Tomato synthesis apomixis related genes SlSPO11-1, SlREC8 and SlOSD1 and application thereof

Abstract

The invention discloses apomixis related genes SlSPO11-1, SlREC8 and SlOSD1 synthesized by tomatoes and application of the apomixis related genes SlSPO11-1, SlREC8 and SlOSD1, DNA (deoxyribonucleic acid) sequences of the SlSPO11-1, SlREC8 and SlOSD1 genes are shown as SEQ ID No.1-SEQ ID No.3, the SlSPO11-1, SlREC8 and SlOSD1 genes of the tomatoes are knocked out by a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (CRISPR associated protein 9) technology, and single mutants Slspo11-1, Slrec8 and Slosd1 and three mutants SlMiMe are obtained. The SlMiMe mutant of which the three genes are knocked out has a phenotype similar to mitosis instead of meiosis, and part of 2n gametes can be generated. The mutation combination of the SlSPO11-1 gene, the SlREC8 gene and the SlOSD1 gene can be applied to the generation of tomato cloned gametes and the breeding of vegetables, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1 and applications thereof. Background Art

[0002] Apomixis is a way of asexual reproduction in plants through seeds. Because it can produce seeds that are completely identical to the maternal genotype, it has broad application prospects in fixing hybrid vigor, improving breeding efficiency and reducing breeding costs. However, due to the complex formation mechanism of apomixis and the slow progress of related gene cloning and functional research, it is very difficult to achieve apomixis in crops.

[0003] Artificial apomixis is an effective means to break through the barriers of apomixis. By converting meiosis into a mitotic process, clonal gametes that have not undergone recombination and reduction can be obtained. In order to obtain clonal gametes, recombination and crossover during meiosis must first be eliminated, so it is crucial to inhibit DNA double-strand breaks. It is reported that SPO11 and topoisomerase VIB subunit homologs are highly conserved in plants such as Arabidopsis, rice, and corn, and mutations in any of these genes are sufficient to disrupt the meiotic recombination process. SPO11-1 has been successfully used in engineered synthetic apomixis. The second step to obtain clonal gametes is to separate sister chromatids in advance. During the first meiotic division, sister chromosomes must be connected together to correctly position and achieve meiosis. In the late meiotic division, the cohesion of sister chromosomes is released to prepare for the second meiotic division. Therefore, the formation and proper maintenance of sister chromatid cohesion are crucial for the correct arrangement and separation of chromosomes during meiosis. REC8 protein is a meiosis-specific cohesin. The loss of REC8 genes in Arabidopsis and rice will lead to premature separation of sister chromatids during the first meiotic division. The third step to obtain cloned gametes is to eliminate the second meiotic division. During the transition from the first meiotic division to the second meiotic division, OSD1 can negatively regulate APC / C to control the meiotic process. Knockout of the OSD1 gene in Arabidopsis and rice can induce the production of 2n pollen grains. Simultaneous editing of SPO11-1, REC8 and OSD1 genes successfully constructed MiMe mutants in both Arabidopsis and rice that replaced meiosis with mitosis.

[0004] Solanaceae plants include many important food, vegetable and cash crops. Tomato (Solanum lycopersicum L.) is the world's third largest vegetable crop and is widely used in scientific research as an important model plant. At present, tomato variety improvement is still mainly based on hybrid breeding, and breeding hybrid seeds requires a lot of manpower and material resources every year. The application of artificial synthetic apomixis in fixing tomato hybrid vigor can save a lot of seed production costs, and has huge production utilization value and broad application prospects. Summary of the invention

[0005] The object of the present invention is to provide tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1 and applications thereof in view of the deficiencies in the prior art.

[0006] The object of the present invention is achieved through the following technical scheme: The present invention provides three tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1, which are cloned from 'Micro Tom' and have:

[0007] 1) the nucleotide sequence shown in SEQ ID No.1 to SEQ ID No.3; or

[0008] 2) The nucleotide sequence shown in SEQ ID No.1 to SEQ ID No.3 is substituted, deleted and / or added with one or more nucleotides; or

[0009] 3) A nucleotide sequence that hybridizes to the DNA sequence defined in 1) under stringent conditions.

[0010] The present invention provides biological materials containing the tomato synthetic apomixis related genes SlSPO11-1, SlREC8 and SlOSD1.

[0011] Furthermore, the biological material is an expression vector, an expression cassette, a host cell or an engineered bacterium.

[0012] The present invention provides the use of the tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1 or their corresponding biological materials in regulating the process of plant meiosis.

[0013] Furthermore, the application is specifically:

[0014] By knocking out SlSPO11-1 in tomatoes, homologous chromosomes do not cross over and recombine during plant meiosis, maintaining consistency with the maternal genetic information; knocking out the SlREC8 gene causes sister chromatids to separate prematurely during the first meiotic division; knocking out the SlOSD1 gene causes some cells to skip the second meiotic division and directly form dyads; when the SlSPO11-1, SlREC8 and SlOSD1 genes are knocked out at the same time, some cells produce a phenotype of mitosis instead of meiosis.

