Application of Rice Leaf Angle Gene OsPUB77 Alleles

Abstract

The present invention belongs to the field of plant genetic engineering, and particularly relates to the application of rice leaf angle genes OsPUB77 alleles. The present invention provides the uses of rice leaf angle alleles OsPUB77 <supgt;R< / supgt;, OsPUB77 <supgt;I< / supgt; for at least any one of the following: regulating the rice leaf angle and improving the rice plant type; the nucleotide sequence of the rice leaf angle allele OsPUB77 <supgt;R< / supgt; is shown in SEQ ID NO:1; the nucleotide sequence of the rice leaf angle allele OsPUB77 <supgt;I< / supgt; is shown in SEQ ID NO:3. The rice containing the allele OsPUB77 <supgt;R< / supgt; of has a small leaf angle and a compact plant type; the rice containing the allele OsPUB77

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering, and specifically relates to a rice leaf angle gene OsPUB77 Application of alleles. Background Art

[0002] Rice is an important food crop in the world. With the continuous increase of the world's population and the decreasing cultivated land area, it is particularly important and urgent to increase crop yields to meet people's demand for food (Tian et al., 2024). Plant type is an important factor affecting plant growth and yield. Leaf angle and tillering are key factors in controlling plant type. The upright plant type can avoid mutual shading between leaves between plants and the shading of lower leaves by upper leaves in a single plant, thereby increasing photosynthetic efficiency; at the same time, the upright plant type can increase inter-row ventilation, greatly reduce microbial reproduction, enhance heat dissipation, etc., so it has a stronger ability to resist adverse stress; in addition, the upright plant type is suitable for dense planting, which can grow more food on the same area of ​​land, and can improve land utilization and crop yield. In summary, studying rice plant type is of great significance for improving rice yield.

[0003] The leaf angle is the angle formed by the leaf away from the vertical stem, which is controlled by the lamina joint, the intermediate structure connecting the leaf and the sheath. The existence of the leaf angle enables the leaf to effectively capture light energy and carry out photosynthesis (Sinclair and Sheehy, 1999; Sakamoto et al., 2006). The side of the pulvinus close to the stem end is named the adaxial end, and the side of the pulvinus away from the stem end is named the abaxial end. The development of the leaf angle is regulated by a series of dynamic cell division and proliferation, cell wall thickening, and programmed cell apoptosis events in the adaxial and abaxial cells (Zhou et al., 2017). The pulvinus provides a special transport channel between the leaf and the sheath, and is the basis of mechanical support. Therefore, in addition to the influence of cell size and number on the leaf angle, the lignin deposition of the pulvinus vascular bundle affects the mechanical support and also changes the leaf angle (Liu et al., 2024). Analysis at the genome level revealed that leaf angle is a gene that has been selected and domesticated by humans for a long time, and compact plants are the plant type that people prefer (Ishii et al., 2013). Therefore, studying the effect of leaf angle on rice plant type and yield is of great significance.

[0004] BR (brassinosteroid) hormone plays an important role in regulating rice plant shape. BR deficiency / insensitive mutants generally show a phenotype of short plants, upright plant shape, and reduced tillering. If the BR synthesis pathway in the body is blocked, for example brd1 , brd2 , d2 , d11Mutants have smaller seeds, shorter plants, smaller leaf angles, and upright plant shapes (Hong et al., 2002; Hong et al., 2003; Qin et al., 2018; Huang et al., 2022). Blocking the BR signaling pathway can also change the leaf angle, coleoptile morphology, and seed phenotypes of rice. Many genes in the BR signaling pathway in rice have been cloned. For example, the core transcription factor OsBZR1 and its downstream OsILI1 , OsBC1 , OsBU1, OsIBH1 and DLT Gene mutation or overexpression can significantly change the leaf angle of rice (Tanaka et al., 2009; Zhang et al., 2009; Tong et al., 2012). OsGSK2 and BR hormone receptor protein encoding genes such as OsBRI1 , OsBAK1 and OsBKI1 The findings of others indicate that BR plays an important role in regulating rice plant architecture (Namand Li, 2002; Wang and Chory, 2006). Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a rice leaf angle gene OsPUB77 The application of alleles, that is, the present invention is aimed at the existing breeding needs of ideal rice plant types and provides a natural variation site for improving rice plant type and its application.

[0006] In order to solve the above technical problems, the present invention provides a rice leaf angle allele OsPUB77 I , whose nucleotide sequence is shown in SEQ ID NO:3.

[0007] The present invention also provides a rice leaf angle allele OsPUB77 R , OsPUB77 I The purpose is at least any one of the following: regulating the angle of rice leaves and improving the rice plant type;

[0008] The rice leaf angle allele OsPUB77 R The nucleotide sequence of is shown in SEQ ID NO: 1; the rice leaf angle allele OsPUB77 I The nucleotide sequence is shown in SEQ ID NO:3.

[0009] As the rice leaf angle allele of the present invention OsPUB77 R , OsPUB77 I Improvements in usage:

[0010] Contains allele OsPUB77 R of the Rice, with small leaf angles and compact plant shape;

[0011] Contains allele OsPUB77 I The rice has large leaf angles and a loose plant shape.

[0012] As the rice leaf angle allele of the present invention OsPUB77 R , OsPUB77 I A further improvement of the use is at least any of the following:

[0013] Identification of rice leaf angle gene OsPUB77 Alleles;

[0014] Assist in selecting rice leaf angle and plant type.

[0015] As the rice leaf angle allele of the present invention OsPUB77 R , OsPUB77 I Further improvements of usage:

[0016] When the detection primer pair is used to amplify rice genomic DNA, the band is 196bp. Sequencing and identification determine the SNP site. If it is G, encoding arginine, then the rice to be tested contains the leaf angle allele. OsPUB77 R , the rice leaf angle is smaller; if it is T, encoding isoleucine, then the rice to be tested contains the leaf angle allele OsPUB77 I , the angle of rice leaves is larger.

[0017] As the rice leaf angle allele of the present invention OsPUB77 R , OsPUB77 I A further improvement of the use of, wherein the detection primer pair is:

[0018] Allele- OsPUB77- F: 5'-TGATTTCCTCTGTCCACTGACGAGG-3'

[0019] Allele- OsPUB77- R: 5'-CAGTTATCGATCAAGCGTTTTAACA-3'.

[0020] As the rice leaf angle allele of the present invention OsPUB77 R , OsPUB77 I Further improvement of the use of knockout alleles OsPUB77 R The knockout vector construction method used is as follows:

[0021] According to allele OsPUB77 R Sequence design of two target primers, the target of the double target is connected to U3 The vector and target two are connected to U6 On the vector, a single target is attached to U3 on the carrier; finally, by using EcoR31I It was connected to the final vector pYLCRISPR-gRNA by enzyme digestion and T4 ligase ligation;

[0022] The sequences of the dual-target primers are:

[0023] OsPUB77 - crispr2-U3-F: ggcaGTACTAGCGATGGCGACGG

[0024] OsPUB77 - crispr2-U3-R:aaacCCGTCGCCATCGCTAGTAC

[0025] OsPUB77 - crispr2-U6-F: gtgtTGACAAGCTAGCCAACGAGG

[0026] OsPUB77 - crispr2-U6-R: caaaCCTCGTTGGCTAGCTTGTCA;

[0027] The single target primer sequences are:

[0028] OsPUB77 - crispr1-U3-F: ggcaCCTCGTATCCGAGCTCGCCG

[0029] OsPUB77 - crispr1-U3-R:aaacCGGCGAGCTCGGATACGAGG.

[0030] As the rice leaf angle allele of the present invention OsPUB77 R , OsPUB77 IIn order to further improve the use of the invention, the overexpression vector used for overexpressing the allele OsPUB77 is constructed as follows:

[0031] The cDNA of Nipponbare NIP was used as template for amplification, and the amplified product was Kpn1 and Spe1 The double-enzyme-digested pTCK303 vector is subjected to homologous recombination ligation to obtain the overexpression vector;

[0032] The primers for constructing the overexpression vector are:

[0033] OVPUB77- F-Kpn1: 5'-GGATCCCCGGGTACCATGGCGCCGCCCGTCGT-3'

[0034] OVPUB77 -R-Spe1: 5'-GTAGTCCATACTAGTACTATTTCCCTTCTGTGACA-3'.

[0035] In the present invention:

[0036] Rice leaf angle allele OsPUB77 R The nucleotide sequence is registered in the Rice Genome Annotation Project (uga.edu) website with the accession number: Os04g05845000, the sequence is shown in SEQ ID NO: 1; the protein sequence is shown in SEQ ID NO: 2;

[0037] Allele OsPUB77 I The nucleotide sequence is shown in SEQ ID NO:3; the protein sequence is shown in SEQ ID NO:4.

[0038] The present invention utilizes reverse genetics method to clone rice OsPUB77 Gene, using transgenic CRISPR-Cas9 to knock out mutants, Ubi The promoter-driven overexpression strain verifies the role of this gene in regulating rice leaf angle and tillering; it also involves the use of the natural variation sites of this gene to regulate leaf angle and thus increase rice planting density.

