Rice OsLRG2 gene and application thereof in rice blast resistance

Abstract

The invention discloses a rice OsLRG2 gene and application of the rice OsLRG2 gene in rice blast resistance. The nucleotide sequence of the OsLRG2 gene is as shown in SEQ ID NO: 1, and the amino acid sequence of the protein coded by the OsLRG2 gene is as shown in SEQ ID NO: 2. The CDS sequence length of the gene is 2742bp, the gene encodes a protein with 914 amino acids, and the protein encoded by the gene has CC, NB-ARC and LRR structural domains, and belongs to one of most typical NBS-LRR disease-resistant protein family members in plants. The OsLRG2 gene is knocked out through a CRISPR / Cas9 method, and it is found that the resistance of rice to pyricularia grisea is reduced. The rice disease-resistant gene overcomes the defects of the existing rice disease-resistant gene, and can be applied to disease-resistant breeding to improve the rice blast resistance of rice, so that a new gene resource and a theoretical basis are provided for breeding of new varieties of high-yield and high-quality crops.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to rice OsLRG2 Genes and their application in rice blast resistance. Background Art

[0002] Rice ( Oryza sativa As one of the most important food crops in the world, rice production is facing unprecedented challenges due to the intensification of global climate change and the large-scale outbreak of natural diseases. Magnaporthe oryzae ) is known as the "cancer" in rice cultivation and poses a serious threat to rice yield and quality. Rice blast can infect multiple parts of rice at multiple stages of its growth period, including leaves, stems, spikelets, etc., and in severe cases can cause up to 80% yield loss or even total crop failure. Although the harm of rice blast has been alleviated through agronomic management, chemical control and promotion of disease-resistant varieties, its rapid mutation and evolution ability have limited the resistance life of existing disease-resistant varieties, making it difficult to meet production needs. The cultivation of disease-resistant varieties is considered to be the most economical, environmentally friendly and efficient strategy for rice blast control. However, the key to disease-resistant breeding lies in the discovery and utilization of disease-resistant genes. So far, more than 100 rice blast resistance-related sites have been located in the rice genome, but only more than 30 disease-resistant genes have been cloned, and most of them have problems such as narrow resistance spectrum and insufficient stability. The high variability of rice blast fungi further exacerbates the complexity of breeding work. Therefore, the discovery and application of new genes with broad-spectrum and durable resistance to rice blast has become the core task of rice disease-resistant breeding research. Summary of the invention

[0003] The present invention aims to provide rice OsLRG2 Genes and their application in rice blast resistance can make up for the shortage of existing rice blast resistance genes, and apply them in rice breeding to improve rice disease resistance, especially rice resistance to rice blast, providing important gene resources for green prevention and control of rice blast through resistance breeding.

[0004] In order to solve the above technical problems, the technical solution adopted by the present invention is: The present invention proposes a rice blast resistance gene OsLRG2 , whose nucleotide sequence is shown in SEQ ID NO.1.

[0005] Furthermore, the rice blast resistance gene OsLRG2 The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0006] The present invention also provides a rice blast resistance gene containing the above-mentioned new gene OsLRG2recombinant vectors and recombinant engineered bacteria.

[0007] The present invention also provides the rice blast resistance gene OsLRG2 Application in the prevention and control of rice blast.

[0008] The present invention also provides the rice blast resistance gene OsLRG2 Application in inducing tobacco hypersensitivity.

[0009] The present invention also provides a new rice blast resistance gene OsLRG2 The functional identification method comprises the following steps: S1: New gene for rice resistance to rice blast OsLRG2 Clone into pYLCRISPR / Cas9Pubi-H vector to obtain expression vector; S2: The expression vector is used to infect rice with Agrobacterium transformation method to obtain OsLRG2 Gene knockout mutant plants; S3: OsLRG2 After the seeds of the gene knockout mutant plants were cultured to three leaves and one heart, they were inoculated with a spore suspension of rice blast fungus. After 7 days of culture, the leaf spot area was observed, recorded and analyzed.

