Application of high-temperature resistant TnpB nuclease in nucleic acid detection and gene editing

By modifying the TnpB nuclease and ωRNA molecules, their cleavage activity under high-temperature conditions was enhanced, solving the problem of insufficient activity in nucleic acid detection and gene editing, and achieving efficient gene editing and detection.

CN119752847BActive Publication Date: 2025-12-05YAZHOUWAN NATIONAL LABORATORY +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411932793.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-26
Publication Date
2025-12-05
Estimated Expiration
2044-12-26

AI Technical Summary

Technical Problem

The application of TnpB nuclease in nucleic acid detection and gene editing has not been fully developed in the current technology, especially its cleavage activity and flexibility under high temperature conditions need to be improved.

Method used

To develop a heat-resistant TnpB nuclease, improve its cis and trans cleavage activities by protein engineering and optimizing ωRNA molecules, and express it in host cells by combining it with a gene expression cassette and recombinant vector for application in gene editing and nucleic acid detection.

Benefits of technology

This technology enables efficient cleavage of DNA and RNA under high-temperature conditions, expanding the application scope of nucleic acid detection and gene editing, and improving the accuracy and flexibility of gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119752847B_ABST
    Figure CN119752847B_ABST
Patent Text Reader

Abstract

The application discloses application of a high-temperature resistant TnpB nuclease in nucleic acid detection and gene editing, and relates to the technical field of gene editing. The TnpB nuclease is any one of (A1), (A2) and (A3): (A1) a TnpB nuclease, wherein the amino acid sequence is shown in SEQ ID NO. 1; (A2) a protein obtained by substituting, deleting and / or adding one or more amino acid residues in the amino acid sequence of the TnpB nuclease, wherein the protein has more than 80% identity with the TnpB nuclease and has the same biological function as the TnpB nuclease; and (A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of (A1) or (A2). The TnpB nuclease provided in the application has cis and trans cleavage activity, and has wide application prospects in the fields of nucleic acid detection and gene editing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and in particular to the application of a heat-resistant TnpB nuclease in nucleic acid detection and gene editing. Background Technology

[0002] TnpB is an RNA-guided, compact nuclease, approximately 400 amino acids in size, first discovered in bacterial transposons. The TnpB system mainly consists of two key components: 1) the TnpB protein, responsible for recognizing and cleaving target DNA; and 2) the guide RNA (ωRNA). ωRNA interacts with the TnpB protein, guiding it to recognize and cleave the target DNA sequence. Although several applications of TnpB nucleases in gene editing have been reported both domestically and internationally, there are few reports in the field of nucleic acid detection. The TnpB protein is the ancestor of the Cas12 protein in the type V CRISPR system. The trans-cleavage activity of the Cas12 protein has been widely used in in vitro diagnostics, including for pathogens, toxins, and compounds. Therefore, TnpB proteins with trans-cleavage activity need to be identified. TnpB nucleases can have their gene editing activity improved through protein engineering and optimization of ωRNA molecules. AlphaFold 3 can accurately predict RNA-protein-DNA complexes; whether engineered ωRNA molecules can improve TnpB nuclease activity requires further investigation. Summary of the Invention

[0003] The purpose of this invention is to provide a heat-resistant TnpB nuclease for use in nucleic acid detection and gene editing, thereby addressing the problems existing in the prior art. The TnpB nuclease provided by this invention possesses both cis and trans cleavage activities, and has broad application prospects in the fields of nucleic acid detection and gene editing.

[0004] To achieve the above objectives, the present invention provides the following solution:

[0005] This invention provides a TnpB nuclease, wherein the TnpB nuclease is any one of (A1), (A2), and (A3):

[0006] (A1)TnpB nuclease, the amino acid sequence of which is shown in SEQ ID NO.1;

[0007] (A2) The amino acid sequence of the TnpB nuclease is replaced, deleted and / or added by one or more amino acid residues to obtain a protein that has more than 80% identity with the TnpB nuclease and has the same biological function as the TnpB nuclease.

[0008] (A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0009] The present invention also provides a gene encoding the above-mentioned TnpB nuclease.

[0010] Furthermore, when the amino acid sequence of the TnpB nuclease is as shown in SEQ ID NO.1, the nucleotide sequence of the encoding gene is as shown in SEQ ID NO.2.

[0011] The present invention also provides a biomaterial, wherein the biomaterial is any one of (B1)-(B3):

[0012] (B1) Gene expression cassette, the gene expression cassette containing the above-described coding gene;

[0013] (B2) A recombinant vector containing the gene expression cassette;

[0014] (B3) Recombinant host cells containing the recombinant vector.