[0015] The present invention provides the use of the tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1 or their corresponding biological materials in preparing transgenic plants.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: the sequences of the tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1 provided by the present invention are shown in SEQ ID No.1-SEQ ID No.3. The SlSPO11-1, SlREC8 and SlOSD1 genes of tomatoes were knocked out by CRISPR / Cas9 technology to obtain single mutants Slspo11-1, Slrec8 and Slosd1 and triple mutant SlMiMe. The results showed that the knockout of SlSPO11-1 would lead to the inability to pair homologous chromosomes in the prophase of meiosis, no bivalent formation in the terminal stage, and unequal separation of chromosomes in the late stages of the first and second meiotic divisions. The knockout of SlREC8 would affect the normal cohesion of chromosomes in the prophase of meiosis, and the sister chromatids would separate prematurely during the first meiotic division. The knockout of SlOSD1 would cause some cells to directly form dyads without undergoing the second meiotic division. The abnormal chromosome behavior of the SlMiMe mutant constructed by knocking out the SlSPO11-1, SlREC8 and SlOSD1 genes at the same time was alleviated in the prophase of meiosis, and some cells did not undergo the second meiotic division and directly formed 2n gametes, showing a phenotype of mitosis replacing meiosis. This shows that the mutation combination of the SlSPO11-1, SlREC8 and SlOSD1 genes can be used to obtain clonal gametes, and the mutant has good application prospects in the breeding of tomatoes or other Solanaceae vegetables. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a schematic diagram of the CRISPR / Cas9 knockout vector structure of tomato SlSPO11-1, SlREC8 and SlOSD1 genes; Figure 1 (A) is a schematic diagram of the SlSPO11-1 knockout vector structure; Figure 1 (B) is a schematic diagram of the SlREC8 knockout vector structure; Figure 1(C) is a schematic diagram of the SlOSD1 knockout vector structure; Figure 1 (D) is a schematic diagram of the vector structure for simultaneously knocking out the three genes SlSPO11-1, SlREC8 and SlOSD1;

[0018] Figure 2 Schematic diagram of the gene structure of tomato SlSPO11-1, SlREC8 and SlOSD1 and the mutation induced by CRISPR / Cas9 at the target site; Figure 2 (A) is a schematic diagram of the SlSPO11-1 gene structure and the mutation of the representative knockout mutant of Slspo11-1 at the sgRNA target site (the scale bar in the figure is 500 bp); Figure 2 (B) is a schematic diagram of the SlREC8 gene structure and the mutation of a representative knockout mutant of Slrec8 at the sgRNA target site (the scale bar in the figure is 500 bp); Figure 2 (C) is a schematic diagram of the SlOSD1 gene structure and the mutation of representative Slosd1 knockout mutants at the sgRNA target site (the scale bar in the figure is 300 bp);

[0019] Figure 3 The amino acid sequence alignment diagram of representative mutant strains of Slspo11-1, Slrec8 and Slosd1; Figure 3 (A) is a comparison of the amino acid sequences of SlSPO11-1 in the wild-type plant and the Slspo11-1-#43 mutant; Figure 3 (B) is a comparison of the amino acid sequences of SlREC8 in the wild-type plant and the Slrec8-#21 mutant; Figure 3 (C) is a comparison of the amino acid sequences of SlOSD1 in wild-type plants and Slosd1-#11 and Slosd1-#2 mutants;

[0020] Figure 4 Schematic diagram of the mutations of different strains of the SlMiMe mutant at the SlOSD1, SlREC8 and SlSPO11-1 genes;

[0021] Figure 5 The results of the phenotype and pollen viability test of Slspo11-1, Slrec8, Slosd1 and SlMiMe tomato mutants are shown in Figure 2. Figure 5 (A) shows the phenotypic observation results of Slspo11-1, Slrec8, Slosd1 and SlMiMe mutant plants (the scale bar in the figure is 5 cm); Figure 5 (B) in the figure shows the results of pollen vitality detection and scanning electron microscopy observation (in the figure, the scale bar in the first row is 100 μm, the scale bar in the second row is 20 μm, the scale bar in the third row is 10 μm, and the scale bar in the fourth row is 3 μm); Figure 5 (C) is a statistical chart of the Alexander staining results of mature pollen grains;

[0022] Figure 6 The results of pollen viability test of Slosd1 mutants with different knockout types are shown in the figure; Figure 6 (A) is a picture of pollen viability of Slosd1 mutants with different knockout types detected by Alexander staining (the scale bar in the figure is 100 μm); Figure 6 (B) is a statistical chart of the Alexander staining results of mature pollen grains;

[0023] Figure 7 The phenotypic observation and ploidy detection results of Slosd1 and SlMiMe mutants with different knockout types; Figure 7 (A) shows the phenotype observation of wild-type and different knockout types of Slosd1 representative mutants (the scale bar in the figure is 5 cm); Figure 7 (B) shows the ploidy results of wild-type and different knockout types of Slosd1 representative mutants detected by flow cytometry; Figure 7 (C) is the phenotypic observation diagram of wild type and different knockout types of SlMiMe mutants (the scale bar in the figure is 5 cm); Figure 7 (D) in the figure is the result of flow cytometry detection of ploidy of wild type and different knockout types of SlMiMe mutants;