[0010] Furthermore, S1 specifically includes the following steps: Reference Sequencing OsLRG2 The sequences were sequenced and the knockout targets were predicted using CRISPR-P online analysis software; After designing the target primers, the target fragment was amplified. After confirming the target band, the amplified fragment was recovered and connected to the pYLCRISPR / Cas9Pubi-H expression vector through Goldden Gate cloning, and then transformed into Escherichia coli DH5α.

[0011] Furthermore, the target primers include: OsLRG2-TF, whose sequence is shown in SEQ ID NO.5, and OsLRG2-TR, whose sequence is shown in SEQ ID NO.6; Furthermore, S2 also includes OsLRG2 DNA of knockout mutant plants was used for molecular identification; The molecular identification method specifically comprises the following steps: Designing hygromycin primers hygF and hygR, and amplifying a segment of the hygromycin gene of the gene knockout mutant plant, and amplifying a 1035 bp fragment is a positive plant; Collect seeds of positive plants, and after sowing, extract DNA from young leaves for mutation detection of target sites; Primers OsLRG2-LF and OsLRG2-LR were designed for target site fragment PCR, and a fragment of 808 bp was amplified for sequencing analysis. Plants with frameshift mutations as a result of sequencing were homozygous knockout plants, and their offspring were homozygous Cas9 knockout mutant plants.

[0012] The sequence of the hygF is shown in SEQ ID NO.7, and the sequence of the hygR is shown in SEQ ID NO.8; the sequence of the OsLRG2-LF is shown in SEQ ID NO.9, and the sequence of the OsLRG2-LR is shown in SEQ ID NO.10.

[0013] Further, S3 was inoculated with a spore suspension of rice blast fungus, and after culturing for 7 days, the leaf lesion area was observed, recorded, and analyzed. The specific steps were as follows: A high pressure atomizer was used to spray the inoculated 1.0×10 5 ~2.0×10 5 The spore suspension of rice blast fungus with a concentration of 100 / mL was cultured in the inoculation room for 7 days, and then the leaf spots (based on the second young leaf) were observed, photographed and recorded, and the spot area was analyzed using ImageJ software.

[0014] The beneficial effects of the present invention are: The new rice blast resistance gene of the present invention OsLRG2 It was cloned from rice for the first time. Its CDS is 2742bp long and encodes a protein of 914 amino acids. The protein has CC, NB-ARC and LRR domains and is a typical NBS-LRR protein. By comparing the tolerance of rice Cas9 knockout mutants and wild-type rice to rice blast fungus, it was found that OsLRG2 The gene can improve rice's resistance to rice blast disease. Its application in genetic engineering has important economic value and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 For Example 1 of the present invention OsLRG2 Electrophoresis of PCR products on agarose gel.

[0016] Figure 2 For Example 1 of the present invention OsLRG2 Prediction map of conserved domains of proteins encoded by genes.

[0017] Figure 3 Agarose gel electrophoresis diagram of target fragment amplification (A) and positive colony detection (B) during the construction of the pYLCRISPR / Cas9Pubi-H-OsLRG2 vector in Example 2 of the present invention.

[0018] Figure 4This is a flow chart of Agrobacterium-mediated rice genetic transformation in Example 3 of the present invention.

[0019] Figure 5 Shown is a diagram showing the mutation detection of the DNA target site in young leaves of the T0 positive transgenic plant in Example 3.

[0020] Figure 6 For Example 4 of the present invention OsLRG2 Comparison of leaves (A) and leaf lesion area (B) of the mutant plants and their wild-type rice 7 days after inoculation with rice blast fungus.

[0021] Figure 7 For Example 5 of the present invention OsLRG2 Figure 1. The results of transient expression of the gene and its mutant genes (M-1 and M-2) in tobacco to induce tobacco hypersensitivity. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention.