[0015] The present invention also provides the application of the above-mentioned encoding gene or biological material in the preparation of the above-mentioned TnpB nuclease.

[0016] The present invention also provides a composition for gene editing, comprising the above-mentioned TnpB nuclease and ωRNA;

[0017] The ωRNA includes a backbone portion and a target sequence portion;

[0018] The target sequence portion is complementary to the target sequence of the target gene.

[0019] Further, the nucleotide sequence of the backbone portion of the ωRNA is as shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.35.

[0020] The present invention also provides a gene editing system, comprising a recombinant vector expressing the above-mentioned TnpB nuclease and a recombinant vector expressing ωRNA;

[0021] The ωRNA includes a backbone portion and a target sequence portion;

[0022] The target sequence portion is complementary to the target sequence of the target gene;

[0023] The nucleotide sequence of the backbone portion of the ωRNA is shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.35.

[0024] The present invention also provides the application of the above-described TnpB nuclease, composition or gene editing system in nucleic acid recognition or gene editing for purposes other than disease diagnosis and treatment.

[0025] The gene editing includes gene modification, gene knockout, alteration of gene product expression, mutation repair, or insertion of polynucleotides in prokaryotic genomes, eukaryotic genomes, or in vitro genes.

[0026] The present invention also provides a gene editing method, comprising the step of transfecting the above-described gene editing system into a host cell to perform gene editing.

[0027] The present invention discloses the following technical effects:

[0028] This invention has conducted in-depth mining of massive metagenomic sequencing data from public databases and discovered a novel TnpB nuclease (SfaTnpB) from the ISBce3 transposon family. The protein is only 369 amino acids in size and recognizes the TAM sequence TAC. It has cis and trans cleavage activities and can trans cleave ssDNA and ssRNA.

[0029] This invention further enhances gene editing activity by engineering the ωRNA sequence of the SfaTnpB nuclease, and has broad application prospects in in vitro detection of pathogenic microorganisms, molecular diagnostics, and precise modification of mammalian genomes. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 A schematic diagram of the structural domains of the SfaTnpB nuclease;

[0032] Figure 2 The image shows the results of agarose gel electrophoresis detection of the in vitro double-stranded DNA cleavage activity of SfaTnpB nuclease; where S represents substrate and P represents product.

[0033] Figure 3 The graph shows the fluorescence intensity detection results of trans-cleavage of ssDNA reporter when SfaTnpB nuclease targets dsDNA and ssDNA at different temperatures.

[0034] Figure 4 The graph shows the fluorescence intensity detection results of SfaTnpB nuclease trans-cleaving ssDNA and ssRNA reporter when targeting dsDNA at different temperatures; where "+" represents the addition of dsDNA and "-" represents the absence of dsDNA.

[0035] Figure 5 The graph shows the fluorescence intensity detection results of SfaTnpB nuclease trans-cleaving ssDNA and ssRNA reporter when targeting ssDNA at different temperatures; where "+" represents the addition of ssDNA and "-" represents the absence of ssDNA.

[0036] Figure 6 The graph shows the fluorescence intensity of ssDNA-reporter trans-cleavage of AAAAA, TTTTT, GGGGG, or CCCCC ssDNA when the SfaTnpB nuclease targets dsDNA at different temperatures; where "+" indicates the addition of dsDNA and "-" indicates the absence of dsDNA.

[0037] Figure 7 The image shows the results of detecting the cis-cleavage activity of SfaTnpB nuclease after TAM mutation.

[0038] Figure 8 The graph shows the detection results of cis-cleavage activity after sequential mutation of the ωRNA sequence when the SfaTnpB nuclease targets the same target;

[0039] Figure 9The results of detecting the trans-cleavage activity of ωRNA after 5' end truncation on dsDNA and ssDNA are shown in the figure.

[0040] Figure 10 The figure shows the detection results of the trans-cleavage activity of the Stem 1 sequence truncated from 165-ωRNA;

[0041] Figure 11 The figure shows the detection results of the trans-cleavage activity of the Stem 2 and Stem 3 sequences of 165-ωRNA after truncation.

[0042] Figure 12 The trans-cleavage activity of two ωRNAs with lengths of 105 nt and 97 nt were detected by combining the optimal ωRNAs truncated to the 5' end, Stem1, Stem2 and Stem3.

