Use of rex02 as a diagnostic / prognostic biomarker and therapeutic target for glioblastoma
By inhibiting REXO2 expression, therapeutic drugs and diagnostic products for glioblastoma have been developed, solving the problem of poor efficacy in the treatment of GBM in existing technologies and achieving effective diagnosis and treatment of GBM.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHONGQING MEDICAL UNIVERSITY
- Filing Date
- 2025-01-07
- Publication Date
- 2026-05-19
AI Technical Summary
Existing technologies offer limited treatment options for glioblastoma multiforme (GBM), particularly due to its invasiveness to normal brain tissue, poor blood-brain barrier penetration, and inherent glioma drug resistance, resulting in poor treatment outcomes. The specific mechanism of REXO2 in the development and progression of GBM remains unclear.
Using REXO2 as a target, we aim to develop drugs to treat glioblastoma by inhibiting its expression, and to use the detection of REXO2 expression levels for the diagnosis and prognostic assessment of glioblastoma.
High REXO2 expression is associated with shorter patient survival. Inhibiting REXO2 can significantly suppress the clonogenic ability of U251 cells, reduce their proliferation and tumorigenicity, demonstrating that it can serve as a therapeutic target and diagnostic biomarker for glioblastoma.
Smart Images

Figure CN119753146B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to the application of REXO2 as a diagnostic / prognostic biomarker and therapeutic target for glioblastoma. Background Technology
[0002] Glioblastoma multiforme (GBM) is the most common and deadliest primary brain tumor, characterized by high incidence, short survival, low survival rate, high malignancy, and rapid development. Traditional treatments include surgical resection, radiotherapy, and chemotherapy, but these have limited effectiveness due to GBM's invasion of normal brain tissue, significant tumor heterogeneity, poor blood-brain barrier penetration, and inherent glioma drug resistance.
[0003] Mitochondria are crucial organelles within cells, and the brain, being the organ with the highest energy demand from mitochondria, is particularly affected by subtle changes in energy production. Mitochondrial RNA, produced during mitochondrial transcription, is degraded into oligonucleotides of approximately 2-5 bp by RNA degraders. REXO2, as a downstream component of RNA degraders, can degrade these oligonucleotides into mononucleotides, maintaining RNA homeostasis. Studies have shown that knocking down REXO2 expression in HeLa cells affects cell morphology and mitochondrial structure, causing cell cycle arrest, remaining in the G0 / G1 phase, and altering mtDNA and mtRNA levels. Complete knockout of Rexo2 in mice leads to embryonic lethality, while conditional knockout of Rexo2 in cardiomyocytes has no significant effect on body weight and heart weight in adult mice. Currently, the impact and specific mechanisms of REXO2 in the development and progression of GBM are unclear. Whether targeting REXO2 affects GBM development and the specific mechanisms involved remain to be explored. Summary of the Invention
[0004] The purpose of this invention is to address the above-mentioned problems by providing an application of REXO2 as a diagnostic / prognostic biomarker and therapeutic target for glioblastoma.
[0005] To achieve its objective, the present invention employs the following technical solution:
[0006] The first aspect of the present invention provides the use of REXO2 as a target in screening or preparing drugs for treating glioblastoma.
[0007] In the aforementioned application technology solution, the drug inhibits the expression of REXO2.
[0008] In the aforementioned application technology solution, the drug achieves its therapeutic effect on glioblastoma by inhibiting the clonogenic ability of glioblastoma.
[0009] In the aforementioned application technology solution, the cell line of the glioblastoma is U251.
[0010] A second aspect of the invention provides the use of a REXO2 expression inhibitor in the preparation of a medicament for treating glioblastoma.
[0011] In the aforementioned application technology solution, the drug inhibits the expression of REXO2.
[0012] In the aforementioned application technology solution, the expression inhibitor achieves the therapeutic effect of glioblastoma by inhibiting the clonogenic ability of glioblastoma.
[0013] A third aspect of the invention provides the use of REXO2 as a target in the preparation of reagents or kits for diagnosing glioblastoma.
[0014] A fourth aspect of the present invention provides the use of a reagent for detecting REXO2 expression levels in the preparation of products for the diagnosis or prognosis of glioblastoma subjects.
