Plant parthenogenesis-inducing gene and use thereof

Abstract

The present invention belongs to the fields of biotechnology and plant breeding. Specifically disclosed are a gene having parthenogenesis-inducing ability in plants, and the use thereof in plant breeding such as induction of haploid formation and apomixis. By means of regulating the expression of a gene that encodes a protein having parthenogenesis-inducing ability, the transition of egg cells into the embryonic development fate is effectively realized, thereby inducing parthenogenesis. The gene and a corresponding induction method therefor can be applied to related plant breeding processes such as the production of haploids and synthetic apomixis.

Description

Plant parthenogenesis-inducing genes and their applications Technical Field

[0001] This invention belongs to the field of biotechnology and plant breeding, and specifically provides a gene in plants that has the ability to induce parthenogenesis, and its application in plant breeding such as inducing haploid formation and apomixis. Background Technology

[0002] In plants, the transformation of egg cells into embryonic cells is a crucial area of ​​reproductive biology research. This process plays a vital role in the plant life cycle, particularly in the sexual reproduction of seed plants. Plant egg cells, located within the embryo sac, are unfertilized haploid cells. After fertilization, the egg cell and sperm cell (usually derived from pollen tubes) combine to form a diploid zygote. This zygote then develops into a multicellular embryo through cell division and differentiation. During this process, the cytoplasm and genetic material of the egg cell undergo transformation, enabling it to acquire the ability to form a complete plant. Research on the transformation of plant egg cells into embryonic cells not only contributes to understanding the fundamental principles of plant reproduction and development but also has practical significance for agricultural practices. For example, genes that induce the transformation of egg cells into embryonic cells under unfertilized conditions—genes capable of inducing parthenogenesis—may be applied to the induction of parthenogenesis in haploid plants and apomixis techniques.

[0003] Haploid plants contain a single set of chromosomes, derived from gametes of either the maternal or paternal parent. Compared to normal diploid plants, they are genetically simpler and exhibit genotypic homozygosity across the entire genome. Haploid technology is particularly valuable in agricultural science because it allows for the doubling of chromosome number in these haploids through natural or artificial methods, resulting in genetically homozygous double haploid (DH) lines. Due to their genetic uniformity, these DH plants are a powerful tool in modern breeding techniques, especially in the pursuit of rapidly developing genetically stable germplasm resources. Compared to traditional breeding methods such as backcrossing or self-pollination, haploid breeding technology significantly improves the speed and efficiency of producing homozygous lines, greatly accelerating the development cycle of new varieties.

[0004] While haploid formation occurs occasionally under natural conditions, its frequency is extremely low, limiting its practical application. Therefore, scientists have developed two main haploid production technologies: in vitro and in vivo. The in vitro method is primarily operated under laboratory conditions. Cells derived from haploid gametophytes are cultured, and these cells can differentiate into haploid embryos under certain induction conditions, eventually developing into complete haploid plants. This method has a wide range of applications, using microspores (pollen) or megaspores (ovules) as starting materials. However, this technology is highly dependent on the plant's genotype, and the difficulty and success rate vary among different plants. Furthermore, mutations are prone to occur and accumulate during in vitro culture, requiring complex and precise operational techniques, including the selection of anther stage, anther pretreatment, and optimization of culture medium formulations.

[0005] In vivo methods utilize natural or technologically modified pollination or induction techniques, including pollen irradiation, interspecific hybridization, and pollination using inducing lines. The advantage of this method is that it can directly induce the formation of haploid embryos within the plant, subsequently leading to haploid seeds and offspring, potentially overcoming the limitations of in vitro culture such as low efficiency, complex operation, and background dependence. Inducing lines in in vivo methods may utilize a unique double fertilization mechanism. In normal double fertilization, one sperm cell fertilizes the egg cell to produce a diploid embryo, while the other sperm cell fertilizes the central cell to form the endosperm. In haploid inducing line technology, haploid embryos can be induced through single fertilization or genomic elimination following double fertilization.

[0006] Haploid induction technology is not only used in breeding to rapidly obtain homozygous germplasm resources, but it can also be combined with gamete cloning technology to develop apomixis systems. Apomixis technology can fix and utilize heterosis in hybrids without traditional fertilization processes, simplifying the breeding process and production practices of hybrids. The application of this technology can significantly reduce the human and material resources required for hybrid production, possessing significant economic and social value. Through these efficient breeding technologies, modern agriculture can better address the needs of global food security and sustainable development. Summary of the Invention

[0007] This invention analyzes the expression patterns of rice genes to screen for transcription factor genes that are expressed in sperm cells but not in oocytes or other tissues. It identifies several transcription factors belonging to the RWP-RK family, including LOC_Os12g12970, and predicts that this family of genes may play an important role in the transition from oocyte fate to embryo fate after fertilization. Further research and experimental confirmation reveal that RWP-RK transcription factors from multiple species, including LOC_Os12g12970 in rice, possess parthenogenesis induction capabilities, thus completing this invention.

