SNP (Single Nucleotide Polymorphism) marker related to intramuscular fat content character of Rongchang pig, detection primer and application

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) marker related to intramuscular fat content characters of Rongchang pigs, a detection primer and application, and belongs to the technical field of molecular biology. The invention develops an SNP marker related to the intramuscular fat content character of Rongchang pigs and a detection primer based on an SNP marker technology. The SNP marker developed by the invention is located at the 121626638bp position on the No.7 chromosome of the Rongchang pig and relates to C / T mutation, and when the genotype is CT, the intramuscular fat content of the Rongchang pig is obviously higher than that of the TT genotype. Individuals with excellent intramuscular fat content can be screened out through the SNP marker, so that the level of the intramuscular fat content character of the Rongchang pigs is improved, and the breeding process of new varieties is accelerated.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a SNP marker associated with the intramuscular fat content trait of Rongchang pigs, a detection primer and an application thereof. Background Art

[0002] In modern animal husbandry, the quality characteristics of pork directly affect the market value and consumer satisfaction, especially the intramuscular fat (IMF) content. IMF content not only determines the flavor, tenderness and juiciness of meat, but is also closely related to consumers' preference for meat products. With the improvement of living standards, consumers' demand for high-quality pork is increasing. Therefore, the research and improvement of IMF content has become a key issue in the pig industry. Studies have shown that the formation of IMF is affected by a variety of genetic factors. These genetic factors can be identified by single nucleotide polymorphism (SNP) molecular markers, especially gene loci that are closely related to meat quality characteristics. SNP markers are regarded as an effective tool for predicting and selecting excellent meat quality characteristics. By identifying SNPs related to IMF content, farmers can more effectively screen individuals with excellent genetic characteristics during the breeding process, thereby significantly improving the efficiency of breeding and reducing the time cost and economic risks brought by traditional methods.

[0003] As a high-quality local breed unique to China, Rongchang pig has attracted widespread attention in the market in recent years due to its high IMF content and unique flavor. Its excellent meat quality makes it highly competitive in the market, but traditional breeding methods are difficult to quickly meet the demand for high-quality meat products. Therefore, genetic improvement of Rongchang pigs combined with modern molecular marker technology has become an important means to improve its meat quality and market competitiveness. Summary of the invention

[0004] In order to solve the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a SNP marker and detection primers related to the intramuscular fat content trait of Rongchang pigs, so as to provide a new SNP marker for rapid selection of genetic improvement of Rongchang pigs with high intramuscular fat content.

[0005] The technical solution of the present invention to solve the above technical problems is as follows: a SNP marker related to the intramuscular fat content trait of Rongchang pigs is provided, and the SNP marker is located at 121626638bp on chromosome 7 of Rongchang pigs; the nucleotide sequence of the gene where the SNP marker is located is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0006] Furthermore, Rongchang pig is a purebred Rongchang pig.

[0007] Furthermore, the SNP marker is located at the 206th bp of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2; and the genotype of the SNP marker is CT or TT.

[0008] The present invention provides a primer composition for detecting the above-mentioned SNP marker, comprising an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID NO.3; the nucleotide sequence of the downstream primer R is shown in SEQ ID NO.4.

[0009] The present invention provides an application of the above SNP marker in determining the intramuscular fat content of Rongchang pigs, improving the intramuscular fat content of Rongchang pigs or genetic breeding of Rongchang pigs. The present invention provides a method for detecting the intramuscular fat content of Rongchang pigs, comprising the following steps: (1) Extracting genomic DNA from Rongchang pigs to be tested; (2) using the genomic DNA of the Rongchang pig to be tested as a template, and performing PCR amplification using the primer combination described in claim 4 to obtain a PCR product; (3) Sequencing the PCR product and analyzing the genotype of the SNP marker; if its genotype is CT, the intramuscular fat content of the Rongchang pig to be tested is determined to be high fat content; if its genotype is TT, the intramuscular fat content of the Rongchang pig to be tested is determined to be low fat content.

[0010] Furthermore, the PCR amplification system includes: SYBR, upstream primer F, downstream primer R, DNA template and RNase Free H2O; the PCR amplification program is: 98°C pre-denaturation for 3 minutes, 1 cycle; 98°C denaturation for 10 seconds, 55-65°C annealing for 20-30 seconds, 72°C extension for 30 seconds / kb, 23-35 cycles; 72°C final extension for 1-5 minutes, 1 cycle; 4°C insulation.

[0011] The present invention provides a method for genetic improvement of the intramuscular fat content trait of Rongchang pigs, comprising the following steps: using the above-mentioned primer combination to perform PCR amplification on the genomic DNA of the Rongchang pigs to be tested, analyzing the genotype of the SNP marker of the Rongchang pigs to be tested, and determining Rongchang pigs with high / low intramuscular fat content according to their genotypes for subsequent production.

[0012] The present invention provides a breeding method for Rongchang pigs with high intramuscular fat content, comprising the following steps: adopting the method for genetic improvement of the intramuscular fat content trait of Rongchang pigs, and selecting Rongchang pigs with a SNP marker genotype of CT for subsequent production.

[0013] The present invention also provides a kit for detecting the intramuscular fat content of Rongchang pigs, comprising the above primer combination.