[0024] Figure 8 The results of the detection of 2n pollen grains in Slosd1 and SlMiMe diploid mutants; Figure 8 (A) is a scanning electron microscopic image of larger pollen grains produced by Slosd1 and SlMiMe diploid mutants (the scale bar in the figure is 10 μm); Figure 8 (B) in the figure shows the statistical results of viable pollen diameters of Slosd1 and SlMiMe diploid mutants; Figure 8 (C) is the result of flow cytometry detection of the ploidy of mature pollen grains of Slosd1 and SlMiMe diploid mutants;

[0025] Fig. 9 For Slosd1-#2T 1 The mutation sites, phenotypes and ploidy test results of the first generation plants; Fig. 9 (A) is a schematic diagram of the mutations of Slosd1-#2-2 and Slosd1-#2-8 at two sgRNA target sites; Fig. 9 (B) shows wild-type plants and representative Slosd1 mutant plants. 1 Representative type (the scale in the figure is 5cm); Fig. 9 (C) is the result of flow cytometry analysis of the ploidy of Slosd1 mutants;

[0026] Fig.10 The results of observation of meiosis in tomato wild-type, Slspo11-1, Slrec8, Slosd1 and SlMiMe mutant plants (the scale bar in the figure is 10 μm); Fig.10 (A) shows the observation results of chromosome behavior during meiosis in wild-type plants; Fig.10 (B) shows the results of chromosome behavior observation during meiosis of Slspo11-1 mutant plants; Fig.10 (C) in the figure shows the results of observation of chromosome behavior during meiosis in Slrec8 mutant plants; Fig.10 (D) in the figure shows the observation results of chromosome behavior during meiosis of Slosd1 mutant plants; Fig.10 (E) shows the observation results of chromosome behavior during meiosis of SlMiMe mutant plants. DETAILED DESCRIPTION

[0027] Exemplary embodiments will be described in detail herein, examples of which are shown in the accompanying drawings. When the following description refers to the drawings, unless otherwise indicated, the same numbers in different drawings represent the same or similar elements. The embodiments described in the following exemplary embodiments do not represent all embodiments consistent with the present application. Instead, they are merely examples of devices and methods consistent with some aspects of the present application as detailed in the attached claims. It should be understood that the above general description and the detailed description that follows are merely exemplary and explanatory and cannot limit the present application.

[0028] The terms used in this application are for the purpose of describing specific embodiments only and are not intended to limit this application. The singular forms of "a", "said" and "the" used in this application and the appended claims are also intended to include plural forms unless the context clearly indicates other meanings. It should also be understood that the term "and / or" used herein refers to and includes any or all possible combinations of one or more associated listed items.

[0029] It should be understood that, although the term first, second, third, etc. may be used in the present application to describe various information, these information should not be limited to these terms. These terms are only used to distinguish the same type of information from each other. For example, without departing from the scope of the present application, the first information may also be referred to as the second information, and similarly, the second information may also be referred to as the first information. Depending on the context, the word "if" as used herein may be interpreted as "at the time of..." or "when..." or "in response to determination". Moreover, the term "include", "comprise" or any other variant thereof is intended to cover non-exclusive inclusion, so that the process and method including a series of elements include not only those elements, but also include other elements not clearly listed, or also include elements inherent to such process and method. In the absence of more restrictions, the elements limited by the statement "including one..." do not exclude the existence of other identical elements in the process, method, article or equipment including the elements.

[0030] The present invention is described in detail below in conjunction with the accompanying drawings. In the absence of conflict, the features of the following embodiments and implementations can be combined with each other.

[0031] The embodiment of the present invention provides three tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1, which are cloned from 'Micro Tom' and have nucleotide sequences shown in SEQ ID No. 1 to SEQ ID No. 3.

[0032] The embodiments of the present invention also provide applications of the above-mentioned tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1 in regulating plant meiosis, which are described in detail below.

[0033] Example 1: Construction of S1SPO11-1, S1REC8 and S1OSD1 knockout vectors

[0034] 1. Double restriction digestion of pCAMBIA1301-Cas9 vector

[0035] Double digestion with XbaⅠ and SalⅠ was performed, and large fragment bands were separated by electrophoresis and recovered by gel tapping.

[0036] 2. sgRNA target design and insert fragment preparation

[0037] The sgRNA sequences of SlSPO11-1, SlREC8 and SlOSD1 genes were designed using the CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) website. The sgRNA sequences with high screening scores and fewer potential off-target sites were used for the construction of CRISPR / Cas9 vectors, and two sgRNA target sites were designed for each gene. Using the pMD18T-2×U6-scaffold plasmid as a template, primers containing sgRNA sequences and homology arms at both ends were designed to amplify the fragment containing sgRNA1-sgRNA scaffold-U6-sgRNA2. The primer sequence information is shown in Table 1. The PCR products were separated by 1% agarose gel electrophoresis, and the lengths were consistent, so they were cut and recovered.