[0039] In summary, the present invention discloses a method for controlling the angle of rice leaves OsPUB77 The application of alleles belongs to the field of gene breeding application technology. This gene is involved in regulating the angle of rice leaves. The present invention obtains a mutant with loss of function of OsPUB77 by CRISPR-Cas9 technology, and the plant shows a significantly increased leaf inclination angle and an increase in tillering. Nipponbare ) and Zhonghua 11 (ZH11) backgroundsOsPUB77 , the leaf inclination angle was significantly reduced and the tillering was reduced. In the exogenous brassinolide sensitivity test experiment, the mutant showed that it was more sensitive to the increase in leaf angle promoted by exogenous BR, while the overexpression strain showed almost no response to the increase in leaf angle promoted by exogenous BR in the exogenous brassinolide sensitivity test experiment. There is a naturally variant SNP site G / T in the U box domain of the OsPUB77 protein, which encodes arginine R / isoleucine I at position 530, respectively. Description: SEQ ID NO:1 Arginine at position 530; SEQ ID NO:3 Isoleucine at position 530. Transgenic OsPUB77pro:: OsPUB77 R / I Revertant phenotype discovery allele OsPUB77pro:: OsPUB77 R showed a more upright leaf angle phenotype, indicating OsPUB77 The allele plays an important role in leaf angle, which affects rice yield because it affects planting density and photosynthetic efficiency. Therefore, the gene has potential agricultural application value in molecular breeding.

[0040] It should be emphasized that the genes that are currently known to regulate rice leaf angle through the BR signaling pathway are mainly OsBRI1 , OsBAK1 , OsBKI1 , OsGSK2 , OsBZR1 , OsIBH1 , OsBU1 , DLT , OsBC1 , OsBIM1 , OsBHLH98 These known rice leaf angle genes and the rice leaf angle gene of the present invention OsPUB77 The differences between the alleles are as follows: 1. The present invention discovered that OsPUB77 is a new protein involved in the BR signaling pathway and simultaneously regulates rice leaf angle and tillering. OsPUB77 is stabilized by phosphorylation of OsGSK2 and degrades OsBZR3, thereby enriching the existing BR signaling network; 2. The above-mentioned genes reported above only reported their mechanisms of involvement in BR signaling, while OsPUB77 not only participates in BR signaling, but is also strongly induced by phosphorus deficiency. Therefore, the gene of the present invention links the nutrient element phosphorus with the hormone BR, explaining the problem that has always puzzled people, namely, why rice becomes a "stick of incense" phenotype with few tillers and upright growth under phosphorus deficiency; the above-mentioned genes reported above only focus on the single phenotype of leaf angle for description and analysis, while the present invention OsPUB77 Compared with the above-mentioned reported genes, the leaf angle and tillering phenotypes were quantified and analyzed for the first time, and the effects of phosphorus deficiency on leaf angle and tillering were explained from the perspective of hormones; 3. The distribution of the above-mentioned genes among rice populations has not been reported, but the present invention OsPUB77The gene was further analyzed between wild rice, japonica rice and indica rice. Ubox The nucleotide diversity of the domain is lower in japonica and indica rice, indicating that this gene has been selected as a superior gene for breeding in the long-term evolution. OsPUB77 There is a strong differentiation between japonica and indica rice, with OsPUB77 being almost exclusively expressed in japonica rice. R530 , while about 80% of indica rice is OsPUB77 I530 , E2 transferase UBCH1 and OsPUB77 R530 The interaction ability ratio of OsPUB77 I530 Stronger, OsPUB77 R530 The E3 ubiquitin ligase activity of OsPUB77 I530 stronger, leading to OsPUB77 R530 The ubiquitination ability of the downstream substrate OsBZR3 is stronger, and the downregulation of the positive regulatory genes downstream of BR is more obvious, so the OsPUB77 R530 Rice with the gene has a smaller leaf angle and contains OsPUB77 I530 Rice with the gene has a smaller leaf angle. R530I There is no difference in tillering between the two species, which avoids the disadvantage of traditional BR-insensitive mutants that reduce leaf angle while reducing tillering. Therefore, this allele is expected to be applied in actual production to improve dense planting and increase yield; 4. In terms of function, the above-mentioned reported genes are either transcription factors or kinases, while OsPUB77 of the present invention belongs to the plant PUB family, performs the function of E3 ubiquitin ligase, and is a newly discovered family protein involved in the regulation of rice leaf angle and tillering.

[0041] In addition, it is currently known OsPUB24 can only control the leaf angle and does not respond to phosphorus concentration, while the present invention OsPUB77 The gene can respond to phosphorus concentration and can control both tillering and leaf angle.

[0042] In summary, the rice leaf angle gene of the present invention OsPUB77 R530I The technical advantages of the allele over the above known rice leaf angle genes are: OsPUB77 R530I It is a natural variant allele that regulates the excellent plant type of rice. This allele can reduce the leaf angle without changing the tillering of rice, so it is suitable for dense planting and increase yield; and OsPUB77 The gene responds to phosphorus concentration and is strongly induced under phosphorus deficiency, so it is suitable to plant crops containing the corresponding allele under different phosphorus concentration conditions to achieve high yields. For example, OsPUB77 with a smaller leaf angle can be planted under nutrient-rich soil conditions such as high phosphorus. R530type, achieving high yield in dense planting; and under nutrient-poor conditions such as phosphorus deficiency, OsPUB77 with larger leaf angles can be planted I530 The appropriate leaf angle and tillering degree are important factors in improving photosynthetic efficiency and yield. OsPUB77 The discovery of superior variant alleles suitable for dense planting can provide an effective means for molecular breeding, thereby increasing rice yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0044] Figure 1 For wild type (NIP), ospub77 Mutants ( ospub77-1 and ospub77-2 )as well as OsPUB77 Overexpression lines ( OVPUB77-1 and OVPUB77-2 ) phenotype;

[0045] Figure 1 middle:

[0046] A: Rice OsPUB77 The gene structure model of (LOC_Os04g49500), and the mutant allele sequence constructed by the CRISPR-Cas9 system; the color map on the right is the mutation site displayed by Snapgene software; the black box shows the exon, the black line shows the intron, and the white box shows the 5'- and 3'-untranslated regions (UTR); the coding sequence below the area indicated by the red line in the genome structure model is the CRISPR target sequence, the red font underlined at the end of the sequence indicates the PAM sequence, the red short line in the sequence indicates a deletion, and the red single base indicates an insertion; ospub77-1 It includes a 1 bp insertion at the 210 bp position and a 1 bp deletion at the 1297 bp position. ospub77-2 It is a mutant with 1 bp inserted at the 865 bp position. Both strains are the mutation type that causes premature termination of the protein due to frameshift;

[0047] Right now, OsPUB77 The double-target mutant had a 1 bp insertion at 210 bp and a 1 bp deletion at 1297 bp on the first exon, which resulted in premature protein termination. The other single-target strain had a 1 bp insertion at 865 bp on the CDS, which resulted in a protein frameshift and premature termination.

[0048] BC: wild type grown for one week, ospub77 Mutant strains and OsPUB77 Phenotype of overexpression lines at seedling stage, Bar = 2 cm;

[0049] D: Wild type grown for one week, ospub77 Mutants and OsPUB77 Leaf angle statistics of overexpression lines; values ​​are expressed as mean ± standard deviation (n=10, **P<0.05 by Student's t -test);

[0050] E: Wild type at maturity in Hainan Agricultural Experimental Area, ospub77 Mutants and OsPUB77 Total tillering statistics of overexpression lines; values ​​are expressed as mean ± SD (n = 10, *P < 0.05; ***P < 0.001; by Student's t -test);

[0051] * and ** indicate significant differences ( P <0.05, Student's t test), *** indicates a very significant difference ( P <0.001, Student's t test);

[0052] FG: wild type, ospub77 Mutant strains and OsPUB77 The whole plant and tillering phenotypes of the overexpression lines at maturity, Bar=4 cm.

[0053] Figure 2 For wild type (NIP), ospub77 Mutants ( ospub77-1 )as well as OsPUB77 Overexpression lines ( OVPUB77-1 )'s occipital cross-section cytological observation;

[0054] Figure 2 middle:

[0055] AC: wild type, ospub77 Mutants -1 and OsPUB77 Overexpression strains -1 Stereoscopic observation results of the pulvinus; bar = 0.5 cm;

[0056] DF: wild type, ospub77 Mutants -1 and OsPUB77 Overexpression strains -1 Vibration section results of the occipital region; bar=50 μm;

[0057] GI: represents the enlarged view of the abaxial cells in the DE image;

[0058] JL: represents the magnified view of the adaxial end and cells in DE;

[0059] MN: Statistical graph of the results of stereomicroscope observation of the distal end length (Ab) and the proximal end length (Ad). The values ​​are expressed as mean ± standard deviation (n=3, *P<0.05 by Student's t -test);

[0060] OP: Statistical results of the proximal end length D1 and distal end length D2 of vibration-cut samples, values ​​are expressed as mean ± standard deviation (n=5, ***P<0.01; **P<0.05 by Student's t -test);

[0061] QR: Statistical results of the number of cell layers at the proximal end D1 and distal end D2 of the vibration-cut samples (n=5, ***P<0.01; **P<0.05 by Student's t -test), Bar = 50 μm.

[0062] Figure 3 for OsPUB77 Expression pattern analysis;

[0063] Figure 3 middle:

[0064] A: OsPUB77 Expression patterns in different parts of NIP; the different parts are node, leaf blade, leaf sheath, lamina joint, shoot, root, and immature and mature spike;

[0065] B: OsPUB77 fused to GFP tag vector transiently expressed in tobacco shows subcellular localization of OsPUB77, Bar = 10 μm;

[0066] C: OsPUB77 fused to GFP tag vector transiently expressed in protoplasts shows the subcellular localization of OsPUB77, Bar=5 μm.

[0067] Figure 4 To show that OsPUB77 is insensitive to exogenous BR;

[0068] Figure 4 middle:

[0069] AB: wild type under normal nutrient solution and dark culture conditions, ospub77 Mutant strains ( ospub77-1 and ospub77-2 )as well asOsPUB77 Overexpression lines ( OVPUB77-1 and OVPUB77-2 ) phenotype of coleoptile without BR and with BR; Bar=2 cm;

[0070] C: Change in the length of the coleoptile in Figure AB (length BR -length CK ) Statistics, data are expressed as mean ± SD, (n ≥ 6, ***P < 0.01; ****P < 0.001 by Student's t -test);

[0071] D: Wild type, ospub77 Mutant strains and OsPUB77 Detached leaf angle phenotype of overexpression lines; Bar = 2 cm;

[0072] E: Statistical diagram of the angle of detached leaves in different concentrations of BR, data are expressed as mean ± SD, (n ≥ 6).

