAVNEEYSGRLQLAQMDTGYSRHHHHHH
[0057] Example 4: Construction of a coenzyme regeneration system with purified chromium reductase and aldehyde dehydrogenase
[0058] Chromium reductase needs to add coenzyme NADH when reducing hexavalent chromium, but adding coenzyme NADH will increase the cost of reduction. + Therefore, by adding NAD + Coenzyme, aldehyde and hexavalent chromium are used to construct a dual enzyme coenzyme regeneration system of chromium reductase and aldehyde dehydrogenase.
[0059] 0.5 mg / mL chromium reductase and 0.5 mg / mL aldehyde dehydrogenase were added to phosphate buffer at pH 7.0, with 0.1 mM hexavalent chromium and 0.5 mM glutaraldehyde as substrates and 1 mM NAD + Coenzyme, 0.001mM calcium ion (added in the form of calcium chloride, i.e., 0.001mM calcium chloride) was added at the same time, and the reaction was carried out at 75° C. As the reaction time increased, the removal rate of hexavalent chromium increased.
[0060] Under the same conditions as above, the coenzyme NAD + Replaced by NADP + The same effect can be achieved when glutaraldehyde is replaced by acetaldehyde.
[0061] Figure 4 is the residual hexavalent chromium concentration after different reaction times. The experimental results show that after 4 minutes of reaction, 46% of the hexavalent chromium with an initial concentration of 0.1 mM has not been reduced. After 12 minutes of reaction, only about 16.8% of the hexavalent chromium has not been reduced, and about 83.2% of the hexavalent chromium has been reduced.
[0062] Example 5: Construction of a coenzyme regeneration system using the purified fusion protein Cr-Aldh
[0063] 0.5 mg / mL of fusion protein Cr-Aldh was added to a phosphate buffer at pH 7.0, with 0.1 mM hexavalent chromium and 0.5 mM glutaraldehyde as substrates and 1 mM NAD + Coenzyme, 0.001mM calcium ion (added in the form of calcium chloride, i.e., 0.001mM calcium chloride) was added at the same time, and the reaction was carried out at 75° C. As the reaction time increased, the removal rate of hexavalent chromium increased.
[0064] Under the same conditions as above, the coenzyme NAD + Replaced by NADP + The same effect can be achieved when glutaraldehyde is replaced by acetaldehyde.
[0065] Figure 5The experimental results show that after 6 minutes of reaction, 42% of the hexavalent chromium remained unreduced at an initial concentration of 0.1 mM hexavalent chromium. After 15 minutes of reaction, only about 13.9% of the hexavalent chromium remained unreduced, and about 86.1% of the hexavalent chromium was reduced.
[0066] The fusion protein Cr-Aldh has the functions of chromium reductase and aldehyde dehydrogenase, and has the same effect in coenzyme regeneration. Through recombinant expression, the fusion protein can be applied to water environments with complex pollution of hexavalent chromium and aldehydes. Compared with the dual enzyme regeneration system, the fusion protein not only simplifies the preparation process, but also reduces costs.
[0067] In water environments with hexavalent chromium and aldehydes co-pollutants, when chromium reductase is used to reduce hexavalent chromium, coenzyme NADH or NADPH needs to be added, while when aldehyde dehydrogenase is used to oxidize aldehyde compounds, NAD + or NADP + The fusion protein of the present invention has both chromium reductase function and aldehyde dehydrogenase function. When repairing hexavalent chromium and aldehyde compound pollution, only the fusion protein and a coenzyme (NADH, NADPH, NAD + or NADP + ), coenzyme regeneration can be achieved.
[0068] The above embodiments are detailed descriptions of the preferred embodiments of the present invention, but the embodiments are not intended to limit the scope of the patent application of the present invention. For those skilled in the art, any modifications made without departing from the content, spirit and scope of the present invention are within the protection scope of the present invention.