[0008] Therefore, this invention provides a parthenogenesis-inducing gene, the expression of which in oocytes can induce the conversion of unfertilized oocyte fate to embryo fate, thereby generating haploid plants. This provides new gene resources and application technologies for plant haploid induction and apomixis.

[0009] This invention provides a protein with parthenogenesis induction ability, characterized in that it is a transcription factor of the RWP-RK protein family, which contains the following conserved domains: TITFEDIRKYFHLPI and KEAAKELNVCLTTLKKICREHGIPRWPHRKIKSLNKLIKNI; and the protein contains a homology of more than 60% with SEQ ID NO: 1 or SEQ ID NO: 2, preferably more than 70%, 80%, 90%, more preferably more than 95%, 98%, 99%, and still has parthenogenesis induction ability.

[0010] Specifically, in rice, the homologous proteins are LOC_Os12g12970 (SEQ ID NO: 4), LOC_Os01g14420 (SEQ ID NO: 6), or LOC_Os04g47640; in maize, the homologous proteins are GRMZM2G004663 (SEQ ID NO: 8) and AC233880 (SEQ ID NO: 10); in wheat, the homologous proteins are TRAES3BF003800040CFD (SEQ ID NO: 12) and TraesCS7A03G1206100 (SEQ ID NO: 14); in sorghum, the homologous proteins are Sobic.003G000800 (SEQ ID NO: 16) and Sobic.008G082000 (SEQ ID NO: 18); and in soybean, the homologous protein is Glyma.06G198300 (SEQ ID NO: 18). (SEQ ID NO: 20); the homologous protein in millet is Seita.3G091700 (SEQ ID NO: 22); the homologous proteins in tomato are Solyc08g062200 (SEQ ID NO: 24) and Solyc12g011190 (SEQ ID NO: 26); or a homologous sequence greater than 22% with LOC_Os12g12970, preferably greater than 35%, more preferably greater than 45%; or a homologous sequence greater than 42% with LOC_Os01g14420, preferably greater than 60%, more preferably greater than 70%; or a homologous sequence greater than 60% with the above proteins, preferably greater than 70%, 80%, 90%, more preferably greater than 95%, 98%, 99%, and still possessing parthenogenetic induction ability.

[0011] Preferably, the homologous genes in rice are LOC_Os12g12970 (SEQ ID NO: 3) and LOC_Os01g14420 (SEQ ID NO: 5) or LOC_Os04g47640; in maize, they are GRMZM2G004663 (SEQ ID NO: 7) and AC233880 (SEQ ID NO: 9); in wheat, they are TRAES3BF003800040CFD (SEQ ID NO: 11) and TraesCS7A03G1206100 (SEQ ID NO: 13); in sorghum, they are Sobic.003G000800 (SEQ ID NO: 15) and Sobic.008G082000 (SEQ ID NO: 17); and in soybean, they are Glyma.06G198300 (SEQ ID NO: 17). SEQ ID NO: 19); the homologous gene in millet is Seita.3G091700 (SEQ ID NO: 21); the homologous genes in tomato are Solyc08g062200 (SEQ ID NO: 23) and Solyc12g011190 (SEQ ID NO: 25). 4. The application of the protein as described in any one of claims 1-2, and the encoding gene as described in claim 3, in inducing parthenogenesis in plants, specifically in inducing haploids; or in apomixis.

[0012] Specifically, the plants are monocotyledonous grasses such as rice, corn, wheat, sorghum, and millet, or dicotyledonous plants such as soybean and tomato.

[0013] The present invention also provides a method for inducing haploid plants, which is achieved by expressing the protein or gene as described in claims 2-3 in egg cells, and then identifying haploid offspring by flow cytometry screening in their offspring; or by combining the above haploid induction method with the method of cloning gametes (such as simultaneously mutating the three genes OSD1, PAIR1, and REC8 in rice), and then obtaining cloned offspring plants in their offspring.

[0014] Specifically, the expression of the gene is driven by a promoter expressed from a heterologous or homologous egg cell.

[0015] More specifically, the promoter is selected from AtDD45 (At2g21740), AtEC1.1 (At1g76750), AtEC1.3 (At2g21750), AtEC1.4 (At4g39340), AtEC1.5 (At5g64720), OsECA1 (LOC_Os03g18530), OsECA2 (LOC_Os11g06730), OsECA3 (LOC_Os12g06970) or other heterologous or homologous promoters that have oocyte expression characteristics.

[0016] In a specific implementation, the promoter of the endogenous gene is modified by gene editing or mutagenesis to induce its expression in oocytes; or an activation system is used in oocytes to induce the expression of the endogenous gene in oocytes. For example, the activation system is a CRISPR / Cas9-based specific gene activation system CRISPRa (such as dCas9-TV, dzCas9-Act3.0, dSpRY-Act3.0, etc.).