[0073] Figure 5 To reflect OsPUB77 R530I The strength of interaction with UBCH1 varies;

[0074] Figure 5 middle:

[0075] A: Schematic diagram of the OsPUB77 gene structure, black squares represent exons; black lines represent introns; white rectangles represent UTR regions, green boxes represent Ubox regions, and red lines represent SNP sites;

[0076] B: Frequency statistics of SNP site G / T in the Ubox domain of OsPUB77 protein between japonica rice and indica rice;

[0077] C:OsPUB77-Ubox R530I and E2-UBCH1 yeast two-hybrid;

[0078] D: OsPUB77-Ubox R530I Detection of E3 ubiquitin ligase activity in combination with E2-UBCH1. The lower picture shows the results of GST antibody immunoblotting and GST-tag purified OsPUB77-Ubox protein. The upper picture shows the intensity of OsPUB77-Ubox's own E3 ubiquitin ligase activity as shown by Ub antibody.

[0079] EF: α-fold prediction Ubox R530I / E2 interaction strength; cyan represents UBCH1 protein, and green represents Ubox protein.

[0080] Figure 6 for OsPUB77pro ::OsPUB77 R530I change ospub77 Phenotypes of transgenic lines in mutant background;

[0081] Figure 6 middle:

[0082] A: The expression is consistent OsPUB77pro ::OsPUB77 R530I change ospub77 Phenotypic observation of transgenic lines in mutant background at the seedling stage, bar = 2 cm;

[0083] B: Wild-type NIP, ospub77 Mutant strains and expression levels are consistent OsPUB77pro ::OsPUB77 R530I change ospub77 Observation of the phenotype of transgenic lines in mutant background at maturity, bar = 10 cm;

[0084] C: OsPUB77pro ::OsPUB77 R530I Sequencing results of transgenic lines;

[0085] D: Two weeks of growth and consistent expression OsPUB77pro ::OsPUB77 R530I change ospub77 Statistics of leaf angles of transgenic lines in mutant background (data are expressed as mean ± SD, * indicates significant difference, *, P < 0.05 by Student's t -test);

[0086] E: The expression level is consistent during the mature stage OsPUB77pro ::OsPUB77 R530I change ospub77 Tillering statistics of transgenic lines in mutant background (data are expressed as mean ± SD, ns, no significance);

[0087] FG: consistent expression OsPUB77pro ::OsPUB77 R530I change ospub77 Downstream genes of transgenic lines in mutant background OsBU1 and OsIBH1 Gene expression, data are expressed as mean ± SD, (n ≥ 3, **, P < 0.05; ***, P < 0.001 by Student's t -test).

[0088] Figure 7 ,Figure 8 for ospub77 Mutant construction used vector map.

[0089] Figure 9 Flag-tagged overexpression vector ( OsPUB77 Overexpression vector) was constructed using the vector map.

[0090] Figure 10 GFP-tagged overexpression vector ( 35S:: OsPUB77-GFP vector) was constructed using the vector map.

[0091] Figure 11 for OsPUB77pro ::OsPUB77 R530I reply ospub77 Vectors of mutants.

[0092] Figure 12 GST-OsPUB77-Ubox R530I Schematic diagram of the protein purification vector. DETAILED DESCRIPTION

[0093] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0094] The specific technical steps for implementing the present invention are as follows:

[0095] I. ospub77 The leaf inclination angle of the mutant increased and the number of tillers increased. OsPUB77 The leaf inclination angle of the overexpression strains decreased and tillering decreased:

[0096] The CRISPR-Cas9 technology was used to construct OsPUB77 Knockout vector, OsPUB77 Overexpression vectors were constructed Ubi:: The OsPUB77-Flag vector was used to amplify the wild-type NIP cDNA with the stop codon removed. OsPUB77 The CDS was linked to the pTCK303 empty vector by homologous recombination and sequenced correctly. ospub77 Mutant lines and two lines with reduced leaf angle and reduced tillering OsPUB77 Overexpression strains. According to statistics, when the rice is cultured under normal growth conditions for about 7 days, after the penultimate leaf is fully grown, the angle between the leaf and the stem is significantly greater than that of the wild type. This phenomenon can also be observed in the leaves that grow later. The phenotypic observations and statistical results at maturity show that ospub77 The mutant strains had more tillers. OsPUB77 The tillering of the overexpression lines was reduced (Figure 1 BG in the figure). By observing the pulvinus of the leaves under a stereoscope, we found that the reason for the increased leaf inclination angle of the mutant was that the adaxial end of the pulvinus was elongated, causing the leaves to bend toward the abaxial end. The reason for the reduction in the overexpression strain was that both the adaxial and abaxial ends were reduced, and the thin-walled cells at the adaxial end almost disappeared ( Figure 2 AL in), causing the leaves to grow close to the stem and upright.

[0097] 2. Analysis of the expression pattern of rice OsPUB77:

[0098] By sampling various parts of NIP including nodes, leaves, leaf sheaths, leaf pillows, stems, roots and spikes for RNA extraction and quantitative analysis by qRT-PCR, it was found that OsPUB77 The highest expression was in the leaf sheath, pulvinus and root, while the expression was lower in other parts and lowest in the ear at maturity ( Figure 3 A in ). Build 35S::OsPUB77 Laser confocal microscopy of the transient expression of tobacco infected with Agrobacterium EHA105 and the transient expression of protoplasts transformed with the vector showed that OsPUB77 was co-localized in the nucleus and cytoplasm ( Figure 3 BC in).

[0099] 3. Rice OsPUB77 affects the response of leaf pulvinus to exogenous BR:

[0100] The coleoptile plays an important role in the seed germination process. It retains moisture for the newly germinated seed buds and prevents the young buds from being damaged when they first germinate. BR plays an important role in the dark morphogenesis of plants. The coleoptile grows rapidly in a dark environment and is induced by BR (Zhou et al., 2013). Exogenous BR treatment ospub77 The results of mutant and overexpression strains showed that ospub77 The mutant was more sensitive to exogenous BR. OsPUB77 The overexpression strains were insensitive to exogenous BR. The results showed that the angle of detached leaves treated with exogenous BR ospub77 The mutant was more sensitive to exogenous BR. OsPUB77 Overexpression is insensitive to exogenous BR, and the leaf angle is almost unchanged ( Figure 4 in AE).

[0101] 4. OsPUB77 I / R The strength of the interaction between proteins and E2 varies:

[0102] OsPUB77 belongs to the rice PUB family protein and performs E3 ubiquitin ligase function. There is a SNP site in its U box domain that is clearly differentiated between japonica and indica rice. This SNP is almost entirely G (99%) in japonica rice, encoding arginine R; while in indica rice, it is mostly T (78.5%), encoding isoleucine I. After yeast interaction, E3 ubiquitin ligase activity detection and α fold prediction, the results showed that OsPUB77 R530 It interacts more strongly with UBCH1 and has stronger E3 ubiquitin ligase activity. The αfold prediction results show that the R530I amino acid encoded by the SNP site is located at the interaction interface between OsPUB77 and UBCH1, and the R-type OsPUB77 binds more tightly to UBCH1, has stronger E3 ubiquitin ligase activity, and has stronger regulation of downstream genes of BR signaling ( Figure 5 in AD).

[0103] five, OsPUB77pro ::OsPUB77 R530I change ospub77 The leaf angles of transgenic lines in the mutant background are different:

[0104] OsPUB77pro ::OsPUB77 R530I change ospub77 The T0 transgenic seedlings of the mutant showed OsPUB77pro ::OsPUB77 I530 The leaf angle is larger. OsPUB77pro ::OsPUB77 R530 The leaf angle is smaller, but it does not affect the number of tillers. The upright plant type allows for dense planting, saving land resources, enhancing photosynthesis, and increasing yield. R530 Can assist in selecting upright and excellent plant types, thus achieving dense rice planting and high yield ( Figure 6 AG in ).

[0105] Embodiment 1, OsPUB77 Acquisition and identification of mutant and overexpression strains

[0106] 1. Knockout:

[0107] Using CRISPR-Cas9 technology, we designed and constructed OsPUB77 Single-target and dual-target knockout vectors ( Figure 1 A in):

[0108] By PCR cloning of a 20 nt OsPUB77 The sequence of the single target site (5'CCTCGTATCCGAGCTCGCCG3') was used with primers U3 The linker sequence (indicated by lowercase letters below) is as follows:

[0109] OsPUB77-crispr1-U3-F:5'ggcaCCTCGTATCCGAGCTCGCCG3';

[0110] OsPUB77-crispr1-U3-R:5'aaacCGGCGAGCTCGGATACGAGG3'.

[0111] The same PCR method was used to clone a 20 nt OsPUB77 The sequences of the dual targets (target one: 5'GTACTAGCGATGGCGACGG 3', target two: 5' TGACAAGCTAGCCAACGAGG 3'). The primers used were target one plus U3 Adapter and target two plus U6 Connectors (indicated by lowercase letters below), specifically:

[0112] OsPUB77-crispr2-U3-F: 5'ggcaGTACTAGCGATGGCGACGG3';

[0113] OsPUB77-crispr2-U3-R: 5'aaacCCGTCGCCATCGCTAGTAC3';

[0114] OsPUB77-crispr2-U6-F: 5'gtgtTGACAAGCTAGCCAACGAGG3';

[0115] OsPUB77-crispr2-U6-R: 5'caaaCCTCGTTGGCTAGCTTGTCA3'.