[0038] Table 1: Primers used for CRISPR / Cas9 knockout vector construction

[0039]

[0040]

[0041] 3. Homologous recombination ligation

[0042] Single gene knockout vector construction process: The fragment containing sgRNA1-sgRNA scaffold-U6-sgRNA2 is connected to the linearized pCAMBIA1301-Cas9 vector through homologous recombination. Escherichia coli DH5α is transformed and a single colony is picked for sequencing. The plasmid of the vector with correct sequencing is extracted for use.

[0043] The process of constructing a vector for knocking out three genes at the same time: The fragment containing SlOSD1-sgRNA-sgRNA scaffold-U6-MCS is connected to the pCAMBIA1301-Cas9 vector linearized by double restriction digestion with Xba I and Sal I through homologous recombination to construct the intermediate vector pCAMBIA1301-SlSPO11-1-MCS-Cas9, and Escherichia coli DH5α is transformed and a single colony is picked for sequencing. After the sequencing is correct, the plasmid is extracted and the plasmid is cut again with two restriction endonucleases, Xba I and Sal I. The fragment containing SlREC8-sgRNA-sgRNA scaffold-U6-SlSPO11-1-sgRNA is connected to the linearized intermediate vector through homologous recombination. Escherichia coli DH5α is transformed and a single colony is picked for sequencing. The vector with correct sequencing is extracted and used for standby. The schematic diagram of the vector structure is shown in the figure below. Figure 1 The SlSPO11-1 knockout vector structure is shown in Figure 1 As shown in (A), the SlREC8 knockout vector structure is as follows Figure 1 As shown in (B), the S1OSD1 knockout vector structure is as follows Figure 1 As shown in (C), the vector structure for simultaneously knocking out the three genes SlSPO11-1, SlREC8 and SlOSD1 is as follows Figure 1 As shown in (D) in .

[0044] The linearized vector and the PCR-amplified and purified fragments were homologously recombined and connected using the single-fragment homologous recombination kit C112 of Novozymes. The system was: 4 μl 5xCEⅡBuffer, 2 μl ExnaseⅡ, 200 ng of the linearized vector recovered by double enzyme digestion, 20 ng of the amplified fragment, ddH 2 Make up to 20 μl with 5% CO and react at 37°C for 30 min.

[0045] Example 2: Construction and screening of CRISPR / Cas9 gene-edited tomato mutants

[0046] 1. Construction of tomato gene-edited mutants

[0047] The plasmid verified by sequencing was transformed into Agrobacterium GV3101, and transgenic plants were obtained by leaf disc method. The specific steps are as follows: tomato seeds were cultured in sowing medium, and when the cotyledons were fully expanded but the true leaves had not grown, the middle part of the cotyledons was cut off and cultured on pre-culture medium for 24 hours; the Agrobacterium culture containing the target bacterial solution was cultured to OD 600 =0.5, resuspend in liquid MS medium to prepare infection solution; after explant infection, culture in dark conditions for 48h; after co-culture, transfer explants to differentiation medium and subculture medium in sequence until single plants grow out, then transfer to elongation medium, and when plants grow to more than 2cm, transfer to rooting medium for rooting; after hardening the obtained tissue culture seedlings, transfer to peat soil for culture.

[0048] 2. Screening of gene-edited plants

[0049] Extract DNA from tomato plants. The specific steps are as follows: take 0.2g of plant leaves into a centrifuge tube, add 200μL of DNA extraction solution, grind the sample until there are no large flakes left; centrifuge at 13000rpm at room temperature (i.e. 20℃~26℃) for 8min; draw 100μL of supernatant into a new centrifuge tube, add an equal volume of isopropanol, mix upside down, and let stand at room temperature for 5min; centrifuge at 13000rpm at room temperature for 6min; discard the supernatant, rinse with 75% ethanol, centrifuge at 13000rpm at room temperature for 3min, and repeat the rinse once; use a gun to absorb the residual ethanol, dry in a fume hood for 10min, add 60μL ddH 2 Dissolve in 0 and store at -20℃ until use.

[0050] Primers were designed about 300 bp upstream and downstream of the sgRNA target site, where the primer sequence information is shown in Table 2. The sequence near the target site was amplified and connected to the T vector using the Yisheng Universal TOPO Cloning Kit. The competent Escherichia coli DH5α was then transformed, and a single colony was picked for sequencing.

[0051] Table 2: Primers used for CRISPR / Cas9 knockout site detection

[0052] Primer name Primer sequence (5'-3') SlSPO11-1-F ATTAACCTTCATGCCCAACACG(SEQ ID No.14) SlSPO11-1-R ACATATGCGTCTTGCCGATT(SEQ ID No.15) SlREC8-F1 AGCATGTGCATCTCTCTCTGG(SEQ ID No.16) SlREC8-R1 TTGCCGAAAAATCATGGAGA(SEQ ID No.17) SlREC8-F2 ACGATAGCACAAAAATTCCATTCAC(SEQ ID No.18) SlREC8-R2 TCTGAACAGAAACAGATCCAATTTT(SEQ ID No.19) SlOSD1-F AGATCAATGGGCAGAGGTGG(SEQ ID No.20) SlOSD1-R TACTCTTGTAGTTCGTTGGACC(SEQ ID No.21)

