A binary expression vector for fixing soybean heterosis and a construction method and application thereof
By constructing a binary expression vector containing specific sgRNA and ToPAR genes, and utilizing the CRISPR/Cas9 system and the soybean MiMe system, apomixis in soybeans was achieved, solving the problem of difficulty in fixing heterosis in soybeans, improving seed production efficiency and reducing costs.
Patent Information
- Application Number
- CN202410784644.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-18
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2044-06-18
AI Technical Summary
The heterosis of soybeans is difficult to fix, resulting in high cost of hybrid seeds and segregation of traits in F2 offspring, which limits the application of existing apomixis technology in agriculture.
A binary expression vector was constructed, comprising sgRNA targeting Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700, and Glyma.02G299600 and the ToPAR gene. Using the CRISPR/Cas9-mediated soybean MiMe system and the dandelion-induced parthenogenetic gene ToPAR, soybean meiosis was converted into mitosis. The ToPAR gene was then activated by the soybean oocyte promoter to induce gametes to develop into seeds.
This method enables asexual reproduction of soybean hybrid seeds, fixes heterosis, improves seed production efficiency, reduces hybrid seed costs, and ensures that phenotypic segregation does not occur in the F2 offspring.
Smart Images

Figure CN118531056B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of plant breeding and biotechnology, and particularly relates to a binary expression vector for fixing soybean hybrid vigor and a construction method and application thereof. BACKGROUND
[0002] Hybrid vigor refers to that a hybrid generation produced by crossing two genetically different parents has stronger vitality, growth potential, resistance, adaptability and yield than the parents, and is an effective way to greatly improve crop yield, and has been widely applied in crops such as rice and corn to cultivate hybrid F1 showing many excellent yield potential and stability. However, the F2 generation seeds are prone to character separation, and new hybrid F1 generation seeds need to be reproduced every year through a tedious procedure. Soybean is a self-pollinating crop, and the natural cross-pollination rate is low due to small flower organs, and the production of F1 hybrid seeds depends on male sterile lines, resulting in high cost of hybrid seeds. Therefore, how to realize self-retention of hybrid seeds has been considered as the highest goal of hybrid breeding.
[0003] Apomixis is a replacement scheme for male sterile lines, and the seeds are used for asexual reproduction, and the hybrid genotype of the hybrid variety is not changed with the alternation of generations, so that the hybrid offspring does not separate in character. Apomixis can be used for hybrid vigor. Apomixis has been proved to be feasible in self-pollinating rice, and three genes OsPAIR1, OsREC8 and OsOSD1 involved in the meiosis stage of rice are simultaneously mutated, and OsBBM is ectopically expressed in the egg cell, so that these rice lines can develop into embryos directly from the egg cell without meiosis, and then complete the apomixis process, but the ratio of apomictic seeds is too low to limit the application of the technology in agriculture. Although apomixis widely exists in nature, there is no natural apomixis phenomenon in major crops. Therefore, it is necessary to explore an efficient apomixis approach for soybean. SUMMARY
[0004] Therefore, the application aims to provide a binary expression vector for fixing soybean hybrid vigor and a construction method and application thereof, which makes the hybrid soybean offspring not separate to fix the hybrid vigor of soybean, realizes one-line seed production of soybean, improves the matching efficiency, and eliminates the risk of seed production.
[0005] To solve the above technical problems, the application provides the following technical solutions.
[0006] The application provides a binary expression vector for fixing soybean hybrid advantage, which comprises sgRNA targeting Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700 and Glyma.02G299600 and a ToPAR gene.
[0007] Preferably, the binary expression vector further comprises a soybean pGmEC1.1 promoter.
[0008] Preferably, the nucleotide sequences of the sgRNA of Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700 and Glyma.02G299600 are shown in SEQ ID NO:1-5 in sequence; and the CDS sequence of the ToPAR gene is shown in SEQ ID NO:6.
[0009] Preferably, the promoter sequence of the soybean pGmEC1.1 gene is shown in SEQ ID NO:7.
[0010] Preferably, the nucleotide sequence of the binary expression vector is shown in SEQ ID NO:8.