[0043] Figure 13 The figure shows the results of evaluating the gene editing activity of SfaTnpB nuclease in HEK293T cells; where A represents the detection results of the gene editing activity of wild-type SfaTnpB nuclease in HEK293T cells; and B represents the detection results of the gene editing activity of engineered ωRNA-derived SfaTnpB nuclease in HEK293T cells. Detailed Implementation

[0044] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0045] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0046] Unless otherwise specified, nucleic acids are written from left to right in the 5' to 3' direction; amino acid sequences are written from left to right in the direction from the N-terminus (amino terminus) to the C-terminus (carboxyl terminus).

[0047] Terminology Explanation:

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0049] TnpB transposase: TnpB is a nuclease derived from bacteria and archaea, belonging to the IF-type CRISPR-associated protein family. It was initially discovered in transposons (mobile gene elements), hence the name transposase. TnpB plays a crucial role in gene editing, recognizing specific DNA sequences and performing cuts or insertions at those locations.

[0050] ωRNA (RNA-guided nuclease activity factor): ωRNA is a small RNA molecule associated with TnpB, typically encoded by the host genome. It binds to the TnpB protein to form a complex that recognizes and targets specific DNA sequences. This RNA-guided mechanism is similar to crRNA in the CRISPR-Cas system.

[0051] TAM (TnpB-Associated Motif): TAMs are specific DNA sequences that TnpB nucleases recognize and bind to. These sequences are typically located near target genes and are used to guide the precise cutting or editing of TnpB within the genome.

[0052] Cis-cleavage: refers to the TnpB nuclease cutting the target DNA sequence that it directly pairs with after binding to its ωRNA.

[0053] Trans-cutting: This refers to the fact that after TnpB nuclease recognizes and binds to target DNA, it not only cuts the DNA sequence paired with ωRNA, but also cuts neighboring or other DNA molecules.

[0054] While only preferred methods and materials have been described in this invention, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe the methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0055] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0056] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0057] Example 1: Discovering Novel TnpB Nucleases Based on Metagenomics Strategies

[0058] We conducted in-depth analysis of bacterial-encoded proteins using massive metagenomic sequencing data from public databases such as the NCBI nrpsd (Non-Redundant Protein Sequence Database) and the Global Microbial Gene Catalogue Database (GMGC). The simplified workflow was as follows: For all contig sequences in the target database, we used minced and prodigal software to search for and locate REs (representative proteins) and neighboring expressed proteins. Then, we used CD-hit software to remove redundancy from these proteins. Finally, we used mega software for protein clustering analysis and hmmer software to identify and classify proteins with similar RuvC domains. Ultimately, we identified a novel, unknown bacterial protein with a size of only 369 amino acids. Its amino acid sequence is shown in SEQ ID NO.1, and the nucleic acid sequence of its encoding gene is shown in SEQ ID NO.2.

[0059] After identifying candidate proteins, multiple sequence homology alignment was performed on the RNA sequences derived from the right-hand transposon elements of their genomes to locate the transposon ends. The corresponding ωRNA secondary structure was predicted using the RNAfold web server (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) and compared with the secondary structures of known TnpB nuclease ωRNAs to determine the candidate ωRNA sequences. The structure of the ωRNA-protein-DNA complex was predicted using AlphaFold 3, and the predicted structural model was compared with the cryo-electron microscopy structures of known ISDra2 nucleases to ultimately determine the domain composition and characteristics of the novel SfaTnpB nuclease (e.g., [missing information]). Figure 1 (As shown).

[0060] Example 2: SfaTnpB nuclease exhibits nucleic acid cleavage activity in vitro.

[0061] In this embodiment, the SfaTnpB protein (whose nucleotide sequence of the E. coli codon-optimized coding gene is shown in SEQ ID NO.3) was obtained through prokaryotic expression and purification technology. Its corresponding ωRNA was then purified by in vitro transcription, and the cleavage activity of the SfaTnpB protein against dsDNA was tested in vitro at different temperatures. The ωRNA, paired with the target nucleic acid, guides the ISBce3 protein to recognize and bind to the target nucleic acid, thereby stimulating the cleavage activity of the ISBce3 protein against the target nucleic acid. The cleavage efficiency was then assessed by observing changes in the size of the target band during agarose gel electrophoresis.

[0062] In this embodiment, the target dsDNA selected is a partial fragment of the ASFV p72 gene, and its nucleotide sequence is shown in SEQ ID NO. 4. The corresponding ωRNA nucleotide sequence is shown in SEQ ID NO. 5.

[0063] SEQ ID NO.4:

[0064]

[0065] The bolded reverse complementary sequence is the TAM, and the underlined sequence contains the reverse complementary sequence of the target sequence.