[0053] The results showed that the Slspo11-1-#32 plant had a 1bp base insertion at the sgRNA1 and sgRNA2 target sites, respectively. The Slspo11-1-#43 plant had a 5bp base deletion and a 1bp base insertion near the sgRNA1 target site, and a 1bp base insertion and an 11bp base deletion near the sgRNA2 target site. Figure 2 As shown in (A) in the figure. The Slrec8-#21 mutant plant produced a 1bp base insertion and a large fragment knockout of up to 190bp at the sgRNA1 site, and a 1bp base deletion at the sgRNA2 site. The Slrec8-#30 plant is a biallelic mutant, with no gene editing at the sgRNA1 site, and 4bp and 1bp base deletions near the sgRNA2 site, respectively, as shown in Figure 2 As shown in (B) in the figure. One DNA strand of the Slosd1-#3 plant produced a 5bp deletion near the sgRNA1 site, and a 29bp base deletion near the sgRNA2 site; there was a 66bp base deletion on the other DNA strand. The Slosd1-#11 plant produced 3bp and 1bp base deletions near the sgRNA1 site, and 3bp and 64bp base deletions at the sgRNA2 site. In addition, a homozygous strain Slosd1-#2 with a 72bp large fragment knockout between the two sgRNA sites was obtained, as shown in Figure 2. Figure 2 As shown in (C). Figure 2 In the figure, the yellow box represents the UTR region, the green box represents the exon, the black line represents the intron, and the red box represents the sgRNA position; the blue letters indicate the sgRNA sequence, the underline indicates the PAM sequence, "-" represents the base deletion, and the red letters represent the base insertion or substitution.

[0054] By comparing the amino acid sequences of representative strains of Slspo11-1, Slrec8, and Slosd1, Figure 3The results shown in the figure show that both alleles of Slspo11-1-#43 have frameshift mutations, resulting in premature stop codons and only 21 to 25 amino acids can be translated, which is a loss-of-function mutant. Figure 3 As shown in (A). Slrec8-#21 is a biallelic mutant, and both alleles show premature translation termination, which is also a loss-of-function mutant. Figure 3 As shown in (B) in the figure. One allele of the Slosd1-#11 mutant showed premature translation termination, and the other allele only lacked 2 amino acids. The Slosd1-#2 mutant was a homozygous mutant, which lacked 24 amino acids compared with the SlOSD1 protein of the wild-type plant, and did not produce a frameshift mutation. Therefore, Slosd1-#11 and Slosd1-#2 may be weak allelic mutants, such as Figure 3 As shown in (C) in .

[0055] The sequencing results showed that 5 SlMiMe mutants were successfully obtained. The SlMiMe-#2 mutant produced 2bp and 3bp base deletions at the SlOSD1 gene, a single base T and a single base A insertion at the SlREC8 gene, and 95bp and 7bp base deletions at the SlSPO11-1 gene. The SlMiMe-#3 mutant produced a 3bp base deletion and a 1bp single base substitution at the SlOSD1 gene, two single base substitutions at the SlREC8 gene, and 95bp and 7bp base deletions at SlSPO11-1. The sequencing results of the SlMiMe-#12 mutant plants showed that the SlOSD1 gene produced 84bp and 3bp base deletions, respectively, the SlREC8 gene produced a 2bp base deletion and a 1bp base insertion, and the SlSPO11-1 gene produced 8bp and 9bp base deletions. The triple knockout mutant SlMiMe-#21 had 3bp and 1bp deletions in the SlOSD1 gene, a large 87bp deletion and a single C insertion in the SlREC8 gene, and a single A and T insertion in the SlSPO11-1 gene. In addition, the SlMiMe-#20 mutant was a mosaic, with multiple types of mutations detected in the SlOSD1 gene, two different base substitutions in the SlREC8 gene, and a 1bp insertion and a 2bp deletion in the SlSPO11-1 gene. Figure 4 As shown, the blue letters indicate the sgRNA sequence, the underline indicates the PAM sequence, "-" indicates base deletion, and the red letters indicate base insertion or substitution.

[0056] Example 3: Pollen viability and ploidy detection of Slspo11-1, Slrec8, Slosd1 and SlMiMe mutants

[0057] 1. Detect pollen vitality by Alexander staining: Collect freshly bloomed tomato flowers, use tweezers to shake the pollen attached to the anthers onto a glass slide with Alexander stain solution, cover with a coverslip, place in dark for 10 minutes, and observe under a microscope.

[0058] 2. Observe pollen morphology with a scanning electron microscope: Paste black double-sided tape on the stage, gently apply freshly opened pollen on the double-sided tape, and blow away the pollen floating on the surface with an ear-cleaning bulb. Put the stage into an ion sputtering instrument for vacuum drying and gold spraying. After the treatment is completed, put it into a scanning electron microscope and observe the pollen morphology after vacuuming.

[0059] 3. Pollen diameter measurement: Use Image J software to measure the diameter of active pollen in the Alexander staining image taken by the microscope. Use the "threshold" function to process the image and measure the pollen diameter through the "AnalyzeParticles" function. Set "Size" to 290-1000μm 2 , in order to exclude impurities and shrunken pollen grains in the image. More than 2500 pollen grains were measured in each group. GraphPad Prism 9 was used to analyze the data.