[0116] The above-mentioned single-target and double-target primers are annealed and then slowly cooled to form a double-stranded adapter, the primer concentration is 10pmol / microliter, and the system is:

[0117] OsPUB77 Single target double strand:

[0118] Primer OsPUB77-crispr1-U3-F: 10 μL; Primer OsPUB77-crispr1-U3-R: 10 μL; ddH2O: 80 μL; 95°C, 2 min; then slowly cool to room temperature;

[0119] OsPUB77 Dual targets:

[0120] Target one double strand:

[0121] Primer OsPUB77-crispr2-U3-F: 10 μL; Primer OsPUB77-crispr2-U3-R: 10 μL; ddH2O: 80 μL; 95°C, 2 min; then slowly cool to room temperature;

[0122] Target two double strands:

[0123] Primer OsPUB77-crispr2-U6-F: 10 μL; Primer OsPUB77-crispr2-U6-R: 10 μL; ddH2O: 80 μL; 95°C, 2 min; then slowly cool to room temperature.

[0124] Digestion with Eco31I U3 and U6 Vector, enzyme digestion system is:

[0125] 10×Fast Digest buffer: 2 μL

[0126] U3 / U6 vector: 1000 ng

[0127] Eco31I: 1 μL

[0128] Add water to 20 μL

[0129] The annealed primer double strands are connected to the U3 and U6 vectors that have been digested and recovered. The specific contents of the connection system are as follows:

[0130]

[0131] The above three ligation products were used as templates for the first round of PCR, and the primers used were:

[0132] UF: 5'CTCCGTTTTACCTGTGGAATCG3';

[0133] gRNA-R: 5'CGGAGGAAAATTCCATCCAC3'.

[0134] The annealing temperature was 58 °C for 28 cycles.

[0135] The second round of PCR amplification template is ten times diluted from the first round product, and the second round of PCR primers are:

[0136] OsPUB77 Single target second round primers:

[0137] B1': TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG3'

[0138] BL: AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC3'

[0139] The annealing temperature was 58 °C for 30 cycles.

[0140] OsPUB77 Dual-target second round primers:

[0141] Target 1 Second round PCR primers:

[0142] B1': TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG3'

[0143] B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC3'

[0144] Target 2 second round PCR primers:

[0145] B2': TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG3'

[0146] BL: AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC3'

[0147] The annealing temperature was 60 °C for 30 cycles.

[0148] The second round of PCR products were recovered and EcoR31I Enzyme digestion and T4 ligase are connected to the final vector pYLCRISPR-gRNA using variable cutting edge ligation.

[0149] Enzyme digestion reaction system:

[0150] 10×Fast Digest buffer: 1.5 µL; second-round PCR product: 20-70 ng; pYLCRISPR / Cas9: 60-100 ng; EcoR31I: 1 μL; ddH2O to 15 µL; react at 37 ℃ for 15 min.

[0151] After the enzyme digestion reaction is completed, add the following ligation system:

[0152] T4 buffer: 1 μL

[0153] T4 ligase: 0.5 μL

[0154] Carry out the following cycle reaction:

[0155] 10℃5 min

[0156] 20℃5 min

[0157] 37 ℃ 5 min

[0158] The above 15 cycles were completed and stored at 4 ℃.

[0159] The single-target vector was named OsPUB77-singleCas9 and the dual-target vector was named OsPUB77-doubleCas9. The heat shock method was used to transform Escherichia coli. The transformation steps were as follows: the thawed DH5α competent medium was placed on ice, and the OsPUB77-singleCas9 and OsPUB77-doubleCas9 ligation products were added. The reaction was placed on ice for 30 minutes, 42 ° C for 90 seconds, and iced for 5 minutes. After the transformation was completed, 500 μL of non-antibiotic LB liquid medium was added and slowly shaken (<200 rpm) on a 37 ° C shaker for 90 minutes, and then coated with LB plates containing kanamycin resistance. After overnight culture at 37 ° C, clones were picked and sent to the company for sequencing. The sequencing primer was FgRNA: TGGAATCGGCAGCAAAGG.

[0160] The sequenced vectors were transferred into EHA105 competent cells using the freeze-thaw method. The steps are as follows:

[0161] (1) Take 200 ng of plasmid and add it to the freshly melted EHA105 competent medium, gently blow and mix, and let it stand on ice for 10 min; (2) Put it in liquid nitrogen for 1 min; (3) Incubate at 37℃ for 5 min; (4) Add 1 mL of antibiotic-free YEP liquid medium and culture at 28℃, 200 rpm for 2 h; (5) Spread it on YEP solid medium containing corresponding antibiotics and put it in a 28℃ incubator for 48 h. After the Agrobacterium grows up, shake it vigorously in the YEP medium with kanamycin and streptomycin double resistance. After the bacterial liquid is activated, it infects the mature callus tissue of Nipponbare, and after co-cultivation, screening and differentiation and rooting process (the transgenic process is detailed in Example 1-3 below), the Agrobacterium is obtained. ospub77 The single-target and double-target mutant strains were designed to identify the transgenic positive seedlings (the genome extraction of transgenic seedlings is detailed in the following Examples 1-4).

[0162] The single target identification primers are:

[0163] Fsingle: GCATGATCAATTGCGCATGCAA, Rsingle: GTACCGGCTCTCGACGAGTCC;

[0164] The dual target identification primers are:

[0165] The target site identification primers are:

[0166] Fdouble1:GTCATTGCTTCGCGACCTCCTC, Rdouble1:GTTGTAGCTCCTCGCGCTCATC;

[0167] The primers for target 2 identification are:

[0168] Fdouble2:CGCATGCTACTACAGAGATTG, Rdouble2:GCATGATCAATTGCGCATGCAA.

[0169] in ospub77-1 and ospub77-2 The genome extraction method is described in detail in Example 1-IV below. A 400-500 bp DNA fragment including the initial CRISPR target site was amplified and sent to a sequencing company for sequencing. The sequencing primers were the above-mentioned PCR primers. The sequencing primers for the dual-target strain were Fdouble1 and Fdouble2, and the sequencing primer for the single-target strain was Fsingle. The sequencing results were compared with OsPUB77 The genome sequences were compared and the results showed that the double-target vectors caused OsPUB77 The mutant form with a G base inserted at 210 bp and an A base deleted at 1297 bp in the CDS was named ospub77-1 and single-target vectors OsPUB77 The mutant form with an A base inserted at 865 bp on the CDS is named ospub77-2 , both forms of mutations lead to premature termination of OsPUB77 protein, such as Figure 1 As described in A. Transgenic T1 plants were obtained by normal culture and propagation and backcrossed with NIP (Nipponbare), and the phenotypes of F2 homozygous mutants were observed.

[0170] The results showed that the mutant ospub77-1 and ospub77-2 All of them are characterized by increased leaf angle, more tillers at maturity, and loose plant shape. Figure 1 As described in B and F.

[0171] ospub77-1 The protein sequence is shown in SEQ ID NO:5, ospub77-2 The protein sequence is shown in SEQ ID NO:6.

[0172] 2. Overexpression:

[0173] The overexpression vector of OsPUB77 fused with Flag tag was constructed by using NIP cDNA as template and amplifying OsPUB77 The CDS sequence of the gene (SEQ ID NO: 1) was used, and the primers used were Kpn1 andSpe1 The restriction site is underlined and the primer sequence is:

[0174] Ubi:: OsPUB77-Flag-F-Kpn1( OVPUB77- F-Kpn1): GGATCCCCG GGTACC ATGGCGCCGCCGCCGTCGT

[0175] Ubi:: OsPUB77-Flag-R-Spe1 ( OVPUB77 -R-Spe1):GTAGTCCAT ACTAGT ACTATTTCCCTTCTGTGACA

[0176] Amplification conditions were:

[0177] Pre-denaturation at 95°C for 5 min;

[0178] Denaturation at 95°C for 5 min, annealing at 62°C for 30 s, and extension at 68°C for 2 min, for 33 cycles;

[0179] Extension was performed at 68°C for 5 min.

[0180] The resulting fragment was connected to the pTCK303 vector by homologous recombination and named OsPUB77-Flag. The single fragment homologous recombination was performed using the kit of Novozyme (Cat. No. C112). The system was as follows:

[0181] CEII buffer: 4 μL; CEII enzyme: 2 μL; OsPUB77 CDS fragment: about 200 ng;

[0182] pTCK303 vector: about 100 ng; add water to 20 μL; connect at 37 ℃ for 30 min.

[0183] After the connection was completed, the heat shock method was used to transform E. coli. The transformation steps were the same as those described in Example 1-1. After the transformation was completed, the LB plate containing kanamycin resistance was coated. After overnight culture at 37°C, clones were picked and sent to the company for sequencing. The sequencing primer was F: ATGGCGCCGCCGCCGTCGT. The vector OsPUB77-Flag was transferred into Nipponbare ( Nipponbare ) in mature callus tissue, after co-cultivation, screening and differentiation and rooting process (the genetic modification process is detailed in Example 1-3), OsPUB77 -Flag overexpression line transgenic T0 rice seedlings, OsPUB77 The method for extracting the genome of the overexpression strain is detailed in Example 1-4. The primers for identifying positive seedlings of the overexpression strain are specifically:

[0184] OsPUB77-Flagtset-F: CTGCAGTGCAGCGTGACCCGGTCG

[0185] OsPUB77-Flagtest-R:TTGTAGTTGCCGTCGTCCTTGAAG

[0186] At the same time, hygromycin identification was performed, and the specific identification primers were:

[0187] Upstream primer: 5' CGAGTACTTCTACACAGCCATC 3'

[0188] Downstream primer: 5' TAGCGAGAGCCTGACCTATT 3'.

[0189] The seedlings that can amplify the band are OsPUB77 Overexpression positive seedlings.