[0066] SEQ ID NO.5:

[0067] GAAUAUUCGUUAUGCACCUGUGGUUGAUGGUAAAAGUCAAUCAGCAUAGGGAACUAUAUGUUCUGCCCUAUGAGGGGUAAUGAGAUACCCUAAUCUUGAGGACUGUAAAACAGAAAUGGACUGCGAACGCUUAGUCACUCAAGAAUCCCACCCGUUAAACCGUAAGGUUUAGGGCUUGCGUCUUUAGACGUGGGAGUCUCAA CUUUGCUUUGAAGCCA CGGG (Underlined sequences are target sequences).

[0068] First, using the previously constructed pMD18T-p72 plasmid (the p72 fragment was amplified from ASFV genomic DNA and ligated into the pMD-18T vector via TA cloning to construct the pMD18T-p72 plasmid) as a template, PCR amplification was performed using p72-F (SEQ ID NO. 6) and p72-R (SEQ ID NO. 7) as primers to obtain the p72 gene fragment. Second, after codon optimization for *E. coli*, the DNA sequence encoding SfaTnpB was synthesized, cloned into the pET-28a prokaryotic expression vector, transformed into *E. coli* strain BL21, and after identifying positive clones, IPTG-induced expression was performed. The target protein was then purified by affinity chromatography. The in vitro cleavage reaction used the following system: 10×CutSmart Buffer 2 μL, SfaTnpB protein 500 ng, ωRNA 300 ng, and the purified product of p72 target amplification 200 ng. The mixture was incubated at 16℃, 25℃, 37℃, and 55℃ for 15 min, respectively. After the reaction was completed, 1 μL of proteinase K was added, and the reaction was terminated by incubation at 60 °C for 10 min. The control group did not add ωRNA. The cleavage activity of the novel SfaTnpB nuclease at different temperatures was detected by 1.5% agarose gel electrophoresis and gel imaging system.

[0069] The results are as follows Figure 2 As shown, compared with the control group, the SfaTnpB protein can cleave dsDNA within the temperature range of 16℃-55℃. This indicates that the SfaTnpB protein has targeted nucleic acid cleavage activity.

[0070] Example 3: SfaTnpB activates trans-cleavage activity by targeting dsDNA or ssDNA.

[0071] In this embodiment, the targeting ability of dsDNA or ssDNA was evaluated using the complex-RNP formed by SfaTnpB protein and ωRNA. The dsDNA target and ωRNA were the same as in Example 2. The ssDNA target sequence was: 5'-CCCGTGGCTTCAAAGCAAAG-3' (SEQ ID NO. 8).

[0072] The trans-cleavage activity assay consisted of a 20 μL volume, including 2 μL of 10×CutSmart Buffer, 500 ng of SfaTnpB protein, 300 ng of ωRNA, 0.2 μL of 100 μM ssDNA-reporter (5'-ROX / GTATCCAGTGCG / BHQ2-3'), and 200 ng of purified dsDNA target fragment or 5 μM of ssDNA target. The control group contained neither dsDNA nor ssDNA target. Three reaction temperatures were set: 16℃, 37℃, and 55℃, with a reaction time of 60 min. After the reaction, 1 μL of proteinase K was added to each reaction tube, and the reaction was terminated by incubation at 60℃ for 10 min. The resulting solution was transferred to a microplate, and 80 μL of DEPC water was added to each well for dilution. The fluorescence intensity of each reaction was read using a microplate reader in the range of 561-601 nm.

[0073] The results are as follows Figure 3 As shown, at the three set temperatures, the fluorescence signal values ​​of SfaTnpB nuclease were significantly higher than those of the control group when targeting dsDNA or ssDNA. This indicates that SfaTnpB nuclease can activate trans-cleavage activity by targeting dsDNA or ssDNA.

[0074] Example 4: Evaluation of the reporter type for trans-cleavage when SfaTnpB nuclease targets dsDNA

[0075] In this embodiment, the reporter type of trans-cleavage of SfaTnpB nuclease when targeting dsDNA was evaluated. SfaTnpB protein was prepared using prokaryotic expression and purification techniques, ωRNA was prepared via in vitro transcription, and the dsDNA target was amplified and purified by PCR.

[0076] The dsDNA target and ωRNA in this embodiment are the same as in Example 2. The ssDNA-reporter sequence is 5'-ROX / GTATCCAGTGCG / BHQ2-3', and the ssRNA-reporter sequence is 5'-ROX / GUAUCCAGUGCG / BHQ2-3'.