[0023] In the following examples, the new rice blast resistance gene OsLRG2 Abbreviated as OsLRG2 .

[0024] Example 1 This embodiment provides a method for cloning a new rice blast resistance gene OsLRG2, comprising the following steps: (1) Preparation of materials Rice variety materials and Escherichia coli DH5α (Takara 9057). Among them, rice variety ZH11 was used for RNA extraction, which was provided by Wuhan Boyuan Biotechnology Co., Ltd.

[0025] (2) New genes for rice blast resistance OsLRG2 Cloning and transformation according to OsLRG2 The annotation information of the gene is 2742 bp in length. A pair of specific primers were designed using Primer5.0. The nucleotide sequence is as follows: OsLRG2-F: ATGGCAGAAGCTGTGCTGCT (SEQ ID NO.3); OsLRG2-R: TCACCACCCTACATGGATCTCT (SEQ ID NO. 4).

[0026] Rice seedlings at the three-leaf stage were used to extract total RNA using the Trizol reagent method, which was reverse transcribed into cDNA and used as a template for PCR reactions. Vazyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme, China) was used for amplification reactions. OsLRG2 The PCR reaction system of the gene is shown in Table 1, and the total volume is 50 μL. The PCR reaction program is: Pre-denaturation at 95℃ for 3 min→(denaturation at 95℃ for 30 s→annealing at 58℃ for 15 s→extension at 72℃ for 30 s)×30 cycles→full extension at 65℃ for 5 min→storage at 4℃.

[0027] The PCR products were detected by 1% agarose gel electrophoresis and purified ( Figure 1 The cloned new gene was cloned and then treated with DNA A-TailingKit (Takara 6109) for TA cloning. The vector was pMD18-T. Three positive clones were selected for sequencing. OsLRG2 The full length is 2742 bp. The protein domain was analyzed and predicted using the CDD online program. It was found that OsLRG2 protein has CC, NB-ARC and LRR domains, belonging to the typical NBS-LRR class protein (such as Figure 2 shown).

[0028] Table 1 PCR reaction system for amplifying OsLRG2 gene

[0029] Example 2 This embodiment provides a method for constructing a pYLCRISPR / Cas9Pubi-H-OsLRG2 vector, comprising the following steps: (1) Material preparation: OsLRG2 Knockout mutant materials and wild rice varieties, Cas9 knockout vector: pYLCRISPR / Cas9Pubi-H, Agrobacterium EHA105, the above vectors were purchased from Wuhan Boyuan Biotechnology Co., Ltd., and Agrobacterium EHA105 can be purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0030] (2) Reference sequencing OsLRG2 The sequences were obtained by using CRISPR-P (http: / / cbi.hzau.edu. cn / cgi-bin / CRISPR) online analysis software predicts knockout targets and designs target primers: OsLRG2-TF (SEQ ID NO.5): cagtGGTCTCaTGCAAGTCAGTCCGCTCATACCCATGGGTTTTAGAGCTAGAAATAGC; OsLRG2-TR (SEQ ID NO.6):cagtGGTCTCaAAACCCAGTACCGCACAAGGCTCTCACTGCACCAGCCGGGAATCGAA; (3) Then, the target linker amplification reaction was performed. The PCR reaction conditions were: 98℃ pre-denaturation for 3 min→(98℃ denaturation for 15 s→55℃ annealing for 15 s→72℃ extension for 30 s)×25 cycles→72℃ complete extension for 5 min→4℃ storage. The reaction system is shown in Table 2: Table 2 Dual-target fragment amplification reaction system

[0031] (4) Detect the PCR product by 1% agarose gel electrophoresis (e.g. Figure 3 As shown in A), after confirming the target band, the amplified fragment was recovered (gel recovery product), and the recovered fragment was connected to the pYLCRISPR / Cas9Pubi-H expression vector through Goldden Gate cloning to obtain pYLCRISPR / Cas9Pubi-H-OsLRG2. Reaction conditions: incubate at 37℃ for 30-60min, terminate at 65℃ for 20min. The reaction system is shown in Table 3: Table 3 Reaction system of Goldden Gate cloning