[0017] Specifically, the coding sequence of the protein is inserted downstream of the promoter for expression in endogenous oocytes to induce the expression of the gene in oocytes; or the genome is modified to achieve large-segment deletions and chromosomal inversions to recombine the endogenous gene and the promoter on the genome to induce the expression of the gene in oocytes.

[0018] Optionally, haploid plants can be obtained from the progeny of the obtained plant materials through flow cytometry screening, molecular markers, phenotypic identification, and marker-assisted methods. Subsequently, haploid plants can be chemically treated or subjected to spontaneous genome doubling events to obtain genotype-homozygous double haploid materials for use in plant breeding processes.

[0019] In addition, when combined with gamete cloning technology, cloned seeds and plants can be obtained from its offspring, thereby achieving apomixis in plants, which can then be used for hybrid plant breeding or the fixation of plant heterozygous genotypes for hybrid seed production.

[0020] This invention effectively induces parthenogenesis by regulating the expression of a protein gene capable of inducing parthenogenesis, thereby achieving the transformation of an egg cell into an embryonic developmental fate. This gene and its corresponding induction method can be applied to plant breeding processes related to the production of haploids and the synthesis of apomixis. Attached Figure Description

[0021] Figure 1. Expression patterns of candidate genes in various tissues.

[0022] Figure 2. Vector spectrum of pC1300-OsECA::LOC_Os12g12970.

[0023] Figure 3. Phenotype of the pC1300-OsECA::LOC_Os12g12970 transgenic line.

[0024] Figure 4. Ectopic expression of LOC_Os12g12970 in oocytes induces oocytes to autonomously develop into embryonic structures.

[0025] Figure 5. Ectopic expression of LOC_Os12g12970 in oocytes induces haploid offspring.

[0026] Figure 6. Phylogenetic tree of the RWP-RK family.

[0027] Figure 7 shows that the RWP-RK family has two main conservative structural regions.

[0028] Figure 8. Comparison of sequence similarity among candidate branch proteins. The red box represents region 1, which has a similarity of more than 42% with LOC_Os01g14420, and the green box represents region 2, which has a similarity of more than 28% with LOC_Os12g12970. The values ​​shown in the figure are the corresponding similarity percentages.

[0029] Figure 9. Vector map of ectopic expression of homologous genes in oocytes of various species.

[0030] Figure 10. Examples of flow cytometry results of offspring with ectopic expression of homologous genes in oocytes of various species.

[0031] Figure 11. Vector spectrum of pC1300-MiMe-OsECA::LOC_Os12g12970.

[0032] Figure 12. Genotypes of the MiMe-OsECA::LOC_Os12g12970 strain.

[0033] Figure 13. MiMe-OsECA:LOC_Os12g12970 plant phenotype

[0034] Figure 14. Flow cytometry analysis of MiMe-OsECA::LOC_Os12g12970 progeny.

[0035] Figure 15. Whole genome sequencing analysis of diploid progeny clones of MiMe-OsECA::LOC_Os12g12970.

[0036] Figure 16. Location of editing target points in the LOC Os12g1297 starter and stop regions.

[0037] Figure 17. Flow cytometry results of the LOC_Os12g1297 starter and termination sub-regions after editing. Detailed Implementation

[0038] Example 1: Ectopic expression of LOC_Os12g12970 in oocytes induces oocytes to develop into embryos and produce haploid offspring.

[0039] 1. Candidate gene screening:

[0040] Before double fertilization, the egg cell in angiosperms maintains its cellular state and does not undergo embryonic development. However, after the egg cell fuses with the sperm cell, embryonic development is initiated. During this fusion, the sperm cell may introduce relevant embryonic development initiation signals, thus initiating the transition from egg cell fate to embryonic fate. The key gene regulating this transition should possess the following characteristics: 1. Expression in pre-fertilized sperm cells; 2. No expression in pre-fertilized egg cells; 3. Potential expression in the zygote (early embryo) after fertilization; 4. Given the target gene's ability to determine cell fate, it should also be unexpressed or poorly expressed in other tissues; 5. This gene most likely encodes a transcription factor to rapidly initiate the expression of related genes after sperm-egg cell fusion. Based on these characteristics, gene expression pattern analysis was performed on rice to screen for transcription factor genes that are expressed in sperm cells but not in egg cells or other tissues. This includes transcription factors from several RWP-RK families: LOC_Os12g12970, LOC_Os02g20530, LOC_Os09g27190, and LOC_Os08g19820 (Figure 1). Therefore, it is hypothesized that these genes may play an important role in the transition from oocyte fate to embryo fate after fertilization. Further, considering other information and evolutionary relationships, five genes from this family were selected for experiments. The results showed that LOC_Os12g12970, LOC_Os01g14420, and LOC_Os04g47640 were effective.