Claims
1. A coenzyme regeneration system, characterized in that: The coenzyme regeneration system includes chromium reductase and aldehyde dehydrogenase, or the coenzyme regeneration system includes a fusion protein having the functions of chromium reductase and aldehyde dehydrogenase.
2. The coenzyme regeneration system according to claim 1, characterized in that: The coenzyme regeneration system also includes NAD + , NADH, NADP + or NADPH coenzyme.
3. The coenzyme regeneration system according to claim 1, characterized in that: The coenzyme regeneration system also includes a reaction substrate, which includes hexavalent chromium and an aldehyde substance, and the aldehyde substance includes glutaraldehyde or acetaldehyde.
4. The coenzyme regeneration system according to claim 1, characterized in that: The fusion protein with chromium reductase and aldehyde dehydrogenase functions uses recombinant plasmids pET-Cr and pET-Aldh as templates, amplifies sequence fragments containing chromium reductase genes and sequence fragments containing aldehyde dehydrogenase genes, and connects the amplified sequence fragments after enzyme digestion to construct a fusion protein expression plasmid, introduces the plasmid into a host bacterium for expression, and purifies to obtain the fusion protein with chromium reductase and aldehyde dehydrogenase functions.
5. The coenzyme regeneration system according to claim 4, characterized in that: The nucleotide sequence of the chromium reductase gene is shown in SEQ ID No: 1, the nucleotide sequence of the aldehyde dehydrogenase gene is shown in SEQ ID No: 2, and the amino acid sequence of the fusion protein having the functions of chromium reductase and aldehyde dehydrogenase is shown in SEQ ID No:
3.
6. A method for preparing a coenzyme regeneration system, characterized in that: The method comprises the following steps as described in A or B: A. constructing genetically engineered bacteria expressing chromium reductase and aldehyde dehydrogenase respectively, and obtaining enzyme solutions containing chromium reductase and aldehyde dehydrogenase by fermentation expression; purifying the obtained enzyme solutions containing chromium reductase and aldehyde dehydrogenase to obtain chromium reductase and aldehyde dehydrogenase, mixing the obtained purified chromium reductase and aldehyde dehydrogenase, and adding NAD + , NADH, NADP + or NADPH coenzyme, and then adding a reaction substrate, and using calcium ions as an activator to obtain the coenzyme regeneration system; the reaction substrate includes hexavalent chromium and aldehyde substances; or B. Constructing a genetically engineered bacterium that expresses a fusion protein having the functions of chromium reductase and aldehyde dehydrogenase, obtaining an enzyme solution containing the fusion protein having the functions of chromium reductase and aldehyde dehydrogenase through fermentation expression, purifying the obtained enzyme solution containing the fusion protein having the functions of chromium reductase and aldehyde dehydrogenase to obtain a fusion protein having the functions of chromium reductase and aldehyde dehydrogenase, and adding NAD + , NADH, NADP + Or any one of the NADPH coenzymes, and then adding a reaction substrate to mix, and using calcium ions as an activator, the coenzyme regeneration system is obtained, and the reaction substrate includes hexavalent chromium and aldehyde substances.
7. The method for preparing the coenzyme regeneration system according to claim 5, characterized in that: The host bacteria of the genetically engineered bacteria described in A or B are both E. coli BL21 (DE3).
8. The method for preparing the coenzyme regeneration system according to claim 5, characterized in that: The purification described in A or B is: the enzyme solution is heat treated at 75°C for 5 minutes and then centrifuged, and the obtained supernatant is purified by His-tag affinity chromatography; the usage ratio of the purified chromium reductase and aldehyde dehydrogenase in step A is 1:
1.
9. Use of the coenzyme regeneration system according to any one of claims 1 to 5 or the coenzyme regeneration system obtained by the preparation method of the coenzyme regeneration system according to any one of claims 6 to 8 in environmental remediation.
10. The use according to claim 9, characterized in that: The environmental remediation includes reducing hexavalent chromium in the environment to trivalent chromium.