[0190] The results showed that the overexpression materials of OsPUB77 fused with the Flag tag showed reduced leaf angle, fewer tillers, shorter plant height, and an upright and compact plant shape. Figure 1 As described in C and G.

[0191] The above-mentioned Nipponbare mature callus preparation and transgenic process are as follows.

[0192] 3. Rice genetic modification process

[0193] 3.1 Induction of rice callus

[0194] (1) Disinfection: Take mature Nipponbare ( Nipponbare ) Rice seeds, shelled, placed in a 50 mL sterile centrifuge tube, and sterilized with 15 mL 75% ethanol for 2 min;

[0195] (2) Pour off the alcohol, add 30 mL of 30% sodium hypochlorite (NaClO), and place on a shaker and shake slowly for 30 minutes;

[0196] (3) Pour away the sodium hypochlorite solution and wash with sterile water 4-5 times, 2 min each time.

[0197] 3.2 Induction and subculture

[0198] (1) Place the seeds on sterile filter paper to absorb moisture, place on induction medium, about 20-30 seeds per dish, and seal;

[0199] (2) Cultivate at 28°C under light for 3-4 weeks;

[0200] (3) Select embryonic callus tissue, place it on subculture medium, and culture it at 28°C for 1 week.

[0201] 3.3 Co-cultivation and selection of resistant callus

[0202] (1) Agrobacterium culture

[0203] Pick a single Agrobacterium colony and place it in 20 mL YEP liquid medium (containing 50 mg / L kanamycin and 50 mg / L streptomycin) and culture at 28°C and 230 rpm until OD 600 =0.8;

[0204] (2) Co-culture

[0205] A. Transfection of japonica rice callus: Take the cultured bacterial solution, centrifuge at 4,000 rpm at room temperature for 10 min, discard the supernatant to collect the bacterial cells, and resuspend the bacterial cells in the transformation solution containing 200 μM acetosyringone to a final concentration of OD 600 =0.1, placed on a horizontal shaker at 80 rpm, activated for 1.5 h; picked out the callus obtained above, put it into the bacterial solution, and shook it on a horizontal shaker at 80 rpm for 10 min;

[0206] B. Remove the callus tissue and drain it on sterile filter paper for 30-40 min;

[0207] C. Place the callus on a japonica rice culture medium covered with a piece of sterile filter paper and culture it in the dark at 25 ℃ for 3 days.

[0208] (3) Selective training

[0209] A. Take out the callus tissue, wash it with sterile water for 5-6 times, shaking continuously for about 2 minutes each time, then wash it twice with sterile water containing 300 mg / L Carb (sodium carbenicillin), shake it on a horizontal shaker at 80 rpm for 30 minutes, and place the callus tissue on sterile filter paper to drain for 2 hours;

[0210] B. Place the callus on a selection medium containing 300 mg / L Carb and corresponding selection elements and culture at 28°C under light for 2 weeks;

[0211] C. Transfer the resistant calli on the selection medium to the selection medium containing 300 mg / L Carb and hygromycin for the second round of selection culture at 28°C under light for 2 weeks.

[0212] 3.4 Induction of differentiation and rooting culture of resistant callus

[0213] Pick ospub77 Mutant strain callus and OsPUB77The resistant callus tissue of the overexpression strain was 3 per pot, and 25 pots were prepared and transferred to the differentiation medium. The callus tissue was cultured in a 25 ℃ culture room (16 h light) until it differentiated into seedlings (about 40 days). When the seedlings were 4 cm long, they could be taken out of the differentiation pot.

[0214] 3.5 Hardening and transplanting of transgenic seedlings

[0215] After the transgenic seedlings were taken out of the differentiation tank, they were placed in a wide-mouthed container, and distilled water was added to cover the roots of the seedlings. They were placed in a greenhouse and hardened for 1-2 days. After that, they were transplanted into a 50 L rice planting tank. The composition of the nutrient solution is as shown in Table 1:

[0216] Table 1 Rice nutrient solution formula

[0217]

[0218] T0 transgenic seedlings were cultured under normal conditions (daytime temperature: 28-30°C, nighttime temperature: 20-22°C; photoperiod: 7:00-19:00; relative humidity: 65%; light density: 250-300 μmol m-2 s-1; the nutrient solution formula for rice is shown in Table 1; the pH value of the rice culture solution is 5.5-5.8. The nutrient solution was replaced every 7 days.

[0219] IV. Rapid extraction of genomic DNA (TPS method)

[0220] 1. Take a 1 cm leaf and place it in a 2 ml centrifuge tube. Add 200 µL TPS extract (100 mM Tris-HCl (pH 8.0), 10 mM EDTA (pH 8.0), 1 M KCl), add sample beads, cover the centrifuge tube tightly, and shake it in a TissueLyserⅡ (QIAGEN, USA) for 1.5 min. The frequency is 25 times / second.

[0221] 2. Place the mashed tissue homogenate in a 65°C water bath for 30 min. Then carefully pour out the sample beads, centrifuge the remaining sample at 12,000 rpm for 10 min, and take the supernatant as the template.

[0222] OsPUB77 overexpression strains were also identified by Western PCR, and those with positive bands were selected as subsequent experimental materials. The Western PCR steps were as follows: (1) OsPUB77 overexpression strain transgenic rice seedlings grown for about two weeks were placed in a 2 mL centrifuge tube and quickly frozen with liquid nitrogen. Sample beads were added and powdered on a large sample machine. At a volume ratio of 1:1, an appropriate amount of extraction buffer (50 mM Tris-HCL PH7.5, 150 mM NaCl, 1 mM PMSF, 20 μM MG132, cocktail 1 tablet / 50 mL, 0.8% TritionX-100) was added and immediately shaken to mix thoroughly, and lysed on ice for 15 min. Precool a small centrifuge to 4 °C in advance, centrifuge at 12,000 rpm for 15 min, transfer the supernatant to a new 1.5 mL centrifuge tube, and place on ice. This is the total protein of the plant. (2) The total protein content of the plant was detected using Bio-Rad's Protein Assay, and the absorbance was measured at OD595nm to calculate the protein concentration. The extracted plant protein can be directly used in subsequent Western blot experiments, and the excess protein samples can be stored at -80°C. (3) Add 5× protein loading and place on a 99°C heater for 10 minutes to completely denature the protein, and perform SDS-PAGE separation and immunoblotting analysis.

[0223] Western blot experiment:

[0224] (1) Take out the precast gel from the 4 ℃ refrigerator; (Hangzhou Aoqian Biotechnology Co., Ltd., catalog number: M00929), and choose an 11-well or 15-well gel according to your sample loading volume. (2) Take 10 μg of total protein, add 5× Loading Buffer, boil at 99 ℃ for 10 min, centrifuge briefly and then perform electrophoresis detection (electrophoresis time is adjusted according to protein size). (3) Transfer: After the protein electrophoresis is completed, use the semi-dry transfer method at 4 ℃, constant voltage (12 V), 40 min. (4) Blocking: After the transfer is completed, wash once with TBST, add 5 mL of TBST-prepared milk (TBSTM), and incubate at room temperature for 1 h. (5) Primary antibody immunization: After the blocking is completed, wash once with TBST, add TBSTM containing primary antibody (the amount of primary antibody is determined by the titer of the antibody), incubate at room temperature for 3 h or at 4 ℃ overnight; FLAG (sigma; 1:5000). (6) Secondary antibody immunization: Wash the membrane 3 times with TBST, 5 min each time, add TBSTM containing secondary antibody (the dilution of secondary antibody can also be determined according to the titer of the antibody), and incubate at room temperature for 1 h; (rabbit anti-mouse: 1:5000). (7) After the color development immunization process is completed, wash the membrane 3 times with TBST, 5 min each time, and use HRP for color development; Note: The protein size is indicated by protein marker. Coomassie Brilliant Blue (CBB) staining is used to indicate the amount of protein loaded.

[0225] The results of Example 1 above are as follows: ospub77-1 and ospub77-2 Mutant strains; obtained through molecular identification and protein identification OsPUB77 Transgenic positive seedlings of the overexpression strain fused with the Flag tag. Based on this result, we can know that: ospub77-1 It is a double-target mutant. ospub77-2 It is a single-target mutant, and both mutant lines show premature protein termination; ospub77-1 and ospub77- 2 It is manifested by increased leaf angle, more tillers, and loose plant shape; OsPUB77 The overexpression strain fused with the Flag tag was able to express the protein normally, and the overexpression strain showed reduced leaf angle, fewer tillers, lower plant height, and a compact and upright plant shape.

[0226] Embodiment 2, OsPUB77 Analysis of leaf occipital sections of mutant and overexpression lines

[0227] 1. Sample embedding: The samples are selected from one-month-old rice (Nipponbare, ospub77-1 and OsPUB77 overexpression strain line - 1 ( OVPUB77-1)) The leaf angle is fixed with FAA solution (90 mL of alcohol, 5 mL of formalin, and 5 mL of glacial acetic acid) and then embedded. Prepare 4% agarose gel, heat and boil in a microwave oven until it becomes transparent and the bubbles disappear. Pour it into a small culture dish while wearing thick gloves. When it cools to about 70 ℃, add the cut rice leaf angle. Use tweezers to hold the leaf angle and insert it into the agarose in the small culture dish. After solidification, the leaf angle stands upright in the middle of the culture dish. Trim the agar around the embedded leaf angle until the leaf angle can be trimmed into a cube or rectangular embedded sample.

[0228] 2. Vibration sectioning: After the button on the back of the slicer is turned on, the machine will start up naturally. Pour clean water into the black groove in the middle of the machine, drip glue on the magnet, usually 502 glue, stick the cut sample glue block on the glue, wait for one minute until it is completely glued, and then put it into a black box filled with clean water, and the magnet will absorb it with the magnet at the bottom of the box. At this time, install the blade for sectioning, and after the embedded sample is absorbed, it can be operated for sectioning.