[0041] 2. The LOC_Os12g12970 gene can promote the transition of unfertilized egg cells to embryonic development fate:

[0042] 1) Carrier construction:

[0043] To test whether these candidate genes have the ability to initiate the transition from oocyte fate to embryonic fate, an experiment was designed to drive the specific expression of LOC_Os12g12970 in oocytes using the rice oocyte expression promoter OsECA. The amplification primers used for OsECA were:

[0044] adPmeI-OsECA1-F:aaacactgatagtttTATACATGGGAGTCTAGTGCAATATTACTC.

[0045] OsECA1-R:GGTTTTTCTTTCTAGCTTTGCTGCTTGG;

[0046] The amplification primers used for LOC_Os12g12970 are:

[0047] F: CTAGAAAGAAAAACCATGGCGGGCGACGGCGGCAAC;

[0048] R: AATGTTTGAACGATCTTATTGATCAAGACCAGCAACTATCCTTC.

[0049] Finally, the expression cassette was ligated to the PmeI site of the pC1300 vector using the Gibson ligation method, resulting in pC1300-OsECA::LOC_Os12g12970, whose vector map is shown in Figure 2.

[0050] 2) Obtaining pC1300-OsECA::LOC_Os12g12970 transgenic plants

[0051] The expression vector pC1300-OsECA::LOC_Os12g12970 was transformed into the Agrobacterium tumefaciens strain EHA105 via electroporation. This binary expression vector was then transformed into the callus of rice variety Chunyou 84 using Agrobacterium-mediated transformation. Specifically, the embryos of Chunyou 84 hybrid rice seeds were sterilized and inoculated into a callus-inducing medium. After one week of culture, vigorous, light yellow, and relatively loose embryogenic callus tissue was selected as the recipient for transformation. Rice callus tissue was infected with EHA105 strain containing the pC1300-OsECA::LOC_Os12g12970 plasmid. After culturing at 25°C in the dark for 3 days, resistant callus tissue and transgenic plants were screened on a selective medium containing 50 mg / L hygromycin. Transgenic plants that grew normally on the hygromycin selective medium were selected. The obtained lines were subjected to PCR testing to see if they contained the corresponding transgenic fragments. Lines that detected bands were lines containing the target transgenic component. The pC1300-OsECA::LOC_Os12g12970 transgenic line was similar to the wild type in terms of plant height and number of tillers, but its seed setting rate was decreased (Figure 3).

[0052] 3) Autonomous development of oocytes in the pC1300-OsECA::LOC_Os12g12970 transgenic line

[0053] To investigate whether ectopic expression of LOC_Os12g12970 in oocytes could induce embryonic development in unfertilized eggs, emasculated wild-type and pC1300-OsECA::LOC_Os12g12970 materials were subjected to pre-flowering emasculation. Observation of the cellular structure within the emasculated ovary revealed that wild-type oocytes remained in a single-cell state, while oocytes from pC1300-OsECA::LOC_Os12g12970 materials autonomously divided and formed embryo-like structures (Figure 4). This indicates that expression of the LOC_Os12g12970 gene in oocytes can induce embryonic development.

[0054] 4) The self-crossed offspring of the pC1300-OsECA::LOC_Os12g12970 transgenic line can induce the production of haploids.

[0055] To determine whether the expression of LOC_Os12g12970 in oocytes can induce haploid offspring, flow cytometry analysis was performed on the offspring produced by self-pollination of pC1300-OsECA::LOC_Os12g12970 to detect their plant ploidy. The specific analysis process is as follows: Rice leaves approximately 0.5 cm long were cut into a homogenate using a double-edged blade in 1 mL of ice-cold LBO1 buffer. The LBO1 buffer consisted of the following components: 15 mM Tris, 2 mM disodium EDTA, 0.5 mM sperminetetrahydrochloride, 80 mM KCl, 20 mM NaCl, 0.1% (v / v) Triton X-100, 15 mM β-mercaptoethanol, and pH 7.5. The leaf fragments were then removed by filtering through a 45-micron filter. Cell nuclei were collected by centrifugation at 1200 rcf and 4 °C for 5 minutes and stained with 500 μL of LBO1 buffer containing 25 mg / L propidium iodide and 25 mg / L DNase-free RNase A for 20 minutes. Finally, the ploidy of the cell nuclei was analyzed by flow cytometry. The results are shown in Figure 5, where the peak value of the control diploid is at approximately 70,000 (diploid), while the peak value of the detected haploid is at 35,000 (haploid).

[0056] Using the above methods, a total of 5 haploid progeny strains were screened from 155 OsECA::LOC_Os12g12970 progeny strains, with a haploid induction rate of approximately 3.2%. This indicates that ectopic expression of LOC_Os12g12970 in oocytes can induce haploid production.