[0015] The beneficial effects of this invention are:
[0016] This invention confirms that REXO2 expression is higher in GBM patient tumor tissues, and patients with high REXO2 expression have shorter survival times. REXO2 expression increases with increasing malignancy, demonstrating that REXO2 can be used for the diagnosis and prognostic assessment of glioblastoma. Subsequent validation experiments showed that REXO2 knockdown significantly inhibited the clonogenic ability of U251 cells, indicating a reduction in their proliferation and tumorigenicity. This suggests that REXO2 can serve as a therapeutic target for glioblastoma. Therefore, using REXO2 as a target in the preparation of drugs or products for the diagnosis, treatment, and prognosis of glioblastoma has potential significance. Attached Figure Description
[0017] Figure 1This is a survival curve plot of REXO2 expression level and GBM patient survival in the TCGA database in this application embodiment. Here, "survival time (Months)" means "survival time (months)," "Surviving" means "survival rate," "Histology:GBM; Subtype:All; Cutoff:median" means that the survival analysis was performed based on the histological characteristics of glioblastoma multiforme, including all subtypes of GBM; the median was used as the cutoff point, "REXO2 High" and "REXO2 Low" mean patients with high and low REXO2 expression, respectively, "n" means the number of patient samples observed, "events" means the number of death events, "median" means the median, based on which the samples are divided into high and low expression groups, "HR" means Hazard Ratio, which represents the hazard multiple of one group relative to another group at a certain time point for an event (such as death or disease progression), and "Log-rank p value" and "Willcoxon p value" are also included. The meaning of "p-value" is two non-parametric test methods. If the p-value is less than 0.05, the survival difference between the two groups is considered significant.
[0018] Figure 2 This is a graph showing the results of REXO2 expression levels in normal tissue samples and GBM patient samples from the three clinical databases TCGA, CGGA, and Gravedeel in this application embodiment. Here, "non-tumor" means healthy tissue, "GBM" means glioblastoma multiforme patient tissue, and "mRNA expression (log2)" means the REXO2 mRNA transcriptional expression level.
[0019] Figure 3 This is a statistical graph showing the expression level of REXO2 in GBM patients at different grades in the three clinical databases TCGA, CGGA, and Gravedeel in this application embodiment. Among them, II, III, and IV represent glioblastoma patient samples of type II, type III, and type IV, respectively. The meaning of "mRNA expression (log2)" is the expression level of REXO2 mRNA transcription.
[0020] Figure 4This is a transcriptional diagram of REXO2 in U251 cells after REXO2 knockdown in the embodiments of this application. "Scr" means the U251 cell line infected with PLKO.1-Scr as a control group. "shRNA#1 and shRNA#6" mean the U251 cell lines with REXO2 knockdown after infection with PLKO.1-REXO2. "Relative mRNA expression of REXO2" means the relative expression level of REXO2 mRNA.
[0021] Figure 5 This is a diagram showing the experimental results of the clone formation experiment in the embodiments of this application, wherein, Figure 5 (a) is a staining image of U251 cells before and after REXO2 knockdown. Figure 5 (b) is a statistical analysis of the clonogenic capacity of U251 cells before and after REXO2 knockdown. In this figure, "Scr" means the U251 cell line infected with PLKO.1-Scr as the control group, "shRNA#1 and shRNA#6" mean the U251 cell lines with REXO2 knockdown after infection with PLKO.1-REXO2, and "Clone count" means the number of clones. Detailed Implementation
[0022] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.
[0023] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.
[0024] Example 1
[0025] The research method of this invention is as follows: First, data from open tumor clinical sample databases TCGA, CGGA, and Gravendeel were analyzed to explore the expression of REXO2 in GBM patient samples. Then, REXO2 expression was inhibited in the glioblastoma cell line U251 using shRNA lentivirus to construct a stable REXO2 knockdown glioblastoma cell line. Combined with clonogenic assays, the study explored whether REXO2 knockdown affected the proliferation and tumorigenicity of glioblastoma.