[0011] The application further provides a construction method of the binary expression vector, comprising the following steps: assembling an sgRNA expression cassette into a pYLCas9-35S-N vector, linearizing the intermediate vector by PmeI enzyme digestion, connecting a pGmEC1.1 promoter and a ToPAR gene into the linearized intermediate vector, and constructing a binary expression vector pYLCas9-P35S-5KO-pGmEC1.1-ToPAR-N.
[0012] The application further provides application of the binary expression vector or the binary expression vector obtained by the preparation method in fixing soybean hybrid advantage.
[0013] The application further provides a method for fixing soybean hybrid advantage by using the binary expression vector, comprising the following steps: obtaining hybrid seeds by soybean hybrid breeding, transforming the binary expression vector into the hybrid seeds to obtain T0 generation plants, and self-crossing to obtain self-crossing seeds.
[0014] Preferably, the binary expression vector is transformed into the hybrid soybean F1 by using an agrobacterium-mediated soybean cotyledon node transformation method.
[0015] Preferably, the T0 generation plants in which the five genes Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700 and Glyma.02G299600 are all double allelic mutations and the ToPAR gene is successfully ectopically expressed are self-crossed.
[0016] Compared with the prior art, the application has the following beneficial effects:
[0017] (1) The application edits the five key genes involved in the meiosis of soybeans simultaneously, changes the meiosis of the reproductive cells into mitosis, and then obtains gametes with the same genotype and chromosome ploidy type as the hybrid soybeans; and then uses the pGmEC1.1 promoter of the soybean egg cell to start the ToPAR gene to induce the gametes to develop into seeds or plants, and successfully induces apomixis in the dicotyledonous crop soybean.
[0018] (2) The application constructs the CRISPR / Cas9-mediated soybean MiMe system and the dandelion-induced parthenogenesis gene ToPAR on the same T-DNA at one time, and only needs one genetic transformation to fix the heterosis of soybeans, and greatly improves the hybrid seed production efficiency. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 Vector diagram of pYLCas9-P35S-5KO-pGmEC1.1-ToPAR-N.
[0020] Figure 2 Obtaining process diagram of hybrid F1 of ms1 sterile line x Yudou 11. In the diagram, A is a diagram of drilling method for extracting DNA from soybean seeds for identification, and the drilling beans are not affected in germination; B is a diagram of using molecular markers to identify the fertility of soybean seed DNA, the low band is sterile, the high band is fertile, and the double band is heterozygous; C is a diagram of using molecular markers to identify the flower color of soybean seed DNA, the high band is white flower, and the low band is purple flower; D is a diagram of building a net room for pollination of the sterile line by bees; E is a diagram of the white flower sterile line identified in the field; and F is a diagram of hybrid pods harvested from the sterile plants after pollination by bees in the net room.
[0021] Figure 3 Electrophoresis diagram of ToPAR gene in transgenic soybean F1 of ms1 sterile line x Yudou 11 hybrid.
[0022] Figure 4 Phenotype diagram of T1 diploid plants after fixation of F1 hybrid of ms1 sterile line x Yudou 11.
[0023] Figure 5 Result diagram of flow cytometry detection of T1 diploid and tetraploid. DETAILED DESCRIPTION
[0024] The application provides a binary expression vector for fixing soybean heterosis, which comprises sgRNAs targeting Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700 and Glyma.02G299600 and a ToPAR gene.
[0025] In the application, the nucleotide sequences of the sgRNAs targeting Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700 and Glyma.02G299600 are shown in SEQ ID NO:1-5 in sequence; the CDS sequence of the ToPAR gene is shown in SEQ ID NO:6; the promoter sequence of the soybean pGmEC1.1 gene is shown in SEQ ID NO:7; and the nucleotide sequence of the binary expression vector is shown in SEQ ID NO:8.