[0057] Example 2: Screening of homologous genes from multiple species

[0058] To screen whether other genes in the same family as LOC_Os12g12970 also possess haploid induction ability, a phylogenetic similarity tree analysis was performed on members of the RWP-RK family in multiple species. Figure 6 shows that two other genes in rice, LOC_Os01g14420 and LOC_Os09g27190, belong to the same branch as LOC_Os12g12970; in maize, GRMZM2G004663 and AC233880 belong to the same branch; in wheat, TRAES3BF003800040CFD and TraesCS7A03G1206100 belong to the same branch; and in sorghum, Sobic.003G000800 and Sobic.008G0 belong to the same branch. Genes belonging to this branch include 82000, Sobic.007G127800, and Sobic.006G276566; in tomatoes, Solyc12g011190 and Solyc08g062200; in grapes, GSVIVT01020855001; and in soybeans, Glyma.06G054900, Glyma.04G054800, Glyma.06G198300, Glyma.20G016400, and Glyma.20G016500. Furthermore, this protein family primarily contains two main protein structural regions (Figure 7), whose sequences in LOC_Os12g12970 are SEQ ID NO: 1 and SEQ ID NO: 2, respectively, indicating that these two regions may play an important role in its function. The above summary indicates that LOC_Os12g12970 has relatively similar homologous genes in multiple species. While the sequence similarity among proteins within the branch is not high, two main similarity regions still exist: region 1, with a similarity exceeding 42% to rice LOC_Os01g14420, and region 2, with a similarity exceeding 28% to LOC_Os12g12970 (Figure 8).

[0059] Example 3:

[0060] Therefore, in order to verify whether candidate genes in various species with a similarity of more than 42% to rice LOC_Os01g14420 and more than 28% to LOC_Os12g12970, as well as genes in the same family of rice, still have haploid induction ability, the experiment was designed to drive the expression of candidate genes in various species in rice using an oocyte promoter.

[0061] Finally, the expression cassettes were ligated to the PmeI site of the pC1300 vector using the Gibson ligation method, thus obtaining the oocyte ectopic expression vectors for each gene, and their vector map is shown in Figure 9.

[0062] Transgenic lines expressing homologous genes ectopically in oocytes of various species were obtained using the same method described above, and the ploidy of their offspring was detected by flow cytometry. Specifically, the expression vector was transferred into the Agrobacterium tumefaciens strain EHA105 via electroporation. This binary expression vector was then transferred into the callus of rice Chunyou 84 using Agrobacterium-mediated transformation. The transformation method involved sterilizing the embryos of hybrid rice Chunyou 84 seeds and inoculating them into a callus-inducing medium. After one week of culture, vigorous, light yellow, and relatively loose embryogenic callus tissue was selected as the recipients for transformation. Rice callus tissue was infected with EHA105 strain containing the target plasmid. After culturing at 25°C in the dark for 3 days, resistant callus tissue and transgenic plants were screened on a selective medium containing 50 mg / L hygromycin. Transgenic plants that grew normally on the hygromycin selective medium were selected. The obtained strains were subjected to PCR testing to see if they contained the corresponding transgenic fragments. The strains that detected the bands were the strains containing the target transgenic component.

[0063] To detect whether the expression of homologous genes from various species in oocytes can induce haploid offspring, flow cytometry analysis was performed on the offspring produced by self-pollination of each transgenic line to detect their ploidy. The specific analysis process is as follows: Rice leaves approximately 0.5 cm long were cut into a homogenate using a double-edged blade in 1 mL of ice-cold LB01 buffer. The LB01 buffer consisted of the following components: 15 mM Tris, 2 mM disodium EDTA, 0.5 mM sperminetetrahydrochloride, 80 mM KCl, 20 mM NaCl, 0.1% (v / v) Triton X-100, 15 mM β-mercaptoethanol, and pH 7.5. The leaf fragments were then removed by filtering through a 45-micron filter. Cell nuclei were collected by centrifugation at 1200 rcf and 4 °C for 5 minutes and stained with 500 μL of LB01 buffer containing 25 mg / L propidium iodide and 25 mg / L DNase-free RNase A for 20 minutes. Finally, the ploidy of the cell nuclei was analyzed by flow cytometry. The results are shown in Figure 10, where the peak value of the control diploid is at approximately 70,000 (diploid), while the peak value of the detected haploid is at 35,000 (haploid).

[0064] Using the methods described above, haploids of offspring ectopically expressed with homologous genes in oocytes of various species were identified. The genes with haploid induction ability are shown in Table 2. This indicates that homologous genes of this type still possess haploid induction ability in multiple species. The proteins encoded by these genes show a similarity of ≥42% to rice LOC_Os01g14420 or ≥22% to LOC_Os12g12970 (Table 1).

[0065] Table 1. Summary of haploid identification results of offspring from ectopic expression of homologous genes in oocytes of various species

[0066] Example 4: Ectopic expression of LOC_Os12g12970 in oocytes combined with the MiMe mutant in clonal gametes to induce the production of clonal offspring.