[0026] Results: Online database analysis showed that GBM patients had higher REXO2 expression levels in their tumor tissues, and patients with high REXO2 expression had shorter survival times. The expression level of REXO2 increased with the degree of malignancy, which proves that REXO2 can be used for the diagnosis and prognostic assessment of glioblastoma. Subsequent validation experiments showed that knocking down REXO2 significantly inhibited the clonogenic ability of U251, indicating a reduction in its proliferative capacity and tumorigenicity. This suggests that REXO2 can serve as a therapeutic target for glioblastoma.
[0027] The specific experimental procedure is as follows:
[0028] 1. Main experimental reagents and instruments
[0029]
[0030]
[0031] For any other specific conditions not specified, follow the standard conditions or the manufacturer's recommendations. For reagents or instruments whose manufacturers are not specified, they are all commercially available products.
[0032] 2. Methods
[0033] 2.1 Clarify the expression of REXO2 in clinical glioma samples and glioma cell lines.
[0034] Using the online analysis website https: / / gliovis.bioinfo.cnio.es, the genomes of GBM tumor patients were analyzed in the TCGA, CGGA, and Gravendeel databases. The expression levels of REXO2 in 10 normal tissue samples and 528 GBM patient samples were compared, as were the expression levels of REXO2 in different grades of GBM patients.
[0035] 2.2 REXO2 regulates glioblastoma function
[0036] 2.2.1 Construction of a stable REXO2 knockdown glioblastoma cell line
[0037] 1) Lentiviral plasmid construction: The REXO2-shRNA interference lentiviral plasmid was constructed by the research group using conventional methods by linking shRNA to the PLKO.1 empty vector plasmid;
[0038] 2) The Gene ID of REXO2 in NCBI is 25996; the REXO2-shRNA sequence is as follows:
[0039] sequence name Sequence (5'-3'') SEQ ID NO shREXO2-1-Chain of Justice GCGGATGGTCTGGGTGGACCT SEQ ID NO.1 shREXO2-1-Ansense Chain AGGTCCACCCAGACCATCCGC SEQ ID NO.2 shREXO2-6-Chain of Justice GAAACATCTTCATTATAGAAT SEQ ID NO.3 shREXO2-6-Ansense Chain ATTCTATAATGAAGATGTTTC SEQ ID NO.4
[0040] 3) Virus packaging: Prepare HEK 293T cells and culture at 37°C; when the cells reach 90% confluency in a 6cm culture dish, perform transfection; the plasmid transfection system is as follows:
[0041] plasmid Dosage pMD2.G 2.5μg psPAX2 5μg REXO2-shRNA 2.5μg PEI transfection reagent 30 μL (1 μg / μL)
[0042] Prepare 500 μl serum-free DMEM medium + 30 μl transfection reagent PEI, mix thoroughly, and let stand for 5 min; prepare 500 μl serum-free DMEM medium + 2.5 μg target plasmid + 2.5 μg pMD2.G + 5 μg psPAX2, mix thoroughly, and let stand for 5 min; combine the two prepared liquids together and let stand at room temperature for 20 min; add the entire mixture to a 293T culture dish; collect the viral supernatant 48 h and 72 h after transfection, and filter using a 0.45 μm filter; aliquot the filtered virus and store at -20℃.
[0043] 4) Lentiviral infection procedure: Seed cells into six-well plates as needed and incubate overnight in an incubator. The cell density at infection should be about 40%-50%. Add 1 ml of fresh culture medium and 2 ml of virus solution. After 48 hours of infection, add an appropriate concentration of puromycin for stabilization screening. Use wild-type cell lines with the same concentration of puromycin as a control. Stop screening when all wild-type cells die during the screening process.
[0044] 5) Collect RNA from selected cells: standard laboratory method.
[0045] 6) QPCR detection: U251 cells with and without REXO2 knockdown were detected using routine laboratory methods.
[0046] 2.2.2 Cloning experiment
[0047] The clonogenic assay is an important technique for detecting cell proliferation, invasiveness, and sensitivity to cytotoxic agents. Firstly, it indicates the proliferative capacity of treated cells by assessing their clonogenic ability on cell culture plates. Secondly, it evaluates the tumorigenicity of cells in vivo. While not all cancer cells can form tumors in vivo, stronger in vitro clonogenic ability indicates stronger in vivo tumorigenicity. Therefore, the clonogenic assay can be used to determine whether REXO2 knockout affects the proliferation and tumorigenicity of glioblastoma.