[0026] In the application, the site for knocking out Glyma.03G141800 gene is selected from the 21-23th nucleotide sequence shown in SEQ ID NO:1; the site for knocking out Glyma.19G144400 gene is selected from the 21-23th nucleotide sequence shown in SEQ ID NO:2; the site for knocking out Glyma.14G057200 gene is selected from the 21-23th nucleotide sequence shown in SEQ ID NO:3; the site for knocking out Glyma.02G263700 gene is selected from the 21-23th nucleotide sequence shown in SEQ ID NO:4; and the site for knocking out Glyma.02G299600 gene is selected from the 21-23th nucleotide sequence shown in SEQ ID NO:5.
[0027] In the application, the promoter of the ToPAR gene is connected with the ToPAR gene, and the expression of the ToPAR gene is driven by the pGmEC1.1 promoter.
[0028] The application also provides a construction method of the binary expression vector, comprising the following steps: assembling the sgRNA expression cassette into the pYLCas9-35S-N vector, performing PmeI enzyme digestion to linearize the intermediate vector, and connecting the soybean oocyte-specific promoter pGmEC1.1 fragment and the ToPAR gene into the linearized intermediate vector by using the method of homologous recombination to construct the binary expression vector pYLCas9-P35S-5KO-pGmEC1.1-ToPAR-N. The sgRNA expression cassette containing the target gene target sequence is obtained by overlapping PCR. The target gene in the application is Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700 and Glyma.02G299600. The binary expression vector pYL Cas9-P35S-5KO-pGmEC1.1-ToPAR-N has the function of promoting apomixis of soybean.
[0029] The application also provides application of the binary expression vector or the binary expression vector obtained by the preparation method in fixing soybean heterosis. The transgenic hybrid soybean in which the five genes Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700 and Glyma.02G299600 are all double allelic mutations and the ToPAR gene is successfully ectopically expressed is screened by molecular biology means such as PCR amplification and sequencing. The self-crossing is carried out by building an isolation net room, and the self-crossing seeds are harvested. It is found by field observation of the offspring that there is no phenotype separation, and it is found by high-throughput sequencing that the genome is the same as the hybrid used for transformation, so that the purpose of fixing heterosis is achieved.
[0030] The application provides a method for fixing soybean heterosis by using the binary expression vector, comprising the following steps: generating a hybrid F1 by soybean breeding hybridization, transforming the binary expression vector into the hybrid F1 to obtain a T0 generation plant, and self-crossing to obtain a self-crossing seed. The binary expression vector is transformed into the hybrid soybean F1 by using the agrobacterium-mediated soybean cotyledon node transformation method. The five genes Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700 and Glyma.02G299600 of the binary expression vector in the transgenic plant are all double allelic mutations, and the ToPAR gene is successfully ectopically expressed, so that the purpose of fixing heterosis is achieved. In the application, the female soybean ms1 nuclear male sterile line is crossed with the male Yudou 11.
[0031] In the present application, all raw materials, components or culture media are commercially available products well known to those skilled in the art, unless otherwise specified.
[0032] The technical solutions in the present application will be described clearly and completely below in combination with the embodiments in the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.
[0033] Embodiment 1
[0034] 1. Construction of soybean MiMe multi-gene knockout vector
[0035] 1.1 Suitable target points were selected for Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700 and Glyma.02G299600 respectively by using CRISPR-GE website (http: / / skl.scau.edu.cn / targetdesign / ), as shown in Table 1.
[0036] Table 1: Target sequences and target points of 5 genes
[0037]
[0038] 1.2 The target sequence was introduced into the sgRNA expression cassette by overlapping PCR
[0039] Target site forward and reverse primers plus adapters: Glyma.03G141800-FP: TCAACTGCTCGACGTGGTAG gt tttagagctagaaat (SEQ ID NO: 9), Glyma.03G141800-RP: CTACCACGTCGAGCAGTTGAT gaccaatgttgctcc (SEQ ID NO: 10), Glyma.19G144400-FP: TGTCACGGAGTGGTGTCCTA gt tttagagctagaaat (SEQ ID NO: 11), Glyma.19G144400-RP: TAGGACACCACTCCGTGACAT gaccaatgttgctcc (SEQ ID NO: 12), Glyma.14G057200-FP: TAAGAGCCATAGGAATCGA gt tttagagctagaaat (SEQ ID NO: 13), Glyma.14G057200-RP: TCGATTCCTATGGCTCTTAT gaccaatggtgctttg (SEQ ID NO: 14), Glyma.02G263700-FP: AAGAGGCTGTTACTCTGCCA gt tttagagctagaaat (SEQ ID NO: 15), Glyma.02G263700-RP: TGGCAGAGTAACAGCCTCTTC aatcactacttcgtct (SEQ ID NO: 16), Glyma.02G299600-FP: ATGAGCGGTGAGCGTCCGT gt tttagagctagaaat (SEQ ID NO: 17), Glyma.02G299600-RP: ACGGACGCTCACCGCTCATC aatctcttagtcgact (SEQ ID NO: 18).