[0077] The reaction system consisted of 20 μL of 10×CutSmart Buffer, 500 ng of ISBce3 protein, 300 ng of ωRNA, 200 ng of dsDNA target, and 0.2 μL of 100 μM ssDNA-reporter or ssRNA-reporter. The control group did not contain dsDNA target. Three temperatures were set: 16℃, 37℃, and 55℃. The reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction, and the reaction was terminated by incubation at 60℃ for 10 min. The resulting solutions were transferred to microplates, and 80 μL of DEPC water was added to each well for dilution. The fluorescence intensity of each reaction was read using a microplate reader in the range of 561–601 nm.

[0078] The results are as follows Figure 4 As shown, only the ssDNA-reporter group produced a strong fluorescence signal at the three temperatures. In summary, under conditions of 16℃-55℃, the SfaTnpB nuclease, when targeting dsDNA, can only trans-cleave the ssDNA-reporter.

[0079] Example 5 evaluates the reporter type of trans-cleavage when SfaTnpB nuclease targets ssDNA.

[0080] In this embodiment, the reporter type of trans-cleavage of SfaTnpB nuclease when targeting ssDNA was evaluated. ISBce3 protein was prepared using prokaryotic expression purification technology, and ωRNA was prepared by in vitro transcription.

[0081] The ssDNA target selected in this embodiment is the same as in Example 3. The ωRNA sequence is the same as in Example 2. The ssDNA and RNA reporter sequences are the same as in Example 4.

[0082] The reaction system consisted of 20 μL of 10×CutSmart Buffer, 500 ng of SfaTnpB protein, 300 ng of ωRNA, 0.5 μL of synthesized ssDNA (10 μM) target, and 0.2 μL of 100 μM ssDNA reporter or ssRNA reporter. The control group did not contain the ssDNA target. Three temperatures were set: 16℃, 37℃, and 55℃. The reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction, and the reaction was terminated by incubation at 60℃ for 10 min. The resulting solutions were transferred to microplates, and 80 μL of DEPC water was added to each well for dilution. The fluorescence intensity of each reaction was read using a microplate reader in the range of 561-601 nm.

[0083] The results are as follows Figure 5As shown, when the SfaTnpB nuclease targets ssDNA, the ssDNA reporter group produces a strong fluorescence signal at all three temperatures. However, the RNA reporter group only produces a strong fluorescence signal at 55℃. In summary, when targeting ssDNA, SfaTnpB can trans-cleave the ssDNA reporter at temperatures ranging from 16℃ to 55℃, and can also trans-cleave the RNA reporter at 55℃.

[0084] Example 6: Evaluation of the base sequence preference of SfaTnpB nuclease trans-cleavage of ssDNA reporter

[0085] The dsDNA target and ωRNA sequence used in this embodiment are the same as those in Example 2. The ssDNA reporter sequence is designed into four types: (1) 5'-ROX / AAAAA / BHQ2-3'; (2) 5'-ROX / TTTTT / BHQ2-3'; (3) 5'-ROX / GGGGG / BHQ2-3'; (4) 5'-ROX / CCCCC / BHQ2-3'.

[0086] The reaction system consisted of 20 μL of 10×CutSmart Buffer, 500 ng of SfaTnpB protein, 300 ng of ωRNA, 200 ng of dsDNA target, and 0.2 μL of 10 μM ssDNA reporter. The control group did not contain dsDNA target. Three temperatures were set: 16℃, 37℃, and 55℃. The reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction, and the reaction was terminated by incubation at 60℃ for 10 min. The resulting solutions were transferred to microplates, and 80 μL of DEPC water was added to each well for dilution. The fluorescence intensity of each reaction was read using a microplate reader in the range of 561-601 nm.

[0087] The results are as follows Figure 6 As shown, the SfaTnpB nuclease can trans-cleave ssDNA reporters with sequences of type AAAAA, TTTTT, CCCCC, or GGGGG in the temperature range of 16℃-55℃, but it has lower trans-cleavage activity for ssDNA reporters with sequence type GGGGG at 16℃.

[0088] Example 7: Evaluation of SfaTnpB nuclease compatibility with TAM

[0089] This embodiment evaluates the cis-cleavage activity of the SfaTnpB nuclease in vitro using different types of TAMs. Specifically, the target nucleic acid selected in this embodiment is the ASFV p72 gene. First, PCR amplification was performed using p72-F1 / p72-R1 primers to obtain fragment 1, then p72-F2 / p72-R2 primers to obtain fragment 2, and finally p72-F3 / p72-R3 primers to obtain fragment 3. Using p72-F1 and p72-R3 as primers, and fragments 1, 2, and 3 as templates, PCR amplification was performed to obtain targets containing different TAMs. The ωRNA sequences used were the same as in Example 2.