[0067] Apomixis can be used to fix heterosis and achieve self-propagation of hybrid varieties, thereby saving a significant amount of breeding costs for hybrid rice. Currently reported artificial synthetic apomixis systems all combine gamete cloning methods (such as MiMe) and haploid induction methods. To test the effect of the haploid induction gene in this invention on the apomixis system, an experiment was designed to simultaneously knock out three genes in rice: OsOSD1, OsPAIR1, and OsREC8, while ectopically expressing LOC_Os12g12970 in oocytes.

[0068] First, construct the gene-editing knockout vectors for OsOSD1, OsPAIR1, and OsREC8:

[0069] The following sites were selected as the sites for CRISPR-Cas9 gene editing system knockout of OSD1 (LOC_Os02g37850), PAIR1 (LOC_Os03g01590), and REC8 (LOC_Os05g50410) (underlined PAM sequences):

[0070] OSD1-1 gene knockout site: CTGCCGCCGACGAGCAACAAGG; OSD1-2 gene knockout site: CCGCCGGGAGCCGTGGCGGTCAA.

[0071] PAIR1 gene knockout site: AAGCAACCCAGTGCACCGCTGG; REC8 gene knockout site: CCCATGGCACTAAGGCTCTCCG.

[0072] Design two complementary DNA sequences: add GGCA before the forward sequence and add AAAC before the reverse complementary sequence.

[0073] The SK-gRNA has two AarI restriction sites. After digestion with AarI, a vector with sticky ends is formed. After denaturation and annealing with the forward and reverse primers of the designed target sequence, the T4 ligase is used to ligate it into the previously constructed intermediate vector SK-gRNA to form a single target gRNA.

[0074] 2) Concatenation of multiple gRNAs and construction of the final binary expression vector

[0075] Utilizing the isosinetic nature of BglII and BamHI, NheI and XbaI, and SalI and XhoI, gRNA was polymerized into the pC1300-Cas9 vector to obtain a multi-gene knockout vector pC1300-Cas9-gRNA1 OSD1-gRNA20SD1-gRNA REC8-gRNA PAIR1 (hereinafter referred to as pC1300-MiMe), which can simultaneously knock out three genes: REC8, OSD1, and PAIR1. This vector was used for the subsequent construction of the backbone vector (MiMe backbone vector).

[0076] Subsequently, amplification primers for OsECA were used: adPmeI-OsECA1-F: aaacactgatagtttTATACATGGGAGTCTAGTGCAATATTACTC; OsECA1-R: GGTTTTTCTTTCTAGCTTTGCTGCTTGG; and amplification primers for LOC_Os12g12970 were used: VF: CTAGAAAGAAAAACCATGGCGGGCGACGGCGGCAAC; VR: AATGTTTGAACGATCTTATTGATCAAGACCAGCAACTATCCTTC.

[0077] Finally, the expression cassette was ligated to the PmeI site of the pC1300-MiMe vector using the Gibson ligation method, resulting in pC1300-MiMe-OsECA::LOC_Os12g12970, whose vector map is shown in Figure 11.

[0078] 1) Obtaining pC1300-MiMe-OsECA::LOC_Os12g12970 transgenic plants

[0079] The expression vector pC1300-MiMe-OsECA::LOC_Os12g12970 was transformed into the Agrobacterium tumefaciens strain EHA105 via electroporation. This binary expression vector was then transformed into the callus of rice variety Chunyou 84 using Agrobacterium-mediated transformation. Specifically, the embryos of Chunyou 84 hybrid rice seeds were sterilized and inoculated into a callus-inducing medium. After one week of culture, vigorous, light yellow, and relatively loose embryogenic callus tissue was selected as the recipients for transformation. Rice callus tissue was infected with EHA105 strain containing the pC1300-MiMe-OsECA::LOC_Os12g12970 plasmid. After culturing at 25°C in the dark for 3 days, resistant callus tissue and transgenic plants were screened on a selective medium containing 50 mg / L hygromycin. Transgenic plants that grew normally on the hygromycin selective medium were selected. The obtained strains were subjected to PCR detection to assess the editing effect of the three MiMe genes. The detection primers used are as follows:

[0080] REC8-F: gcgacgcttcactcgaagatca; REC8-R: cgccatgcctcgttgatctcaa

[0081] OSD1-F: atctccaggatgcctgaagtgag; OSD1-R: cctagactgctactcttgctagtgat

[0082] PAIR1-F: ctgtacctgtgcatctaattacag; PAIR1-R: ccccatctttgtactgagcttgccag.

[0083] The obtained PCR fragments were sequenced to select lines homozygous for all three MiMe genes. The genotypes of the obtained lines are shown in Figure 13.

[0084] 2) MiMe-OsECA::LOC_Os12g12970 produces clonal diploid offspring.