[0040] Universal primers for first round of overlap PCR: U-F: CTCCGTTTTACCTGTGGAATCG (SEQ ID NO: 19), U-R: CGGAGGAAAATTCCATCCAC (SEQ ID NO: 20).
[0041] First round PCR: 2 ng of pYL-gRNA-AtU# plasmid was taken as template, and the upstream and downstream sequences of the five target genes Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700, Glyma.02G299600 were used for first round PCR amplification. The PCR reaction system was: 2 ng pYL-gRNA-AtU#, 2 μL U-F, 2 μL target-FP, 1 μL target-RP, 1 μL U-R, 25 μL KOD-ONE high-fidelity enzyme mix, and ddH2O was added to 50 μL. The high-fidelity PCR reaction conditions were: 98°C for 3 minutes; 94°C for 10 seconds, 58°C for 15 seconds, 68°C for 15 seconds, for a total of 28 cycles; 68°C for 8 minutes.
[0042] Primers for second round PCR: PT1-FP: TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG (SEQ ID NO: 21), PT1-RP: AGCGTGggtctcGtcagggTCC ATCCACTCCAAGCTC (SEQ ID NO: 22), PT2-FP: TTCAGAggtctcTctgacacT GGAATCGGCAGCAAAGG (SEQ ID NO: 23), PT2-RP: AGCGTGggtctcGtcttcacTCCATCCACTCCAAGCTC (SEQ ID NO: 24), PT3-FP: TTCAGAggtctcTaagacttTGGAATCGGCAGCAAAGG (SEQ ID NO: 25), PT3-RP: AGCGTGggtctcGagtccttTCCATCCACTCCAAGCTC (SEQ ID NO: 26), PT4-FP: TTCAGAggtctcTgactacaTGGAATCGGCAGCAAAGG (SEQ ID NO: 27), PT4-RP: AGCGTGggtctcGgtccacaTCCATCCACTCCAAGCTC (SEQ ID NO: 28), PT5-FP: TTCAGAggtctcTggacttgTGGAATCGGCAGCAAAGG (SEQ ID NO: 29), PT5-RP: AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC (SEQ ID NO: 30).
[0043] Second round PCR: using the first round PCR products of the above 5 gene targets, dilute 10 times, take 1 μL as the template for the second round PCR, use PT1, PT2, PT3, PT4, PT5 upstream and downstream primers for the second round PCR amplification. The PCR reaction system is: 1 μL of diluted PCR product, 3 μL of PT1, 15 μL of KOD-ONE high-fidelity enzyme mix, and ddH2O to 30 μL. High-fidelity PCR reaction conditions: 98℃ for 3 minutes; 94℃ for 10 seconds, 58℃ for 15 seconds, 68℃ for 15 seconds, for 28 cycles; 68℃ for 8 minutes.
[0044] The second round PCR product was purified using the product purification kit FastPure Gel DNA Extraction Mini Kit (Novozyme, DC 301-01) to obtain the sgRNA expression cassette fragment.
[0045] 1.3 Use the method of Golden Gate cloning to assemble the sgRNA expression cassette fragment into the pYLCas9-35S-N vector to construct the intermediate vector pYLCas9-P35S-5KO-N.
[0046] The reaction system involved is: 10x CutSmart Buffer: 1.5 μL; 10 mM ATP: 1.5 μL; pY LCas9-35S-N vector: 80 ng; sgRNA expression cassette mixture: 15 ng for each expression cassette; BsaI-HF high-fidelity endonuclease: 1 μL; T4NDA ligase: 1 μL; ddH2O to 30 μL.