[0090] The nucleotide sequences of p72-F1, p72-R1, p72-F2, p72-R2, p72-F3 and p72-R3 are shown in SEQ ID NO. 9-14, respectively.

[0091] The total reaction volume was 20 μL, including 2 μL of 10×CutSmart Buffer, 500 ng of SfaTnpB protein, 300 ng of ωRNA, and 200 ng of p72 amplification products of different types of TAMs. No ωRNA was added to the control group. The reaction temperature was set at 37℃, and the reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction, and the reaction was terminated by incubation at 60℃ for 10 min. The reaction products were detected by 1.5% agarose gel electrophoresis, and the cleavage efficiency was evaluated by calculating the gray value using ImageJ software.

[0092] The results are as follows Figure 7 As shown, changes in the 2nd, 3rd, and 4th bases of TAM reduce cis-cleavage activity, while changes in the 1st base result in activity comparable to the wild type. This indicates that the last three bases of the SfaTnpB nuclease TAM are crucial for cis-cleavage activity, while the 1st base is more tolerant.

[0093] Example 8 assesses the mismatch tolerance between the SfaTnpB nuclease guide sequence and the dsDNA target.

[0094] In this embodiment, the first 20 bases of the SfaTnpB nuclease guide sequence were sequentially mutated, and the mismatch tolerance between the guide sequence and the dsDNA target was assessed by detecting cis-cleavage activity. Specifically, the target nucleic acid selected in this embodiment is the ASFV p72 gene. Fragments 1, 2, and 3 were obtained using the same primers as in Example 7. Using p72-F1 and p72-R3 as primers, and fragments 1, 2, and 3 as templates, PCR amplification was performed to obtain dsDNA targets with sequential mismatches of the first 20 bases, respectively. The ωRNA sequence used was the same as in Example 2.

[0095] The reaction system consisted of 20 μL of 10×CutSmart Buffer, 500 ng of SfaTnpB protein, 300 ng of ωRNA, and 200 ng of p72 amplification products of different TAMs. The control group did not contain ωRNA. The reaction temperature was set at 37℃, and the reaction time was 60 min. After the reaction, 1 μL of proteinase K was added to each reaction tube, and the reaction was terminated by incubation at 60℃ for 10 min. The reaction products were detected by 1.5% agarose gel electrophoresis, and the grayscale values ​​of the electrophoresis results were calculated using ImageJ software to evaluate the cleavage efficiency. The cleavage efficiency of the wild-type target was quantified as 1, and the proportion of the cleavage efficiency of other sequentially mismatched targets at different positions relative to the wild-type target was calculated as the cleavage efficiency of sequentially mismatched targets at different positions.

[0096] The results are as follows Figure 8 As shown, compared to wild-type and the catalytically inactivated SfaTnpB variant (dTnpB), mismatched bases at positions 1-12 significantly reduce the cis-cleavage activity of SfaTnpB. However, mismatched bases at positions 13-20 still exhibit high cis-cleavage activity. These results indicate that the cis-cleavage activity is activated when the guide sequence of the SfaTnpB nuclease is perfectly paired with the target sequence.

[0097] Example 9: Engineered ωRNA scaffold enhances the trans-cleavage activity of SfaTnpB nuclease.

[0098] In this embodiment, the effect of truncation and optimization of the ωRNA scaffold sequence on the trans-cleavage activity of the SfaTnpB nuclease was evaluated. The wild-type ωRNA scaffold (WT-ωRNA) is 204 nt in length, and its nucleotide sequence is shown in SEQ ID NO. 15.

[0099] First, the 5' end sequence of ωRNA scaffold was truncated to lengths of 191 nt (SEQ ID NO. 16), 175 nt (SEQ ID NO. 17), 165 nt (SEQ ID NO. 18), 156 nt (SEQ ID NO. 19), 140 nt (SEQ ID NO. 20), 133 nt (SEQ ID NO. 21), 121 nt (SEQ ID NO. 22), and 110 nt (SEQ ID NO. 23).

[0100] Specifically, in this embodiment, the selected dsDNA target nucleic acid is the CSFV E2 gene (nucleotide sequence as shown in SEQ ID NO. 24), and the TAM is 5'-TTAC-3'.

[0101] SEQ ID NO.24:

[0102] The bolded sequence is the TAM, and the underlined sequence is the target sequence. The selected ssDNA target sequence is a synthetic oligonucleotide containing a 20-nt target for CSFV, and its sequence is: 5'- CAACTCTGAGAACGGAAGTG -3'(SEQ ID NO.25).