[0032] (5) Then, the ligation product was transformed into Escherichia coli DH5α, and the positive clones were selected for colony PCR. The PCR products were detected by 1% agarose gel electrophoresis (e.g. Figure 3 As shown in B), select the clear and bright double-band bacterial solution for sequencing. After successful alignment, use TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 (9760) to extract the plasmid and transform Agrobacterium EHA105. Select the positive clone and store it in a -80℃ refrigerator for later use.

[0033] Example 3 This example provides a method for genetic transformation of rice mediated by Agrobacterium tumefaciens (the flowchart of genetic transformation of rice is shown in FIG. Figure 4 ), including the following steps: Take 1000 mature rice seeds, peel off the husk, soak and disinfect in 2.5% sodium hypochlorite for 30 minutes, wash 5 times with sterile water, inoculate the disinfected seeds in callus induction medium, and culture them under light at 28°C for 7 days; culture the activated Agrobacterium EHA105 containing the target vector (pYLCRISPR / Cas9Pubi-H-OsLRG2) in YEB (50 mg / L kanamycin, 50 mg / L rifampicin) medium until OD600=0.5, collect the bacterial precipitate by centrifugation at 4000rpm for 10 minutes, resuspend the bacterial cells in AAM (100 μM acetosyringone) medium to prepare an engineering bacterial solution with OD600=0.2, and place it on ice for 1 hour; The wound tissue was immersed in the engineering bacteria solution for 10 minutes, and the surface solution was dried with sterile filter paper, and inoculated into the co-culture medium, and cultured in the dark at 25℃ for 3 days; the infected callus tissue was immersed in 500mg / L carbenicillin solution for 15 minutes, repeated twice, and the surface water of the callus tissue was dried with filter paper, and inoculated into the screening medium, and cultured at 28℃ light; the newly grown resistant callus block was subcultured into the bud induction medium, and cultured at 30℃ light (1-2 weeks) until the adventitious buds grew; the adventitious buds were subcultured into the rooting medium, and cultured at 30℃ light (1-2 weeks) until the seedlings grew most of the adventitious roots; the rooted seedlings were taken out, the culture medium was washed, and the roots of the seedlings were immersed in sterile water for 3-7 days before transplanting to the field or greenhouse. The culture medium formula required for genetic transformation is as follows: Callus induction medium: 24.1g N6 medium + 300mg / L hydrolyzed casein + 2.878g / L proline + 100mg / L inositol + 2mg / L 2,4-D + 30g sucrose + 8g phytogels, pH = 5.8; Co-culture medium: 24.1 g N6 medium + 2 mg / L 2,4-D + 300 mg / L hydrolyzed casein + 100 mg / L inositol + 10 g / L glucose + 30 g sucrose + 100 μM acetosyringone (AS) + 10 g plant gel, pH = 5.2; Screening medium: 24.1g N6 medium + 2mg / L 2,4-D + 300mg / L hydrolyzed casein + 2.878g / L proline + 100mg / L inositol + 30g sucrose + 300mg / L timentin (TIM) + 50mg / L hygromycin + 50mg / L Kan + 8g plant gel, pH = 5.8.

[0034] Pre-differentiation medium: 24.1g N6 medium + 30g sucrose + 30g sorbitol + 2g / L hydrolyzed casein 0.02mg / L NAA + 2mg / L kinetin + 50mg / mL hygromycin + 50mg / L Kan + 8g plant gel, pH 5.8; Rooting medium: MS medium + 30g glucose, pH = 7.2.