[0229] 3. When slicing, first press up or down to adjust the height distance between the sample and the blade. When the knife stops at the appropriate position, press continue for continuous slicing. The machine can automatically slice continuously. The detached slices are floating in the clear water in the black box. Pick them up with a brush or tweezers and place them on the slide. Cover them with a coverslip and observe under a microscope.

[0230] 4. Open the microscope software on the computer and select BR (Basic Research) mode. First observe under the 4× eyepiece, then observe under 10× and 20×, switch the front field of view and project it on the computer to take a photo and save it.

[0231] The results of Example 2 are as follows: ospub77 The length of the adaxial end of the pulvinus of the -1 mutant strain is greater than that of Nipponbare, and the cross-sections of the pulvinus show that the adaxial end distance and the number of cell layers are more than those of Nipponbare NIP; ospub77 The distance of the abaxial end of mutant line-1 did not change relative to Nipponbare NIP; OsPUB77 Overexpression line-1 ( OVPUB77-1 ) The distance between the adaxial end and the abaxial end of the occipital is smaller than that of Nipponbare NIP, and the cross-section of the occipital part shows that the number of cell layers at the adaxial end and the abaxial end are smaller than that of Nipponbare NIP. Figure 2 As shown in AR in. According to this result, we can know that: OsPUB77 The gene controls the size of the leaf angle by controlling the development of the adaxial and abaxial cells in the rice leaf pulvinus. OsPUB77 Gene mutations can increase the number of thin-walled cell layers at the adaxial end and increase leaf angles; OsPUB77When the gene is overexpressed, the parenchyma cells at the adaxial end almost disappear, and the parenchyma cells at the abaxial end also decrease, resulting in a decrease in leaf angle.

[0232] Embodiment 3, OsPUB77 Expression pattern analysis

[0233] Extract various parts of NIP (nodes, leaves, leaf sheaths, leaf pillows, stems, roots, and panicles) during the growth and maturity stages for quantitative PCR experimental verification. The steps for extracting rice RNA using Trizol are as follows:

[0234] (1) Take about 200 mg of rice leaves and put them into a pre-cooled mortar. Add liquid nitrogen and grind them into powder. Use a pre-cooled spatula to transfer the powder into an RNase-free 2 mL centrifuge tube.

[0235] (2) Add 1 mL of Trizol iso plus liquid, shake vigorously to mix, and place at 4 °C for 5 min;

[0236] (3) Centrifuge at 4°C, 12,000 rpm for 10 min.

[0237] (4) Pipette 800 μL of supernatant, transfer, add 200 μL of pre-cooled chloroform, invert to mix, and place on ice for 5 min;

[0238] (5) Invert to mix, and centrifuge at 12,000 rpm at 4 °C for 10 min.

[0239] (6) Carefully aspirate the supernatant with a 200 μL pipette, transfer approximately 400 μL of the supernatant to an Axygen RNase-free 1.5 μL centrifuge tube, add 400 μL of pre-cooled isopropanol, invert to mix, and place at -20 °C for 20 min.

[0240] (7) Centrifuge at 4°C, 12,000 rpm for 10 min. A white RNA precipitate will appear at the bottom of the centrifuge tube.

[0241] (8) Pour off the supernatant and wash the precipitate with 75% alcohol (prepared with DEPC water). Repeat this step once. Place the centrifuge tube in a fume hood and wait for the alcohol to evaporate. Add 20 μL of RNase-free water and dissolve at 4 °C for more than 30 min.

[0242] (9) The RNA concentration was measured using the NanoDrop ND1000 Nucleic Acid Protein Assay Instrument. The samples were quickly frozen in liquid nitrogen and stored at -80°C or used immediately for reverse transcription reaction.

[0243] The specific contents of the reverse transcription system are shown in Table 2 below:

[0244] Table 2 Reverse transcription system

[0245]

[0246] Total RNA was extracted from different parts of rice NIP (leaves, leaf sheaths, leaf pillows, stems, and roots) after 7 days of growth; total RNA from immature panicles and nodes of NIP at the heading stage and total RNA from panicles of NIP at the mature stage were used for relative quantification. OsPUB77 The quantitative primers are OsPUB77 -qPCR-F:GAAGAGCTACACTCACTCACTTCA, OsPUB77 -qPCR-R: AATTGGCACATAACTCGTTGACTC. Using SYBR green I chimeric fluorescence kit and real-time fluorescence quantitative PCR system LightCycler ® RT-qPCR reaction was performed using 480 (Roche, Germany). The specific contents of the RT-qPCR reaction are described in the following table:

[0247]

[0248] Adoption 2 -△△CT The RT-qPCR data were analyzed by using the housekeeping gene OsActin (LOC_Os03g50885) was used as a quantitative standard or internal reference to correct the quantitative data of all samples.

[0249] The results of Example 3 above are as follows: qRT-PCR experiments found that OsPUB77 The highest expression was in the leaf sheath, pulvinus and root, while the expression was lower in other parts and lowest in the ear at maturity, e.g. Figure 3 As described in A; Based on this result, we can know that: OsPUB77 The expression site of α is consistent with the phenotype it controls, and its expression is higher in the leaf sheath, which means OsPUB77 Plays a key role in the regulation of leaf angle.

[0250] Embodiment 4, OsPUB77 Subcellular localization analysis

[0251] The subcellular localization and tissue expression of genes affect the function of genes. By constructing a vector with a luminescent tag (such as GFP), the subcellular localization of OsPUB77 can be observed. The vector construction of OsPUB77 fused with GFP tag uses NIP cDNA as a template and amplifies OsPUB77 The CDS sequence of the gene (SEQ ID NO: 1) was used, and the primers used were Kpn1 and Sal1 Restriction sites (underlined):

[0252] 35S:: OsPUB77-GFP-F-Kpn1:

[0253] GGACGAGCTC GGTACC ATGGCGCCGCCGCCGTCGT

[0254] 35S:: OsPUB77-GFP-R-Sal1:

[0255] GCTCACCAT GTCGAC ACTATTTCCCTTCTGTGACA

[0256] Amplification conditions: 95°C pre-denaturation for 5 min,

[0257] Denaturation at 95 °C for 5 min, annealing at 62 °C for 30 s, and extension at 68 °C for 2 min were performed for 33 cycles;

[0258] The extension was completed at 68°C for 5 min.

[0259] and ligated using homologous recombination 35S ::GFP was loaded empty, and the resulting 35S:: OsPUB77-GFP, homologous recombination ligation was performed using the same kit as in Example 1-2, the system was:

[0260] CEII buffer 4 μL

[0261] CEII enzyme 2 μL

[0262] OsPUB77 CDS fragment about 200 ng

[0263] Carrier about 100 ng

[0264] Add water to 20 μL;

[0265] After the ligation is completed, DH5α transformation is performed and a single clone is picked and sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing. The specific sequencing primers are:

[0266] GFP-F1: ATGGCGCCGCCGCCGTCG

[0267] GFP-F2: GATGGCAGTCAAATATCCATTT

[0268] Sequencing correctly 35S::OsPUB77-GFP vector was transformed into Agrobacterium EHA105 and then infected into tobacco or rice protoplasts, and the subcellular localization of OsPUB77 protein could be observed. The steps of vector transformation into Agrobacterium and infection into tobacco are as follows:

[0269] The vector was transformed into Agrobacterium EHA105 competent cells by freeze-thaw method

[0270] (1) Pipette 200 ng of plasmid and add it to the freshly melted EHA105 competent medium. Mix well by gently pipetting and place on ice for 10 min.

[0271] (2) Place in liquid nitrogen for 1 min;

[0272] (3) Incubate at 37°C for 5 min;

[0273] (4) Add 1 mL of antibiotic-free YEP liquid medium and culture at 28 °C and 200 rpm for 2 h;

[0274] (5) Apply the solution on YEP solid culture medium containing the corresponding antibiotics and place it in a 28°C incubator for 48 h.

[0275] Steps for Agrobacterium infection of tobacco:

[0276] Constructed 35S:: The OsPUB77-GFP vector was transferred into Agrobacterium for cultivation. The positive clones were selected and shaken in a 28 ℃ shaker for 16 h to reach an OD = 1. The tobacco growth environment is long daylight (> 14 h) and the temperature is 24 ℃. Select tobacco leaves with thick leaves and strong growth to inject the activated Agrobacterium. After two days, observe under a two-photon fluorescence microscope. Cut 1 cm 2 Place the tobacco leaves infected by Agrobacterium on the left and right sides, with the reverse side facing up, on a glass slide with water drops, cover with a coverslip, place on the stage, switch to a 20x microscope to focus and find the field of view, drop water on the coverslip and switch to a 25x water microscope for observation. Turn on the laser light, adjust to 488 nm laser to observe whether there is green fluorescence expression, and take pictures.

[0277] The steps for rice protoplast preparation and transformation are as follows:

[0278] 1 M mannitol (sigma FW:182.17)

[0279] 50 mL of mother liquor corresponds to 9.1085 g soluble in water (can be placed at 55 °C to aid dissolution);

[0280] 0.2 M KCl (FW: 74.55)

[0281] 50 mL of mother liquor corresponds to 0.7455 g dissolved in water;

[0282] 1 M CaCl2 (FW:110.98)

[0283] 50 mL of mother liquor corresponds to 5.549 g dissolved in water;

[0284] 0.5 M MgCl2 (FW: 203.3)

[0285] 50 mL of mother liquor corresponds to 5.0825 g dissolved in water;

[0286] 0.5 M NaCl (FW: 58.44)

[0287] 50 mL of mother liquor corresponds to 4.495 g dissolved in water;

[0288] 0.1 M MES (FW:195.24)

[0289] 50 mL of mother liquor corresponds to 0.976 g. Dissolve in water and adjust pH to 5.7 with KOH.