[0047] The reaction system involved is: use variable temperature cycles for enzyme digestion and ligation: first 3 cycles (37℃ incubation for 10 minutes, 10℃ incubation for 5 minutes, 20℃ incubation for 5 minutes); then 10 cycles (37℃ incubation for 3 minutes, 10℃ incubation for 5 minutes, 20℃ incubation for 5 minutes). Finally incubate at 37℃ for 5 minutes.
[0048] 2. Construction of soybean apomixis binary expression vector pYLCas9-P35S-5KO-pGmEC1.1-ToPAR-N
[0049] The pYLCas9-P35S-5KO-N vector is linearized using PmeI enzyme, and the soybean own oocyte promoter pGmEC1.1 promoter fragment and ToPAR gene are connected to the above linearized pYLCas9-P35S-5KO-N vector using the method of homologous recombination, to finally construct the pYLCas9-P35S-5KO-pGmEC1.1-ToPAR-N final vector.
[0050] The specific steps are as follows:
[0051] The designed homologous recombination primers for the promoter sequence of the pGmEC1.1 gene are: pGmEC1.1-FP: cgtttcccgccttcagtttaaacCTATAGGATTAAAAAGATCTCTTTCAAATTATA (SEQ ID NO: 31), pGmEC1.1-RP: gtgttgccattatctgccatTTCTTATAGAATATGCATATGCATATGCA (SEQ ID NO: 32). The promoter fragment of the pGmEC1.1 gene is obtained by PCR amplification using the above designed primers and the genomic DNA template of soybean variety Williams82. The PCR reaction system is: DNA template: 1 μL; upper and lower primers: 2 μL each; KOD-ONE high-fidelity enzyme mix: 25 μL; supplement ddH2O to 50 μl. The high-fidelity PCR reaction conditions are: 98°C for 3 minutes; 94°C for 10 seconds, 60°C for 15 seconds, 68°C for 15 seconds, for a total of 30 cycles; 68°C for 8 minutes.
[0052] The designed homologous recombination primers for the CDS sequence of the ToPAR gene are: ToPAR-FP: ATGGCAGATAATGGCAACACCG (SEQ ID NO: 33), ToPAR-RP: tgtcaaacactgatagtttaaacTCAGGCAGCGTCCTCGTCC (SEQ ID NO: 34). The Taraxacum ToPAR gene DNA fragment is obtained by PCR amplification using the above designed primers and the cDNA of Taraxacum as a template. The PCR reaction system is: DNA template: 1 μl; upper and lower primers: 2 μl each; KOD-ONE high-fidelity enzyme MIX: 25 μl; supplement ddH2O to 50 μl. The high-fidelity PCR reaction conditions are: 98°C for 3 minutes; 94°C for 10 seconds, 60°C for 15 seconds, 68°C for 15 seconds, for a total of 30 cycles; 68°C for 8 minutes.
[0053] The amplified pGmEC1.1 gene promoter fragment (shown as SEQ ID NO: 7) and the ToPAR gene CDS sequence fragment (shown as SEQ ID NO: 6) are connected to the PmeI enzyme linearized pYLCas9-P35S-5KO-N vector by the method of homologous recombination to construct the final vector pYLCas9-P35S-5KO-pGmEC1.1-ToPAR-N (shown as SEQ ID NO: 8), as shown in FIG. 1. Figure 1The reaction system for homologous recombination is shown. The reaction system for homologous recombination is: 50 ng of pGmEC1.1 gene promoter fragment; 50 ng of ToPAR gene CDS sequence fragment; 100 ng of linearized pYLCas9-P35S-5KO vector; 5 μL of full-form gold 2x Basic Assembly Mix; and ddH2O added to 10 μL. The reaction system is 50°C for 30 minutes.