[0060] 4. Flow cytometry to detect plant and pollen ploidy

[0061] 4.1. Plant ploidy detection:

[0062] Galbraith's Buffer solution configuration: 45 mM MgCl 2 , 30 mM sodium citrate, 20 mM MOPS, 0.1% (w / v) Triton X-100, and finally adjust the pH value of the solution to 7.0, and the preparation of Galbraith's Buffer solution is completed.

[0063] Sample preparation: Take fresh plant leaves in a petri dish, add 1mL Galbraith's Buffer, and chop the leaves with a sharp blade on ice. Filter the cut samples through a 350-mesh nylon sieve and transfer them to a 1.5mL centrifuge tube. Centrifuge at 5000rpm for 2min at room temperature, discard the supernatant, add 200μL PI staining solution, and resuspend the precipitate. Let it stand on ice for staining for 30min.

[0064] The samples were transferred into flow tubes, and the bottom of the tubes was flicked to avoid precipitation before testing. The plant ploidy was analyzed using Agilent NovoCyte3000RYB flow cytometer.

[0065] 4.2. Pollen ploidy detection:

[0066] Take the open stamens and put them into 1mL LB01 buffer and vortex for 15s to collect pollen. Use a 40μm cell strainer to filter out impurities, and then filter the resulting liquid through a 10μm cell strainer. Use a relatively thick plastic stick to rub on the filter to break the pollen wall and release the nucleus, and add 500μL LB01 buffer to elute the resulting nucleus. Add PI staining solution to a final concentration of 50μmol / L and let it stand on ice for 45min. Transfer the sample to a flow tube, flick the bottom of the tube before testing to avoid precipitation, and use Agilent NovoCyte 3000RYB flow cytometer to analyze plant ploidy.

[0067] Use DAPI staining to observe chromosome behavior: Take flower buds in the meiotic period and fix them in Carnoy's fixative for 24 hours, changing the fixative continuously until the flower buds are decolorized; take out the flower buds and rinse them three times with sterile water. -1 Incubate at 37℃ for 15min in citric acid buffer (pH=4.5, diluted 1-fold when used), aspirate the enzyme solution and rinse with sterile water 3 times. Remove the calyx and petals under the dissecting microscope, leaving only the anther. Add a drop of sterile water to keep the anther moist, pierce the anther with a dissecting needle, and squeeze out the pollen. Heat the slide at 45℃ until there is only a layer of water film, add 20μl 60% glacial acetic acid, pipette several times and let it stand at room temperature for 1min. Add 20μl of pre-cooled Carnoy's fixative in the center of the glacial acetic acid, and the fragments will spread out in a wavy shape. After the slide is heated and dried at 45℃, add 20μl DAPI staining solution to the sample, incubate in the dark for 10min, and then observe under a microscope.

[0068] The results showed that knockout of the SlSPO11-1 and SlREC8 genes had no effect on the vegetative growth of the plants, but significantly impaired pollen viability and thus affected fertility. Figure 5 From the Alexander staining results shown in (C), it can be seen that the normal pollen ratio of the Slspo11-1 mutant is only 4.47%. Scanning electron microscopy observations revealed that the pollen grains were almost all wrinkled, and the surface patterns were denser than those of wild-type plants. The Slrec8 mutant also showed a similar phenotype, with a pollen abortion rate of 100%, no plump pollen grains were observed, and all pollen appeared wrinkled and deformed. Both the Slspo11-1 and Slrec8 mutants were unable to bear fruit normally, and no seeds were harvested. Figure 6As shown in (B), the values ​​represent the mean ± SD (including three biological replicates), at least 500 pollen grains were counted for each biological replicate, and asterisks indicate significant differences between samples after one-way ANOVA and Dunnett's multiple comparison test (*p<0.05, ****p<0.0001).

[0069] The Slosd1 mutant plants showed different phenotypes. In this example, only 6 Slosd1 mutants were obtained, of which 2 Slosd1 mutants had no difference in vegetative growth from the wild type and could flower and bear fruit normally. The remaining 4 plants grew slowly, their leaves became thicker and dark green, and their buds could not develop or developed slowly. Pollen vitality was counted and it was found that Slosd1-#11, whose vegetative growth was not affected, had obvious pollen abortion, with the proportion of normal pollen being only 40.38%. Scanning electron microscopy results showed that the morphology of these plump pollen grains was similar to that of wild-type plants, such as Figure 5 As shown in (B), the first row of scale bars is 100μm, the second row of scale bars is 20μm, the third row of scale bars is 10μm, and the fourth row of scale bars is 3μm. The pollen vitality of Slosd1-#2 was less affected, and the proportion of normal pollen was 92.63%. For the Slosd1-#3 mutant with obvious abnormal vegetative growth, a large number of shrunken and inactive pollen grains appeared, and the proportion of normal pollen was only 12.18%. Figure 6 As shown in (A) in .