[0103] The reaction system consisted of 20 μL of 10×CutSmart Buffer, 500 ng of SfaTnpB protein, 300 ng of different ωRNA variants, 200 ng of CSFV-E2 amplification product or 1 μL of synthesized 10 μM ssDNA target, and 0.2 μL of 100 μM ssDNA-reporter. The control group did not contain dsDNA target. The reactions were incubated at 37 °C for 5 min, 15 min, 30 min, 60 min, and 90 min, respectively. After the reaction, 1 μL of proteinase K was added to each reaction, and the reaction was terminated by incubation at 60 °C for 10 min. The resulting solutions were transferred to microplates, and 80 μL of DEPC water was added to each well for dilution. The fluorescence intensity of each reaction was read using a microplate reader in the range of 561–601 nm.

[0104] The results are as follows Figure 9 As shown, when targeting dsDNA, when the ωRNA length is truncated to 156 nt, compared with WT-ωRNA, the activity of 156-ωRNA is significantly reduced, the activity of 140-ωRNA is lost, and the activities of 165-ωRNA, 175-ωRNA, and 191-ωRNA are similar to those of WT-ωRNA. When targeting ssDNA, the activity decreases when the ωRNA length is truncated to 133-ωRNA, and the activities of 140-ωRNA, 156-ωRNA, 165-ωRNA, 175-ωRNA, and 191-ωRNA are comparable to those of WT-ωRNA. Therefore, the SfaTnpB nuclease is more flexible in targeting ssDNA than in targeting dsDNA and is more tolerant of 5' truncation of ωRNA. In summary, based on the performance targeting ssDNA and dsDNA, the optimal ωRNA for 5' truncation of 165-ωRNA was determined and used in subsequent experiments.

[0105] Subsequently, the three-dimensional structure of the TnpB-ωRNA-DNA complex was predicted using AlphaFold3, and the Stem1 stem-loop region of ωRNAscaffold was truncated to 150nt (SEQ ID NO.26), 139nt (SEQ ID NO.27), 138nt (SEQ ID NO.28), and 131nt (SEQ ID NO.29), respectively.

[0106] The results are as follows Figure 10 As shown, the activities of Stem1-131-ωRNA and Stem1-138-ωRNA are similar to those of WT-ωRNA, while the activities of Stem1-150-ωRNA and Stem1-139-ωRNA are lower than those of WT-ωRNA. In summary, Stem1-131-ωRNA is the optimal ωRNA for truncating the Stem1 region.

[0107] Then, the Stem2 and Stem3 regions were truncated using a similar method to form Stem2-155-ωRNA (SEQ ID NO.30), Stem2-151-ωRNA (SEQ ID NO.31), Stem3-149-ωRNA (SEQ ID NO.32), and Stem2 & Stem3-131-ωRNA (SEQ ID NO.33), respectively.

[0108] The results are as follows Figure 11 As shown, compared with the wild type, Stem3-149-ωRNA exhibited the best activity, followed by Stem2-151-ωRNA and Stem2-155-ωRNA, while Stem2 & Stem3-131-ωRNA showed the lowest activity. Therefore, Stem2-155-ωRNA is the optimal ωRNA truncated from the Stem2 region, and Stem3-149-ωRNA is the optimal ωRNA truncated from the Stem3 region.

[0109] Furthermore, the optimal ωRNAs truncated at the 5' end, Stem1, Stem2, and Stem3 were combined to obtain two ωRNAs with lengths of 105 nt (SEQ ID NO.34) and 97 nt (SEQ ID NO.35), respectively.

[0110] The results are as follows Figure 12 As shown, the activity of 105-ωRNA was significantly higher than that of wild-type, while the activity of 97-ωRNA was lower than that of wild-type. Based on these results, 105-ωRNA is the optimal ωRNA for engineered production.

[0111] Example 10: Evaluation of the gene editing activity of SfaTnpB nuclease in HEK293T cells.

[0112] In this embodiment, the SfaTnpB sequence was first codon-optimized for eukaryotic cells, and SV40NLS and NLS nuclear localization signals were added to the N-terminus and C-terminus, respectively, as shown in SEQ ID NO.36. It was then cloned into a eukaryotic expression vector, and simultaneously co-transfected with a vector expressing ωRNA into HEK 293T cells via liposomes. After 72 hours, genomic DNA was extracted from the cells, amplified by PCR, and gene editing activity was detected by high-throughput sequencing.