[0048] 1000 cells / well were seeded in six-well plates and incubated at 37°C for 14 days, with medium changes every 3 days. Cells were fixed and stained with crystal violet at day 14 for observation. (Data are expressed as mean + standard deviation). The experiment was repeated at least three times. Data were analyzed using GraphPad Prism 8 statistical software. The two-tailed Student's t test was used to compare the two groups, and a p-value < 0.05 was considered statistically significant.
[0049] 3. Results
[0050] 3.1 Expression of REXO2 in clinical glioma samples and glioma cell lines
[0051] Survival curves obtained from online database analysis are shown below. Figure 1 As shown in the figure, the red line represents 242 GBM patients with high REXO2 expression, and the blue line represents 246 GBM patients with low REXO2 expression. The figure shows that patients with high REXO2 expression have shorter survival.
[0052] The results of REXO2 expression levels in normal tissue samples and GBM patient samples are shown in the figure below. Figure 2 As shown in the figure, compared with normal tissue, the expression level of REXO2 in the tumor tissue of GBM patients is higher; the results of REXO2 expression levels in tissue samples of different grades of GBM patients are shown in the figure below. Figure 3 As shown, by Figure 3 It can be seen that the expression level of REXO2 increases with the increase of the malignancy of the patient.
[0053] Combination Figures 1-3 It is known that the expression level of REXO2 in the tumor tissue of GBM patients is higher, and patients with high REXO2 expression have shorter survival time. The expression level of REXO2 increases with the increase of the malignancy of the patient, which proves that REXO2 can be used for the diagnosis and prognostic assessment of glioblastoma.
[0054] 3.2 REXO2 regulates glioblastoma function
[0055] U251 cells were infected with a lentivirus containing REXO2-shRNA, and the knockdown efficiency was verified by qPCR experiments. The results are as follows: Figure 4 As shown in the figure, the REXO2 transcription level of U251 was significantly reduced compared with the control group.
[0056] Cloning experiment results as follows Figure 5 As shown, crystal violet-stained cell colonies are tumor cell monoclonal colonies. The number of monoclonal colonies shown in the figure indicates that the U251 colony-forming ability is reduced after REXO2 knockdown, which means that its proliferation ability and tumorigenicity are reduced. The results are statistically significant.
[0057] In summary, REXO2 can be used for the diagnosis and prognostic assessment of glioblastoma. REXO2 can be targeted for the development and preparation of products for the diagnosis or prognosis of glioblastoma. The malignancy of glioblastoma can be determined by detecting the expression level of REXO2. Knockdown of REXO2 significantly inhibits the clonogenic ability of U251, indicating a reduction in its proliferative capacity and tumorigenicity, suggesting that REXO2 can serve as a therapeutic target for glioblastoma. In the development, screening, or preparation of drugs targeting glioblastoma, inhibiting REXO2 expression can suppress the proliferation and tumorigenicity of glioblastoma.
Claims
1. The application of REXO2 as a target in the preparation of drugs for treating glioblastoma, characterized in that: The drug is an shRNA that inhibits REXO2 expression, and the sequence of the shRNA is shREXO2-1 shown in SEQ ID NO.1-2 or shREXO2-6 shown in SEQ ID NO.3-4.
2. The application according to claim 1, characterized in that: The drug achieves its therapeutic effect on glioblastoma by inhibiting the clonogenic ability of glioblastoma.
3. The application according to claim 2, characterized in that: The cell line of the glioblastoma is U251.
4. The application of an shRNA that inhibits REXO2 expression in the preparation of a drug for treating glioblastoma, characterized in that: The shRNA sequence is either shREXO2-1 as shown in SEQ ID NO.1-2 or shREXO2-6 as shown in SEQ ID NO.3-4.
5. The application according to claim 4, characterized in that: The shRNA achieves its therapeutic effect on glioblastoma by inhibiting the clonogenic ability of glioblastoma cells.
6. The application according to claim 5, characterized in that: The cell line of the glioblastoma is U251.