[0290] The formulas of enzymatic solution, W5 solution, MMG solution, and 40% PEG4000 solution are as follows:

[0291]

[0292] 1. Take 14-day-old rice seedlings, cut off the roots and stems, and cut the leaves into pieces of 0.1 mm in length with a blade.

[0293] 2. Wrap the small beaker with tin foil and place it on a shaker to avoid light. Slowly shake it at 40 rpm and 28 ℃ for 5 hours. Then add an equal volume of W5 solution and shake it on the shaker again under the same conditions for 30 minutes. Take it out and gently shake the culture dish by hand for 2 minutes to fully release the protoplast cells.

[0294] 3. Use a cell strainer with a diameter of about 40 μm to filter the enzymatic solution into a new 50 mL centrifuge tube, then wash the residue twice with the same volume of W5 solution, and transfer them into the same 50 mL centrifuge tube. Finally, the volume of W5 solution in the centrifuge tube is 3 times that of the enzymatic solution. Drain the enzymatic solution into the centrifuge tube during filtration to avoid violent impact that may cause protoplast rupture.

[0295] 4. Centrifuge the filtered protoplast suspension at 1500 rpm for 4 min at room temperature to collect the protoplasts.

[0296] 5. Carefully remove the supernatant with a pipette, slowly add 30 mL of W5 solution along the tube wall, resuspend, gently mix, and centrifuge at 1500 rpm for 5 min at room temperature. Discard the supernatant.

[0297] 6. Add 30 mL of W5 solution, mix gently, place on ice for 30 min, and incubate at room temperature at 1500 rpm for 4 min.

[0298] 7. Discard the supernatant, add an appropriate volume of MMG to resuspend the cells, count the cells on a slide and observe under a microscope, and adjust the protoplast concentration to 2.5-5×10 6 Pieces / mL.

[0299] 8. PEG-mediated DNA transformation. Add 35S:: GFP-OsPUB77 plasmid DNA (6-8 μg, total volume should be less than 20 μL), add the adjusted concentration of protozoan cells and mix gently, then add 40% PEG solution again. Because its texture is relatively viscous, use a cut pipette tip to absorb it.

[0300] 9. Mix gently and incubate at room temperature in the dark for 20 min.

[0301] 10. Add 1 mL of W5 solution, mix well to terminate the reaction, centrifuge at 100 rpm to remove the PEG and reduce damage to the cells. Add an appropriate amount of MMG solution according to the concentration of protozoa, and incubate at 28°C in a dark incubator overnight for 12-15 hours.

[0302] 11. Centrifuge at 100 rpm for four minutes, discard the supernatant, and use the remaining about 40 μL to pipette onto a glass slide for observation. Use a Zeiss LSM710 laser confocal scanning microscope to observe the fluorescent protein signal and take photos.

[0303] The results of Example 4 are as follows: 35S:: Laser confocal microscopy of transient expression of OsPUB77-GFP fusion protein in tobacco and protoplasts showed that OsPUB77 was co-localized in the nucleus and cytoplasm. Figure 3 As described in BC in Figure 2, based on these results, it can be seen that OsPUB77 functions in the cell nucleus and the cytoplasm.

[0304] Example 5: Observation of the change in the angle between coleoptile and detached leaf after exogenous brassinolide treatment

[0305] Exogenous treatment with brassinolide

[0306] (1) Observe the response of coleoptile to exogenous BR. ospub77 Mutants and OsPUB77The overexpressing materials were sown into hydroponic boxes of the control group (without exogenous BR) and the experimental group (1 μM exogenous BR) and cultured in the dark for seven days (daytime temperature: 28-30°C, nighttime temperature: 20-22°C; relative humidity: 65%); then the length of the coleoptile was counted and photographed.

[0307] (2) Observe the response of the detached leaf angle to exogenous BR. NIP cultured normally for seven days, ospub77 as well as OsPUB77 The leaf angle of the second leaf of the overexpressing material was cut off and placed in 0, 10 nM, 100 nM, and 1000 nM BR solution at 30°C in the dark for 12 hours. The sample was taken out for observation and photography, and the leaf angle of each material was measured using ImageJ software. The method for suspension treatment of isolated leaf pulvinus was referred to the method of Guo et al. (Guo et al., 2021). 5-6 biological replicates were placed in each culture dish.

[0308] The results obtained in Example 5 are as follows: After exogenous BR treatment was performed on the coleoptile and the angle of the rice detached leaf, the statistical results showed that: ospub77-1 and ospub77-2 The mutant was more sensitive to exogenous BR, as shown by ospub77- 1 and ospub77-2 After BR treatment, the mutant had longer coleoptiles and a larger leaf angle than the wild type; OsPUB77 The overexpression strains were insensitive to exogenous BR, as shown by the lack of obvious elongation of the coleoptiles and almost no increase in the leaf angle after BR treatment. Figure 4 According to the results, we can know that: ospub77-1 and ospub77-2 More sensitive to BR, OsPUB77 The overexpression lines were insensitive to BR.

[0309] Example 6, OsPUB77 I / R The interaction strength between natural variant site subtypes and UBCH1 is different

[0310] 1. Yeast interaction detection OsPUB77 R / I和UBCH1 Difference in interaction strength:

[0311] OsPUB77 R530I The fragment (i.e., OsPUB77 as shown in SEQ ID NO: 1) R , OsPUB77 as shown in SEQ ID NO:3 I ) were ligated into the yeast pGADT7 vector, the UBCH1 (UniProt: P61086) fragment was ligated into the yeast pGBKT7 vector, and the OsPUB77 R and OsPUB77 IThe cloning template of the fragment was the leaf tissue cDNA of Nipponbare NIP, and the cloning template of the UBCH1 fragment was the human heart tissue cDNA, thus obtaining AD-OsPUB77 and AD-OsPUB10, respectively. R 、AD-OsPUB77 I and BD-UBCH1 vector. The primers used were EcoR1 and BamH1 The restriction sites (underlined) are as follows:

[0312] AD-OsPUB77Ubox R -F-EcoR1: GCCATGGAGGCCAGT GAATTC ATGAGCGTGTTCCATGAGT

[0313] AD-OsPUB77Ubox R -R-BamH1: CAGCTCGAGCTCGAT GGATCC TTTCATTCAGAGTTCAGAGTTTTG

[0314] AD-OsPUB77Ubox I -F1-EcoR1: GCCATGGAGGCCAGT GAATTC ATGAGCGTGTTCCATGAGT

[0315] AD-OsPUB77Ubox I -R1: GCACATTATGATGCCTTTAT

[0316] AD-OsPUB77 I -F2: ATAAAGGCATCATAATGTGC

[0317] AD-OsPUB77 I -R2-BamH1: CAGCTCGAGCTCGAT GGATCC TTTCATTCAGAGTTCAGAGTTTTG

[0318] BD-UBCH1-F: ATGGCCATGGAGGCC GAATTC ATGGCCAACATCGCGGTGCAG

[0319] BD-UBCH1-R: CCGCTGCAGGTCGAC GGATCC TTTTAGACTCAGAAGCAATTCTGT

[0320] OsPUB77 R / IThe fragment amplification program was: pre-denaturation at 95 °C for 5 min,

[0321] Denaturation at 95 °C for 2 min; annealing at 61 °C for 30 s; and extension at 8 °C for 2 min were repeated for 33 cycles.

[0322] The extension was completed at 68°C for 5 min.

[0323] The amplification procedure of UBCH1 fragment was as follows: pre-denaturation at 95°C for 5 min,

[0324] Denaturation at 95 °C for 2 min; annealing at 60 °C for 30 s; extension at 72 °C for 2 min; these three steps were repeated for 33 cycles;

[0325] The extension was completed at 72°C for 5 min.

[0326] AD-OsPUB77 R The homologous recombination system with BD-UBCH1 is:

[0327] CEII buffer 4 μL

[0328] CEII enzyme 2 μL

[0329] Fragment about 200 ng

[0330] About 100 ng of digested vector

[0331] Add water to 20 μL; the kit item number is the same as Example 1-2.

[0332] AD-OsPUB77 I The multi-fragment homologous recombination system is:

[0333] CE mutis buffer 4 μL

[0334] CE mutis enzyme 2 μL

[0335] Fragment 1: about 200 ng

[0336] Fragment 2 About 200 ng

[0337] About 200 ng of digested vector

[0338] Add water to 20 μL; the product number of the multi-fragment homologous recombination kit is C113 from Novozymes.

[0339] After transformation to DH5α, sequencing was performed. The transformation steps were as described in Example 1. The sequencing primer sequences were:

[0340] Gal4-F1: CACGATGCACAGTTGAAG

[0341] Gal4-F2:TTTTCAGTATCTACGAT

[0342] The steps of yeast two-hybrid are as follows:

[0343] (1) Boil carrier DNA at 95°C for 5 min, then place on ice for 2 min. Repeat once.

[0344] (2) In a fume hood, pack and label the competent cells of AH109. Add the corresponding plasmids into the corresponding tubes.

[0345] (3) Add 10 μL carrier DNA and 500 μL PEG / LiCl to each tube.

[0346] (4) Incubate at 30°C for 30 min; incubate at 42°C for 15 min. Shake 6-8 times during each incubation.

[0347] (5) Centrifuge at 600 rpm for 1 min and discard the supernatant. Resuspend and wash with 500 μL sterile ddH2O. Centrifuge again and discard the supernatant. Resuspend with 50 μL ddH2O and apply to two plates.