[0054] Example 2
[0055] 1. Obtaining of soybean hybrid F1
[0056] Based on the existing soybean ms1 cytoplasmic male sterility population (GmMs1 encodes a kinesin-like protein essential for male fertility in soybean (Glycine max L.) population) involving population), the white-flowered ms1 sterile line is selected as the female parent, the purple-flowered variety Yudou 11 with high combining ability is selected as the male parent, the 20-mesh screen is selected to build a hybrid screen room, Italian bees are used for pollination, and the fertile pods of sterile plants are harvested at the harvest period, which are hybrid F1. The process is shown in Figure 2 .
[0057] 2. Transformation of soybean by binary expression vector
[0058] The binary expression vector pYLCas9-P35S-5KO-pGmEC1.1-ToPAR-N prepared in Example 1 is transformed into Agrobacterium competent EHA105 by electroporation to obtain a bacterial solution. At the same time, the hybrid soybean seeds F1 produced by the bee screen room are selected, the chlorinated disinfection method (100 ml of sodium hypochlorite (8% effective concentration) is added with 5 ml of concentrated hydrochloric acid) is used for continuous sterilization for 18 h, the sterilized seeds are inoculated on the germination medium with the hypocotyls downward, and dark culture is performed for 1 day. After the germination of the soybean is treated by scratching, the prepared bacterial solution is poured into the prepared bacterial solution to complete the infection, the well-grown and uncontaminated explants after co-culture are selected, the end of the hypocotyl is cut off, and the recovery medium is inserted for recovery culture for 7 days. The explants with multiple shoots after recovery culture are inoculated into the selection medium, 16 h / 8 h light / dark culture, and selection culture is performed for 21 days. The well-grown multiple shoots after selection are transferred to the rooting medium for further selection culture for 21 days. Bar test paper method is used to directly detect the transgenic T0 seedlings, and the double-banded ones are transgenic positive seedlings.
[0059] 3. Sequencing identification of five-gene mutant and T0 generation transgenic plants with ectopic expression of ToPAR gene
[0060] 3.1 The DNA of single transgenic soybean leaves was extracted by CTAB method, the target band was amplified by PCR, and the mutation of the target gene was identified by sequencing. The primers used were as follows: 03G141800-619-FP: CACACACAC TCCCAAACCCT (SEQ ID NO: 35), 03G141800-619-RP: GATCTTCGGCAC TTTGCTGC (SEQ ID NO: 36), 19G144400-572-FP: TTGCAGTTTTCACTTC GGCG (SEQ ID NO: 37), 19G144400-572-RP: TAGCCTCGCACTTCTCCTCT (SEQ ID NO: 38), 14G057200-662-FP: ATGAAGGATGGCTGCGACAA (SEQ ID NO: 39), 14G057200-662-RP: GGATTTGGACTTGGGGAGCA (SEQ ID NO: 40), 02G263700-552-FP: CTGCGTTTTCATCAGGGGGA (SEQ ID NO: 41), 02G263700-552-RP: TCTGCCACATTCGTCTCACC (SEQ ID NO: 42), 02G299600-592-FP: TCCTTGGAGCTTGGGCATTT (SEQ ID NO: 43), 02G299600-592-RP: ATTTCCTGCGAAGCGTGAGA (SEQ ID NO: 44).
[0061] The PCR products obtained by amplification were sent to the company for sequencing, and 03G141800-619-FP, 19G144400-572-FP, 14G057200-662-FP, 02G263700-552-FP and 02G299600-592-FP were used as sequencing primers for sequencing. The results were compared with the wild type sequence. The sequencing peak chart results were double peaks, and the mutation information was obtained by using the degenerate codon strategy analysis (http: / / skl.scau.edu.cn / dsdecode / ). Five mutants were screened from five genes with double allelic mutations.