[0085] In rice, homozygous mutants of MiMe are all tetraploid. If MiMe-OsECA::LOC_Os12g12970 produces clonal diploid offspring, a certain proportion of diploid plants can be detected in these offspring. Seeds of the T1 progeny obtained from self-pollination of various lines of MiMe-OsECA::LOC_Os12g12970 were germinated, and flow cytometry analysis was performed at the seedling stage to determine the ploidy of the progeny. As shown in Figure 14, in addition to tetraploids, diploids were also detected in the progeny of MiMe-OsECA::LOC_Os12g12970, indicating that MiMe-OsECA::LOC_Os12g12970 did indeed produce diploid offspring.

[0086] Whole-genome sequencing of the diploid offspring of the obtained MiMe-OsECA::LOC_Os12g12970 gene revealed, as shown in Figure 15, that their genotypes were identical to the control parent CY84, exhibiting genome-wide heterozygosity. This indicates that the LOC_Os12g12970 gene can be effectively used for the synthesis of apomixis.

[0087] Example 5: Gene editing of the promoter region of the rice endogenous gene LOC_Os12g1297 can induce haploid offspring.

[0088] Gene expression patterns are controlled by their transcriptional regulatory sequences; therefore, modifying the promoters of endogenous genes can alter their expression patterns and levels. To modify the rice endogenous gene LOC_Os12g1297 to express it in oocytes, thereby achieving an effect similar to ectopic expression of the gene for haploid production, several gene editing knockout targets were uniformly designed targeting approximately 2000 bp upstream and 500 bp downstream of the LOC_Os12g1297 gene. The specific sequences and approximate locations of these targets on the gene are shown in Table 2 and Figure 16.

[0089] Table 2. Design of LOC_Os12g1297 gene regulatory sequence editing targets

[0090] Subsequently, for each target site, two complementary DNA sequences were designed: GGCA was added before the forward sequence, and AAAC was added before the reverse complementary sequence.

[0091] The SK-gRNA has two AarI restriction sites. After digestion with AarI, a vector with sticky ends is formed. After denaturation and annealing with the forward and reverse primers of the designed target sequence, the T4 ligase is used to ligate it into the previously constructed intermediate vector SK-gRNA to form a single target gRNA.

[0092] 2) Concatenation of multiple gRNAs and construction of the final binary expression vector

[0093] Utilizing the isosinetic nature of BglII and BamHI, NheI and XbaI, and SalI and XhoI, gRNAs were polymerized into the pC1300-Cas9 vector to obtain vectors containing multiple editing targets: pC1300-Cas9-Promoter-g1-g5, pC1300-Cas9-Promoter-g6-g10, pC1300-Cas9-Promoter-g11-g15, pC1300-Cas9-Promoter-g16-g20, pC1300-Cas9-Promoter-g21-g23, and pC1300-Cas9-Terminator-g1-g4, etc., for subsequent genetic transformation.

[0094] The specific transformation method is as follows: Gene editing vectors pC1300-Cas9-Promoter-g1-g5, pC1300-Cas9-Promoter-g6-g10, pC1300-Cas9-Promoter-g11-g15, pC1300-Cas9-Promoter-g16-g20, pC1300-Cas9-Promoter-g21-g23, and pC1300-Cas9-Terminator-g1-g4 were transferred into the *Agrobacterium tumefaciens* strain EHA105 via electroporation. This binary expression vector was then transferred into the callus of rice variety Chunyou 84 using *Agrobacterium tumefaciens*-mediated transformation. Specifically, the embryos of hybrid rice Chunyou 84 seeds were sterilized and inoculated into a callus-inducing medium. After one week of culture, vigorous, light yellow, and relatively loose embryogenic callus tissue was selected as the recipient for transformation. Rice callus tissue was infected with the EHA105 strain containing the target plasmid. After culturing at 25°C in the dark for 3 days, resistant callus tissue and transgenic plants were screened on selective medium containing 50 mg / L hygromycin. Transgenic plants that grew normally on the hygromycin selective medium were selected. PCR detection was performed on the obtained lines to screen out multiple lines with edited LOC_Os12g1297 promoter and terminator regions. Flow cytometry was used to screen the offspring to identify whether haploid offspring were produced (Figure 17). The results of haploid detection are shown in Table 3.

[0095] Table 3. Haploid progeny generated by editing the LOC_Os12g1297 start and stop subregions.

[0096] The above results demonstrate that modifying the regulatory sequences of the discovered endogenous genes can also induce the production of haploids.

Claims

1. A protein having the ability to induce parthenogenesis, characterized in that, It is a transcription factor of the RWP-RK protein family, which contains the following conserved domains: TITFEDIRKYFHLPI and KEAAKELNVCLTTLKKICREHGIPRWPHRKIKSLNKLIKNI; and the protein contains a homology of more than 60% with SEQ ID NO:1 or SEQ ID NO:2, preferably more than 70%, 80%, 90%, more preferably more than 95%, 98%, 99%, and still has the ability to induce parthenogenesis.