[0348] (6) Observe the growth of the plate for 48 h to 96 h. Use the di-deficient liquid (-Trp / Leu) to shake until OD = 1. Dilute 10-fold, 100-fold and 1000-fold to point the di-deficient plate (-Trp / Leu) and the tetra-deficient plate (-His / Leu / Trp / Ade) and grow at 30 °C for 48 h to observe the results.

[0349] 2. OsPUB77-Ubox R530I E3 ligase activity assay:

[0350] Construction of GST-OsPUB77-Ubox R530I Vector and purification of GST-OsPUB77-Ubox R530I Protein, validation of OsPUB77-Ubox R530 and OsPUB77-Ubox I530 The activity strength of each E3 ubiquitin ligase. R530 and OsPUB77-Ubox I530 The primers used for constructing each vector were added EcoR1 and Xho1 The restriction site (underlined) and primer sequences are as follows:

[0351] GST-OsPUB77Ubox R-F-EcoR1: GGATCCCCG GAATTC ATGAGCGTGTTCCATGAGT

[0352] GST-OsPUB77Ubox R -R-Xho1: ATGCGGCCG CTCGAG TCATTCAGAGTTCAGAGTTTTG

[0353] OsPUB77Ubox I -F1-EcoR1: GGATCCCCG GAATTC ATGAGCGTGTTCCATGAGT

[0354] OsPUB77Ubox I -R1: TTGGGCACATT A TGATGCCTTTATC

[0355] OsPUB77Ubox I -F2: GATAAAGGCATCA T AATGTGCCCAA

[0356] GST-OsPUB77Ubox I -R2:ATGCGGCCG CTCGAG TCATTCAGAGTTCAGAGTTTTG

[0357] The template is the cDNA sequence of NIP. The I-type Ubox construction is introduced into the SNP site by primers and connected into the vector by multi-fragment homologous recombination. The R530I site is represented by the underlined letters in the primer sequence. The correctly sequenced vector was induced to express in BL21 bacteria at 16 ℃, 16 h, 200 rpm and the protein was purified. The GST protein purification method was carried out according to the GST beads manual (Cat. No.: SA008025).

[0358] The E3 ligase activity detection method is as follows: prepare 20× E3 ubiquitination reaction solution (1M Tris-HCl PH7.4, 200mM MgCl2, 200mM ATP), UBCH1 ( Enzo , Part No.: BML-UW9920-0001) and OsPUB77-Ubox R530 and OsPUB77-Ubox I530 Mix the reaction and react at 28 °C for 1.5 h. After the reaction is completed, use Ub (Cat. No.: P4D1) to detect the E3 ligase activity of the two.

[0359] The specific contents of the reaction system are described in the following table:

[0360]

[0361] 3. Bioinformatics method to predict OsPUB77-Ubox R / I The interaction strength with UBCH1.

[0362] Prediction of Ubox of OsPUB77 using α-fold R / I The binding strength with UBCH1 protein was displayed using pmol software.

[0363] The results of Example 6 are as follows: After the binding ability test with E2 (UBCH1), it was found that the R-type Ubox protein has a stronger binding to E2, and the E2 / E3 binding experiment proves that the R-type U-box protein has a stronger E3 ubiquitin ligase activity. Using α-fold to predict protein interactions, it was found that the SNP site is located at the E2 / E3 interaction interface, and OsPUB77 R The results showed that the OsPUB77 allele R and OsPUB77 I There are differences in the E3 ubiquitin ligase activity between the two, and the activity of the R-type OsPUB77 is stronger.

[0364] Embodiment 7, OsPUB77pro ::OsPUB77 I / R change ospub77 Background transgenic strains

[0365] Build OsPUB77pro:: OsPUB77 I / R The template for the restoration vector was the genomic DNA of Nipponbare NIP leaf tissue. The primers used were added EcoR1 and BamH1 The restriction sites are marked with underline, and the type I SNP sites are introduced by primers and are indicated by underlined letters. The specific primers are:

[0366] 1300- OsPUB77pro ::OsPUB77 R -F:

[0367] tgaccatgattac GAATTC CAGGATTAACGACAT

[0368] 1300- OsPUB77pro ::OsPUB77 R -R:

[0369] gtttgaacgctgcag GTCGACTCACCAGTTATCGATCAAGC

[0370] 1300- OsPUB77pro ::OsPUB77 I -F1:

[0371] tgaccatgattac GAATTC CAGGATTAACGACAT

[0372] 1300- OsPUB77pro ::OsPUB77 I -R1:

[0373] TTGGGCACATT A TGATGCCTTTATC

[0374] 1300- OsPUB77pro ::OsPUB77 I -F2:

[0375] GATAAAGGCATCA T AATGTGCCCAA

[0376] 1300- OsPUB77pro ::OsPUB77 I -R2:

[0377] gtttgaacgctgcag GTCGAC TCACCAGTTATCGATCAAGC,

[0378] The fragment amplification program is:

[0379] Pre-denaturation at 95°C for 5 min;

[0380] 95°C denaturation for 2 min, 61°C annealing for 30 s, 68°C extension for 2 min; 33 cycles;

[0381] The extension was completed at 68°C for 5 min.

[0382] After running on a 1% agarose gel, the fragments were recovered and ligated to pcambia -1300 empty vector, the specific contents of the two homologous recombination systems are described in the following table:

[0383]

[0384] The transformation steps were as described in Example 1-2. The constructed vector was sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing, and the sequencing primer was F: GGATTAACGACA. The transgenic process was as described in Example 1-3. ospub77-1Mutant background, transgenic strains were obtained. qRT-PCR technology was used to screen for transgenic strains with the same expression level. OsPUB77pro:: OsPUB77 I / R Transgenic strains, RNA extraction and reverse transcription are as described in Example 3, and the quantitative primers are:

[0385] RT-1300IR-F: ATGTACATGCGCTTCCATCTCAC

[0386] RT-1300IR-R: ATGATAATCATCGCAAGACCGGC

[0387] Phenotypic observation and verification of BR downstream gene expression were performed on strains with the same expression levels.

[0388] The results obtained in Example 7 are as follows: The transgenic seedlings of the natural variation site SNP (G encoding R530)-(T / encoding I530) showed OsPUB77pro ::OsPUB77 R530 The blade angle is smaller. OsPUB77pro ::OsPUB77 I530 After molecular identification, we identified OsPUB77Pro ::OsPUB77 I530 and OsPUB77Pro ::OsPUB77 R530 There were 3-4 positive transgenic seedlings. After two weeks of greenhouse culture, photos were taken and leaf angles were counted. The results showed that OsPUB77Pro ::OsPUB77 I530 The leaf angle is greater than OsPUB77Pro ::OsPUB77 R530 ;like Figure 6 As described in AE; screen transgenic seedlings with consistent expression levels to detect the expression levels of BR downstream genes, among which the positive regulatory genes OsBU1 exist OsPUB77pro ::OsPUB77 R530 In OsPUB77pro ::OsPUB77 I530 Lower expression level in OiBH1 exist OsPUB77pro ::OsPUB77 R530 Than in OsPUB77pro ::OsPUB77 I530 Higher, such as Figure 6 According to the results, it can be seen that the R-type OsPUB77 has a stronger effect on the regulation of leaf angle and can be applied in actual production to increase density, save land and increase yield.

[0389] Based on the results, the present invention designed the following primer sequencing-assisted selection of excellent leaf angles and plant types of rice.

[0390] Allele- OsPUB77- F: 5'-TGATTTCCTCTGTCCACTGACGAGG-3'

[0391] Allele- OsPUB77- R: 5'-CAGTTATCGATCAAGCGTTTTAACA-3'.

[0392] When the primer pair is used to amplify rice genomic DNA, the band is 196 bp, and the SNP site is determined by sequencing. If it is G, the rice to be tested contains the leaf angle allele OsPUB77. R , the rice leaf angle is more upright; if it is T, the tested rice contains the leaf angle allele OsPUB77 I , the angle of rice leaves is larger.

[0393] In summary: OsPUB77 I / R Natural variation helps to select upright and superior plant types, increase planting density, and hopefully increase yields.

[0394] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Rice leaf angle allele OsPUB77 R The purpose is characterized by: Overexpression in rice OsPUB77 R It can reduce the angle of rice leaves and make the plant more compact; The rice leaf angle allele OsPUB77 R The nucleotide sequence is shown in SEQ ID NO:

1.

2. The rice leaf angle allele according to claim 1 OsPUB77 R The use of At least one of the following: Identification of rice leaf angle gene OsPUB77 R Alleles; Assist in selecting rice leaf angle and plant type.

3. The rice leaf angle allele according to claim 2 OsPUB77 R The purpose is characterized by: When the detection primer pair is used to amplify rice genomic DNA, the band is 195bp. Sequencing and identification determine the SNP site. If it is G, encoding arginine, then the rice to be tested contains the leaf angle allele. OsPUB77 R .

4. The rice leaf angle allele according to claim 3 OsPUB77 R The use of The detection primer pair is: Allele- OsPUB77- F: 5’-TGATTTCCTCTGTCCACTGACGAGG-3’ Allele- OsPUB77- R: 5’-CAGTTATCGATCAAGCGTTTTAACA-3’。 5. The rice leaf angle allele according to claim 4 OsPUB77 R The purpose is characterized by: Overexpression allele OsPUB77 R The construction method of the overexpression vector used is as follows: The cDNA of Nipponbare NIP was used as template for amplification, and the amplified product was Kpn1 and Spe1 The double-enzyme-digested pTCK303 vector is subjected to homologous recombination ligation to obtain the overexpression vector; The primers for constructing the overexpression vector are: OVPUB77- F-Kpn1: 5’-GGATCCCCGGGTACCATGGCGCCGCCGCCGTCGT-3’ OVPUB77 -R-Spe1: 5’-GTAGTCCATACTAGTACTATTTCCCTTCTGTGACA-3’。

Images