[0113] In this embodiment, the target genes selected are: human FANCF gene (TAM sequence: TTAC, amplicon nucleotide sequence as shown in SEQ ID NO. 37, WT-ωRNA sequence as shown in SEQ ID NO. 38); DNMT1 gene (TAM: TTAC, amplicon nucleotide sequence as shown in SEQ ID NO. 39, WT-ωRNA sequence as shown in SEQ ID NO. 40); EMX1 gene (TAM: TTAC, amplicon nucleotide sequence as shown in SEQ ID NO. 41, WT-ωRNA sequence as shown in SEQ ID NO. 42); RUNX1 gene (TAM: TTAC, amplicon nucleotide sequence as shown in SEQ ID NO. 43, WT-ωRNA sequence as shown in SEQ ID NO. 44); and B2M gene (TAM: TTAC, amplicon nucleotide sequence as shown in SEQ ID NO. 45, WT-ωRNA sequence as shown in SEQ ID NO. 46).

[0114] Specifically, HEK293T cells were seeded when their confluence reached 70-80%, with a cell count of 8 × 10⁶ cells per 12-well plate. 4 Cells / well. Transfection was performed after 8 hours, with each well replaced with DMEM medium containing 2% FBS before transfection. 500 ng of the SfaTnpB eukaryotic expression plasmid and 300 ng of the ωRNA expression plasmid were added sequentially to 200 μL of Jetprime Buffer, mixed thoroughly by pipetting, and then 1.5 μL of Jetprime was added and mixed again by pipetting. After incubation at room temperature for 10 min, the mixture was added to the cell supernatant. After culturing at 37°C for 72 h, the medium was discarded, and the cells were resuspended in 100 μL of PBS to extract the genomic DNA. Following PCR amplification, high-throughput sequencing was performed.

[0115] The results are as follows Figure 13 As shown in Figure A, gene editing activity was detected at all five target sites, indicating that the novel SfaTnpB nuclease can perform targeted editing of the mammalian genome.

[0116] Furthermore, the optimized ωRNA variant described in Example 9, which enhances trans-cleavage activity in vitro, was tested at three endogenous targets in HEK293T cells, such as... Figure 13 As shown in Figure B, the optimized 105-ωRNA has the shortest length and significantly improves the editing efficiency of SfaTnpB.

[0117] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A TnpB nuclease, characterized in that, The TnpB nuclease is either (A1) or (A2): (A1)TnpB nuclease, the amino acid sequence of which is shown in SEQ ID NO.1; (A2) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1).

2. A gene encoding the TnpB nuclease as described in claim 1.

3. The encoding gene according to claim 2, characterized in that, When the amino acid sequence of the TnpB nuclease is as shown in SEQ ID NO.1, the nucleotide sequence of the encoding gene is as shown in SEQ ID NO.

2.

4. A biomaterial, characterized in that, The biomaterial is any one of (B1)-(B3): (B1) A gene expression cassette, wherein the gene expression cassette comprises the encoding gene as described in claim 2 or 3; (B2) A recombinant vector containing the gene expression cassette; (B3) Recombinant host cells containing the recombinant vector.

5. The use of the encoding gene as described in claim 2 or 3 or the biological material as described in claim 4 in the preparation of the TnpB nuclease as described in claim 1.

6. A composition for gene editing, characterized in that, Includes the TnpB nuclease and ωRNA as described in claim 1; The ωRNA includes a backbone portion and a target sequence portion; The target sequence portion is complementary to the target sequence of the target gene.

7. The composition according to claim 6, characterized in that, The nucleotide sequence of the backbone portion of the ωRNA is shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.

35.

8. A gene editing system, characterized in that, Includes a recombinant vector expressing the TnpB nuclease as described in claim 1 and a recombinant vector expressing ωRNA; The ωRNA includes a backbone portion and a target sequence portion; The target sequence portion is complementary to the target sequence of the target gene; The nucleotide sequence of the backbone portion of the ωRNA is shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 or SEQ ID NO.

35.

9. The use of a TnpB nuclease as described in claim 1, the composition as described in claim 6 or 7, or the gene editing system as described in claim 8 in nucleic acid recognition or gene editing for non-disease diagnosis and treatment purposes.

10. A method for gene editing not for disease diagnosis and treatment purposes, characterized in that, It includes the step of transfecting the gene editing system of claim 8 into host cells to perform gene editing.

Citation Information

Patent Citations

  • One-pot rapid nucleic acid detection system based on SfaTnpB combined isothermal amplification technology and application of one-pot rapid nucleic acid detection system

    CN120425031A