[0035] The DNA of the transformed plants was extracted for molecular identification, and the hygromycin primers hygF (CCGGAAGTGCTTGACATTGG, SEQ ID NO.7) and hygR (GCCGAATTAATTCGGGG, SEQ ID NO.8) were designed to amplify a segment of the hygromycin gene of the transgenic plants. The positive plants were those that could amplify a fragment of 1035 bp. The seeds of the T0 positive transgenic plants were collected, and after sowing, the young leaves were taken to extract DNA for mutation detection of the target site. The primers for PCR of the target site were: OsLRG2-LF:ACTGGGAAAAACCACCCTGG (SEQ ID NO.9); OsLRG2-LR: TTCGGCCACATCTTCTGGTC (SEQ ID NO. 10), a 808 bp fragment was amplified and sequenced.

[0036] like Figure 5 As shown in the figure, it can be seen that the plants with frameshift mutations are homozygous knockout plants, that is, the seeds of M-1 and M-2 rice OsLRG2 Homozygous Cas9 knockout mutants of genes.

[0037] Example 4 This example provides identification of rice blast resistance of rice Cas9 knockout mutants, comprising the following steps: (1) Take the mutant (M-1, M-2) and wild-type rice seeds obtained in Example 3, immerse them in water, and germinate them in a 30°C incubator for 2 to 3 days. Then sow the germinated rice seeds in small flower pots (10 cm in diameter) filled with soil, with 8 to 10 seeds per pot, and set 3 replicates for each treatment. The rice seedlings are cultured in a greenhouse with a light intensity of 10,000 Lx, a photoperiod of 14 h light / 10 h dark, and 28°C until the rice grows to three leaves and one heart or four leaves and one heart.

[0038] (2) The activated rice blast fungus was cultured in a rice bran medium (rice bran 20 g / L, agarose 40 g / L, pH = 6.5) in the dark for 8-10 days until the mycelium covered the culture dish. A layer of mycelium was scraped off the surface of the culture medium and cultured under 60% light conditions for 3-5 days to allow the rice blast fungus to produce spores. The rice bran plate after spore production was then washed with 3-5 mL of sterile water containing 0.02% Tween-20. The washing liquid was filtered with a single layer of lens paper and the filtrate was counted with a cell counting plate to make the final concentration of the spore suspension 1.0 × 10 5 ~2.0×10 5 The diluted spore suspension was sprayed evenly onto the rice leaves with a high-pressure atomizer, and 15 mL of spore suspension was sprayed for each repetition. The inoculated seedlings were placed in an inoculation room with a humidity higher than 90% and 26°C for dark culture for 24 hours, and then the photoperiod was changed to 12 hours of light / 12 hours of darkness, and cultured for another 7 days.

[0039] Figure 6 For Example 4 of the present invention OsLRG2 Comparison of leaves and leaf lesion areas of mutant plants and wild-type rice (WT) 7 days after inoculation with rice blast fungus. Figure 6 As can be seen in A, OsLRG2 The leaves of the mutants (M-1, M-2) were seriously diseased, with typical spindle-shaped lesions on the surface, that is, with a white center, brown edges, and a light yellow halo outside. Some lesions developed larger. The leaves of wild-type rice did not show lesions. ImageJ software was used to analyze the lesion area of ​​the leaves of OsLRG2 gene mutant plants and wild-type rice 7 days after inoculation with rice blast fungus. Figure 6 As shown in B, the wild type has no obvious lesions and the lesion area is the smallest, and the disease level is 1 (disease resistance). The lesion area of ​​the two mutants is between 30% and 40%, and the disease level is 4, indicating that OsLRG2 The gene mutation caused the wild-type rice to change from disease resistance to disease susceptibility, confirming that OsLRG2 Genes can enhance rice's resistance to blast disease.