[0070] Through sequencing and comparison, this example successfully obtained 5 triple mutants SlMiMe with SlSPO11-1, SlREC8 and SlOSD1 genes knocked out at the same time. Among them, 4 strains grew slightly slowly, and the leaf size, color and thickness were similar to those of wild-type plants. In terms of reproductive growth, pollen vitality was significantly reduced, and the normal pollen ratio was 30.66%. The remaining one strain showed the characteristics of a typical tetraploid plant: vigorous growth, thickened stems, significantly enlarged leaves, darker colors, larger buds and open flowers, such as Figure 5 As shown in (A), the Slosd1 and SlMiMe mutants are diploid, and the scale bar in the figure is 5 cm.

[0071] Flow cytometry was used to detect T 0 The ploidy of the Slosd1 and SlMiMe mutant plants was investigated. The results showed that the two Slosd1 mutants with relatively normal vegetative growth were diploid, while the other four were tetraploid. Figure 7 (A) and Figure 7As shown in (B), the Slosd1-#11 mutant is diploid, and the Slosd1-#3 and Slosd1-#7 mutants are tetraploid; 4 of the 5 SlMiMe mutants are diploid, and one plant with a significantly different phenotype is tetraploid. Since synthetic apomixis requires that the offspring phenotype be consistent with that of the parents, subsequent studies will use diploid mutants as materials for research, such as Figure 7 (C) and Figure 7 As shown in (D), the SlMiMe-#21 and SlMiMe-#12 mutants are diploid, and the SlMiMe-#20 mutant is tetraploid.

[0072] Scanning electron microscopy results showed that Slosd1 and SlMiMe mutants were able to produce larger pollen grains, such as Figure 8 As shown in (A). To further confirm whether the two mutants can produce 2n pollen grains, the diameter of viable pollen in the Alexander staining images of pollen was measured using Image J software. More than 2500 pollen grains were measured in each group. The results showed that both Slosd1 and SlMiMe diploid lines produced larger pollen grains. Among the viable pollens of Slosd1-#11 and Slosd1-#2 plants, 6.29% (n=2576) and 2.63% (n=2619) were larger pollen grains (≥28.15 μm), respectively, while among the viable pollens of SlMiMe-#21 and SlMiMe-#3 mutants, 59.76% (n=2547) and 69.36% (n=2523) were large pollen grains, respectively. Figure 8 As shown in (B), the asterisks indicate significant differences between samples after one-way ANOVA and Dunnett's multiple comparison test (****p<0.0001).

[0073] The pollen ploidy of diploid Slosd1 and SlMiMe mutants was detected by flow cytometry. The results showed that the mature pollen grains of wild-type plants contained two peaks, 1C and 2C, corresponding to vegetative cells and reproductive cells, respectively. Slosd1 also showed two peaks, 1C and 2C, and no 4C peak was detected, which may be due to the small number of 2n pollen and the failure of the instrument to successfully detect it. The mature pollen grains of the SlMiMe mutant contained two peaks, 2C and 4C, corresponding to the doubled vegetative cells and reproductive cells, respectively. Figure 8 As shown in (C) in .

[0074] In addition, the Slosd1-#2 mutant T 1 The knockout type, phenotype and ploidy of the first generation plants were tested, and the results were as follows: Fig. 9 As shown, the mutations of Slosd1-#2-2 and Slosd1-#2-8 at the two sgRNA target sites are shown in Fig. 9 (A) shows wild-type plants and representative Slosd1 mutant plants T 1 Representative types such as Fig. 9 The results showed that 12 strains of T 1 The generation of Slosd1 mutants all showed homozygous mutants with a large deletion of 72 bp. Phenotypic observations showed that the vegetative growth of most plants was not much different from that of the wild type, but one of them, Slosd1-#2-8, grew slowly and was relatively short. Flow cytometry results showed that Slosd1-#2-8 was tetraploid, while the other 11 plants were diploid. This result also indirectly confirmed that the Slosd1 mutant can produce 2n gametes, such as Fig. 9 As shown in (C) in .

[0075] Example 4: Observation of chromosome behavior during meiosis in Slspo11-1, Slrec8, Slosd1 and SlMiMe mutants

[0076] DAPI staining method to observe chromosome behavior: Take flower buds in meiosis period and fix them in Carnoy's fixative for 24 hours, and keep changing the fixative until the flower buds are decolorized; take out the flower buds and rinse them three times with sterile water. -1 Incubate at 37℃ for 15min in citric acid buffer (pH=4.5, diluted 1-fold when used), aspirate the enzyme solution and rinse with sterile water 3 times. Remove the calyx and petals under the dissecting microscope, leaving only the anther. Add a drop of sterile water to keep the anther moist, pierce the anther with a dissecting needle, and squeeze out the pollen. Heat the slide at 45℃ until there is only a layer of water film, add 20μl 60% glacial acetic acid, pipette several times and let it stand at room temperature for 1min. Add 20μl of pre-cooled Carnoy's fixative in the center of the glacial acetic acid, and the fragments will spread out in a wavy shape. After the slide is heated and dried at 45℃, add 20μl DAPI staining solution to the sample, incubate in the dark for 10min, and then observe under a microscope.