2. The protein of claim 1, wherein In rice, the homologous proteins are LOC_Os12g12970 (SEQ ID NO: 4), LOC_Os01g14420 (SEQ ID NO: 6), or LOC_Os04g47640; in maize, the homologous proteins are GRMZM2G004663 (SEQ ID NO: 8) and AC233880 (SEQ ID NO: 10); in wheat, the homologous proteins are TRAES3BF003800040CFD (SEQ ID NO: 12) and TraesCS7A03G1206100 (SEQ ID NO: 14); in sorghum, the homologous proteins are Sobic.003G000800 (SEQ ID NO: 16) and Sobic.008G082000 (SEQ ID NO: 18); and in soybean, the homologous protein is Glyma.06G198300 (SEQ ID NO: 18). (SEQ ID NO: 20); the homologous protein in millet is Seita.3G091700 (SEQ ID NO: 22); the homologous proteins in tomato are Solyc08g062200 (SEQ ID NO: 24) and Solyc12g011190 (SEQ ID NO: 26); or a homologous sequence greater than 22% with LOC_Os12g12970, preferably greater than 35%, more preferably greater than 45%; or a homologous sequence greater than 42% with LOC_Os01g14420, preferably greater than 60%, more preferably greater than 70%; or a homologous sequence greater than 60% with the above proteins, preferably greater than 70%, 80%, 90%, more preferably greater than 95%, 98%, 99%, and still possessing parthenogenetic induction ability.

3. The gene encoding the protein as described in claim 1 or 2, preferably, in rice, LOC_Os12g12970 (SEQ ID NO: 3), LOC_Os01g14420 (SEQ ID NO: 5), or LOC_Os04g47640; in maize, the homologous genes are GRMZM2G004663 (SEQ ID NO: 7) and AC233880 (SEQ ID NO: 9); in wheat, the homologous genes are TRAES3BF003800040CFD (SEQ ID NO: 11) and TraesCS7A03G1206100 (SEQ ID NO: 13); and in sorghum, the homologous genes are Sobic.003G000800 (SEQ ID NO: 15) and Sobic.008G082000 (SEQ ID NO: 9). The homologous gene in soybean is Glyma.06G198300 (SEQ ID NO: 19); the homologous gene in millet is Seita.3G091700 (SEQ ID NO: 21); and the homologous genes in tomato are Solyc08g062200 (SEQ ID NO: 23) and Solyc12g011190 (SEQ ID NO: 25).

4. The application of the protein as described in any one of claims 1-2, or the encoding gene as described in claim 3, in inducing parthenogenesis in plants, specifically in inducing haploids; or in apomixis.

5. The use according to claim 4, wherein the compound is ###0002### The plants mentioned are monocotyledonous grasses such as rice, corn, wheat, sorghum, and millet, or dicotyledonous plants such as soybean and tomato.

6. A method of inducing haploidy in a plant, comprising, This can be achieved by expressing the protein as described in claim 1 or 2 in oocytes, and then identifying haploid offspring through flow cytometry screening; or by combining the above haploid induction method with the method of cloning gametes (such as simultaneously mutating the three genes OSD1, PAIR1, and REC8 in rice), and then obtaining cloned offspring plants in their offspring.

7. The method of claim 6, wherein, The expression of the gene is driven by a promoter expressed from a heterologous or homologous egg cell.

8. The method of claim 7, wherein, The promoters are selected from AtDD45 (At2g21740), AtEC1.1 (At1g76750), AtEC1.3 (At2g21750), AtEC1.4 (At4g39340), AtEC1.5 (At5g64720), OsECA1 (LOC_Os03g18530), OsECA2 (LOC_Os11g06730), OsECA3 (LOC_Os12g06970) or other heterologous or homologous promoters that have oocyte expression characteristics; Specifically, the promoter of the endogenous gene is modified by gene editing or mutagenesis to induce its expression in oocytes; or an activation system is used in oocytes to induce the expression of the endogenous gene in oocytes. For example, the activation system is a CRISPR / Cas9-based specific gene activation system CRISPRa (such as dCas9-TV, dzCas9-Act3.0, dSpRY-Act3.0, etc.).

9. The method of claim 6, wherein, The coding sequence of the protein is inserted downstream of the promoter for expression in endogenous oocytes to induce the expression of the gene in oocytes; or the genome is modified to achieve large-segment deletions and chromosomal inversions to recombine the endogenous gene and the promoter on the genome to induce the expression of the gene in oocytes.

10. The method according to any one of claims 6 to 9, wherein, Haploid plants are obtained from the progeny of the obtained plant materials through flow cytometry screening, molecular markers, phenotypic identification, and marker-assisted methods. Subsequently, haploid plants can be chemically treated or subjected to spontaneous genome doubling events to obtain homozygous double haploid materials for use in plant breeding processes. In addition, when combined with gamete cloning technology, cloned seeds and plants can be obtained from its offspring, thereby achieving apomixis in plants, which can then be used for hybrid plant breeding or the fixation of plant heterozygous genotypes for hybrid seed production.

Images