[0040] Example 5 This embodiment provides a method for observing the cell death induced by transient expression of resistance genes in tobacco leaves. The method comprises the following steps: (1) According to the method in Example 1, OsLRG2 The sequences of its mutants (M-1, M-2) were connected to the pCAMBIA3301-GFP vector to obtain recombinant plasmids, which were then transformed into Agrobacterium GV3101 competent cells. Design of adapter primers: OsLRG2-GFP-F: cgagctcggtacccgggatccATGGCAGAAGCTGTGCTGCT (SEQ ID NO. 11); OsLRG2-GFP-R:gctcaccattctagaggatccTCACCACCCTACATGGATCTCT (SEQ IDNO.12); M1-GFP-F: cgagctcggtacccgggatccATGGCAGAAGCTGTGCTGCT (SEQ ID NO. 13); M1-GFP-R: gctcaccattctagaggatccCTATTGTGTTCGATTCTCACCG (SEQ ID NO. 14); M2-GFP-F: cgagctcggtacccgggatccATGGCAGAAGCTGTGCTGCT (SEQ ID NO. 15); M2-GFP-R: gctcaccattctagaggatccCTATTGTGTTCGATTCTCACCG (SEQ ID NO. 16).

[0041] (2) Pick a single clone and activate GV3101 in liquid YEP medium (50 mg / L kanamycin, 50 mg / L rifampicin) by shaking, and culture overnight at 28°C, 200 rpm. Inoculate the activated GV3101 into the corresponding liquid YEP medium at a ratio of 1:50, and culture at 28°C, 200 rpm for about 12 hours. Then, centrifuge at 28°C, 5000 rpm for 10 minutes to collect the cells. Wash the cells twice with injection buffer (10mM MES (pH=5.6) + 10mM MgCl2), and resuspend the cells with injection buffer to a bacterial solution OD600=1.0. Place horizontally at 28°C for 3-4 hours.

[0042] (3) Select several healthy tobacco leaves (about 4 weeks old) and use a 1 mL medical syringe without a needle to slowly inject the bacterial solution between the upper and lower epidermis of the tobacco leaves on the distal axis of the tobacco leaves. Try to make each injection area a 1-2 cm circle. Incubate in the dark at 25°C for 2-3 days, observe the leaves for any hypersensitivity symptoms, and take photos.

[0043] Figure 7 For Example 5 of the present invention OsLRG2 Figure 1 shows the results of transiently expressing OsLRG2 and its mutants (M-1 and M-2) in tobacco to induce tobacco hypersensitivity, with empty vector GFP as a control. At 48h, OsLRG2 triggered strong cell death in tobacco leaves, while no obvious cell death was observed in tobacco leaves infiltrated with Agrobacterium strains containing mutants (M-1 and M-2), indicating that OsLRG2 Can induce hypersensitive cell death in tobacco leaves.

[0044] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A new gene for rice blast resistance OsLRG2 , characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The new rice blast resistance gene according to claim 1 OsLRG2 , characterized in that: The amino acid sequence of the protein encoded by it is shown in SEQ ID NO.

2.

3. A rice plant containing the novel rice blast resistance gene as claimed in claim 1 OsLRG2 of the recombinant vector.

4. A rice plant containing the novel rice blast resistance gene as claimed in claim 1 OsLRG2 of recombinant engineered bacteria.

5. The rice blast resistance gene according to claim 1 OsLRG2 Application in the prevention and control of rice blast.

6. The rice blast resistance gene according to claim 1 OsLRG2 Application in inducing tobacco hypersensitivity.

7. A method for functional identification of the novel rice blast resistance gene OsLRG2 as claimed in claim 1, characterized in that: The following steps are involved: S1: The claim 1 OsLRG2 The gene was cloned into the pYLCRISPR / Cas9Pubi-H vector to obtain an expression vector; S2: The expression vector is used to infect rice with Agrobacterium transformation method to obtain OsLRG2 Gene knockout mutant plants; S3: After the seeds of the gene knockout mutant plants have three leaves and one heart, they are inoculated with a spore suspension of rice blast fungus. After culturing for 7 days, the leaf spot area is observed, recorded and analyzed.

Images