[0062] 3.2 PCR method was used to identify whether the transgenic soybean contained ToPAR gene. Primer pGmEC1.1-FP: TGGGTGCAGGAAGAATGTCC (SEQ ID NO: 45) and ToPAR-RP: GGA GAATGTTTGGGCGGTGA (SEQ ID NO: 46) were located on the promoter sequence of pGmEC1.1 gene and the CDS sequence of ToPAR gene, respectively, and amplified 645 bp, indicating that the pYLCas9-P35S-5KO-pGmEC1.1-ToPAR-N binary vector had been successfully introduced into the plant, as shown in FIG. 3B. Figure 3
[0063] Example 3 Fixation of Soybean Heterosis
[0064] The five mutants screened Glyma.03G141800, Glyma.19G144400, Glyma.14G057200, Glyma.02G263700, Glyma.02G299600, which were all double allelic mutations, and the transgenic hybrid soybean (T0 generation transgenic plants) with ectopic expression of ToPAR gene were selfed in an isolated net room. The selfed seeds were planted in the field to obtain T1 generation transgenic plants. Whether the fixation of heterosis was successful was preliminarily judged by observing whether the plant phenotype was separated; whether the heterozygous site was separated in the hybrid was identified by whole genome resequencing of the plants, so as to accurately judge the frequency of fixation of heterosis.
[0065] In this embodiment, the hybrid F1 plants produced by the mature soybean ms1 cytoplasmic male sterile line and Yudou 11, the T0 generation transgenic plants and the T1 generation transgenic plants were observed and photographed, as shown in FIG. 4. Figure 4 The results showed that there was no difference between the T1 seedlings and the hybrid F1 in morphology, i.e., the binary expression vector could make the hybrid not separate traits, and thus achieve the purpose of fixing heterosis.
[0066] The hybrid F1 produced by the ms1 cytoplasmic male sterile line and Yudou 11 was selfed to obtain 126 seeds, which were planted in the field to obtain T1 generation transgenic plants. The diploid plants were subjected to whole genome sequencing, and the results showed that the genotype of the diploid plants was consistent with that of the hybrid F1, and only a small part of the tetraploid plants existed.
[0067] The ploidy level detection of 126 samples was analyzed by using a BD FACSCalibur flow cytometer and BD CellQuest Pro software, and the specific steps were as follows: (1) 0.5 g of fresh leaves was taken from each sample; (2) 2 mL of lysis buffer was added, and the sample was crushed with a blade and filtered by using an 80 μm nylon filter; (3) the nuclei of the 126 samples were collected by centrifugation at 1000 rpm, and then placed in a 4°C refrigerator for staining for 5 minutes, and then stained with iodinated propyl iodide in the dark for 20 min; (4) wild-type soybeans were used as a control, and the first signal peak detected at about 200 was diploid, and the first signal peak detected at about 400 was tetraploid. The statistics showed that among the 126 plants, there were 71 diploid plants and 55 tetraploid plants, and the induction rate of diploid was 56.35% ( Figure 5 ), which indicated that heterosis had been successfully fixed in soybeans, and the traits of F1 offspring did not separate.
[0068] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. A method of fixing soybean heterosis, characterized by, The method comprises the following steps: soybean breeding hybrid, transforming the binary expression vector into the hybrid to obtain T0 generation plants, and self-crossing to obtain self-crossing seeds; The binary expression vector comprises a ToPAR gene and sgRNAs targeting Glyma.03G141800 gene, Glyma.19G144400 gene, Glyma.14G057200 gene, Glyma.02G263700 gene and Glyma.02G299600 gene; The nucleotide sequences of the sgRNAs targeting the Glyma.03G141800 gene, Glyma.19G144400 gene, Glyma.14G057200 gene, Glyma.02G263700 gene and Glyma.02G299600 gene are shown in SEQ ID NO:1-SEQ ID NO:5 in sequence; and the CDS sequence of the ToPAR gene is shown in SEQ ID NO:
6. The binary expression vector further comprises a soybean pGmEC1.1 promoter; and the promoter sequence of the soybean pGmEC1.1 gene is shown in SEQ ID NO:
7.
2. The method of claim 1, wherein, The nucleotide sequence of the binary expression vector is shown in SEQ ID NO:
8.
3. The method of claim 1, wherein, The binary expression vector is transformed into soybean hybrid through an agrobacterium-mediated soybean cotyledon node transformation method.
Citation Information
Patent Citations
Gene for parthenogenesis
CN113874388A
Method for fixing heterosis of rice
CN116589550A
Plant meiosis-related protein GmPRD1 as well as coding gene and application thereof
CN117209577A