[0077] The results showed that the chromosomes of wild-type plants were filamentous and dispersed in the nucleus during the leptotene stage. Homologous chromosomes were close together and paired in the zygotene stage, and the nucleolus was clearly visible. In the pachytene stage, the synaptic homologous chromosomes became shorter and thicker. In the diplotene stage, the chromosomes further condensed and became shorter and thicker, and crossing over could be observed between chromosomes. In the telophase, 12 bivalents were formed and evenly dispersed in the nucleus. In the metaphase of the first meiotic division, the chromosomes were tightly arranged on the equatorial plate. At the end of the first meiotic division, the homologous chromosomes separated evenly to form dyads. After the second meiotic division, four daughter cells of equal size were formed (98.7%, n=76). Fig.10As shown in (A), a1-a8 are leptotene, zygotene, pachytene, diplotene, diakinesis, metaphase I, anaphase I, and tetrad, respectively.

[0078] The chromosomal behavior of the Slspo11-1 biallelic mutant during meiosis was observed, and it was found that the chromosomes exhibited normal cohesion in both the leptotene and zygotene stages, typical pachytene chromosomes were not observed, and no chiasma was formed in the diplotene stage. Very obvious abnormal chromosome behavior was observed during the telophase. Instead of 12 paired bivalents, multiple chromosomes were entangled and clustered together, and there were also some small unpaired chromosomes scattered in the cell nucleus. In the metaphase of the first meiotic division, the chromosomes were concentrated near the equatorial plate. The incorrect separation of these abnormal univalents can be observed from the late stage of the first meiotic division to the late stage of the second meiotic division. The incorrect and unequal separation of chromosomes leads to the formation of irregularly divided tetrads or multimers after the second meiotic division (87.1%, n=474), such as Fig.10 As shown in (B), b1-b8 are leptotene, zygotene, pachytene, diplotene, diakinesis, anaphase I, anaphase II, and telophase II, respectively.

[0079] The loss of the SlREC8 gene caused chromosome condensation and pairing defects. During the pachytene stage, some chromosomes were entangled together to form large chromosome clumps, and no homologous chromosomes were observed to be paired. The abnormal condensation of chromosomes was more obvious during the diplotene stage, and most chromosomes were still entangled and intertwined, with no obvious crossover structure. 12 bivalents could not be formed during the telophase, and some unpaired univalents or chromosome fragments were scattered in the cell nucleus. In the metaphase of the first meiotic division, these univalents and chromosome fragments that failed to pair successfully were arranged on the equatorial plate. In the late stage of the second meiotic division, 20 to 24 chromosomes were observed at the two poles of the cell, indicating that the sister chromatids separated prematurely. At the same time, chromosome breakage was observed, and dot-like fragments were mixed between the separated chromosomes. During the second meiotic division, chromosomes separated unequally, and a large number of chromosome bridges were formed. Finally, after the end of the second meiotic division, irregular tetrad structures or multimers containing micronuclei were formed (82.6%, n=132), such as Fig.10 As shown in (C), c1-c8 are leptotene, zygotene, pachytene, diplotene, diakinesis, metaphase I, anaphase I, and tetrad, respectively.

[0080] The meiotic process of the Slosd1 diploid mutant was observed. No obvious abnormalities were observed in the prophase of meiosis, but some cells did not undergo the second meiotic division and directly formed dyads (8.64%, n=81). Fig.10As shown in (D) in the figure, d1-d8 are leptotene, zygotene, pachytene, diplotene, diakinesis, metaphase I, dyad, and dyad, respectively.

[0081] In the SlMiMe diploid mutant, relatively normal chromosome condensation can be observed in the leptotene stage. The homologous chromosomes in synapsis are abnormal in the pachytene stage, the phenomenon of crossing over in the diplotene stage is reduced, and 24 univalent bodies are formed in the diakinesis stage. In the metaphase of the first meiotic division, the chromosomes are closely arranged on the equatorial plate, and in the telophase of the first meiotic division, it can be observed that the two daughter cells each contain 24 chromosomes, and some cells do not undergo the second meiotic division and directly form dyads (23.61%, n = 144), such as Fig.10 As shown in (E), e1-e8 are leptotene, zygotene, pachytene, diplotene, diakinesis, metaphase I, dyad, and dyad, respectively.

[0082] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A tomato synthetic apomixis-related gene S1SPO11-1, S1REC8 and S1OSD1, characterized in that: The nucleotide sequences of the genes SlSPO11-1, SlREC8 and SlOSD1 are the nucleotide sequences shown in SEQ ID No.1-SEQ ID No.

3.

2. An application of the tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1 described in claim 1 in regulating plant meiosis.

3. Use of the tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1 according to claim 1 in preparing transgenic plants.

4. A biological material containing the tomato synthetic apomixis-related genes SlSPO11-1, SlREC8 and SlOSD1 according to claim 1.

5. The biomaterial according to claim 4, characterized in that The biological material is an expression vector, an expression cassette, a host cell or an engineered bacterium.

6. Use of the biological material according to claim 4 in regulating plant meiosis.

7. Use of the biological material according to claim 4 in preparing transgenic plants.

Images