[0014] The present invention has the following beneficial effects: Based on the SNP marker technology, the present invention has developed a SNP marker and detection primer related to the intramuscular fat content trait of Rongchang pigs. The SNP marker developed by the present invention is located at 121626638 bp on chromosome 7 of the pig reference genome version 11.1, involving a C / T mutation. When the genotype is CT, the intramuscular fat content of Rongchang pork is significantly higher than that of the TT genotype. The SNP marker of the present invention can be used to screen out individuals with excellent intramuscular fat content, thereby improving the level of the intramuscular fat content trait of Rongchang pigs, and can be used for early judgment of the IMF content trait of Rongchang pigs, accelerating the breeding process of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the Manhattan plot of IMF content trait of Rongchang pig in GWAS analysis; Figure 2 This is a histogram of the IMF content of the SNP locus in 485 Rongchang pigs. DETAILED DESCRIPTION

[0016] The following examples are only used to explain the present invention and are not intended to limit the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0017] Example 1 Obtaining SNP markers related to intramuscular fat content in Rongchang pigs (1) Sample collection and acquisition of IMF phenotypic data: A total of 485 purebred Rongchang pig samples were collected from the Rongchang Pig National Breeding Farm in Rongchang District, Chongqing, and the phenotypic data of their IMF content were collected.

[0018] (2) Sample processing and IMF content determination: The test pigs were slaughtered when they grew to 180±5 days and sent to the slaughterhouse for unified slaughter. The longissimus dorsi muscle at the 6th to 12th ribs of Rongchang pigs was collected, 25g of the longissimus dorsi muscle was weighed, and placed in a freeze dryer to dehydrate to constant weight. Use quantitative filter paper to dry until the weight is stable, use a precision balance to weigh the dried filter paper, then weigh 3g of the dry sample and wrap it with filter paper. The fat bag was placed in a Soxhlet extractor and refluxed with anhydrous ether for 9 hours. After the extraction, the fat bag was dried again until the weight was stable. The IMF content was calculated according to the following formula: IMF=(m2-m3) / (m2-m1)×100% Among them: m1 is the weight of the dried filter paper; m2 is the weight of the fat package; m3 is the weight of the fat package after extraction).

[0019] (3) Rongchang pig DNA extraction and quality inspection: The whole genome DNA of each ear tissue sample was extracted using a DNA extraction kit (DNA Mini Kit). The DNA quality was tested by Nanodrop 2000 spectrophotometer and 1% agarose gel electrophoresis. The qualified standards were concentration>100ng / μL, OD260 / 280 ratio between 1.8-2.0, A260 / 230 ratio between 1.7-1.9, and clear gel electrophoresis bands without degradation. The samples were uniformly diluted to 50ng / μL for subsequent experiments.

[0020] (4) Gene chip typing test: Liquid phase 66K chip was used to perform genotyping on 485 Rongchang pigs. Plink (v1.90) software was used for data quality control. The quality control conditions included: eliminating loci without chromosome position information, X and Y chromosome loci, individual SNP detection rate>90%, SNP locus detection rate>95%, and finally retaining 485 individuals and 64,249 SNP loci for subsequent analysis.

[0021] (5) Whole genome resequencing and data processing: 120 Rongchang pigs from the core group were selected for 30× whole genome sequencing, and FastQC software was used for quality assessment. The cleaned data (clean reads) were aligned with the pig reference genome (Sscrofa11.1) using BWA software. SAM files were converted to BAM files using SAMtools, and PCR duplicates were removed using Picard's markdup program. GATK software was used for SNP site calling, and quality control was performed according to quality standards. MAF ≥ 0.05 and missing rate < 10 were used in subsequent analysis. -6 , autosomal SNP sites with a read depth ≥ 6 were used as genotype filling references, and finally 27,133,287 SNP sites were retained.

[0022] (6) Genotype filling: Beagle5.1 software was used to fill genotypes of 66K gene chip data of 485 Rongchang pigs based on the whole genome resequencing data of 120 Rongchang pigs. To evaluate the filling accuracy, the whole genome data of 30 Rongchang pigs were randomly selected for comparison, the filling accuracy was calculated, and SNPs with an accuracy of 1.00 and MAF ≥ 0.01 were retained for data analysis.

[0023] (7) Genome-wide association analysis (GWAS): A univariate mixed model of GEMMA software was used to conduct GWAS analysis on the IMF content trait of Rongchang pigs. The principal components (sex, weight, age, etc.) were added to the model as covariates for correction. The significance threshold was the Bonferroni-corrected P value ( P=0.05 / N, N is the number of SNPs) and took the logarithm -log10. The collected pork IMF phenotypic traits were subjected to genome-wide association analysis, and the significantly associated SNP sites were calculated.

[0024] Depend on Figure 1 It can be seen that the C / T site mutation at 121626638bp on chromosome 7 of Rongchang pig is significantly associated with IMF content ( p =4.38×10 -9 ). In 485 Rongchang pig populations, the molecular marker at chr7:121626638 was found to have a significant phenotypic effect. Figure 2 As shown in Table 1, there are two genotypes of chr7:121626638 in the Rongchang pig population: CT and TT. The average IMF content of CT-type Rongchang pigs is about 0.056; the average IMF content of TT-type Rongchang pigs is about 0.037. The unpaired t-test analysis shows that the IMF content of CT-type Rongchang pigs is significantly different from that of TT-type Rongchang pigs ( p< 0.0001).

[0025] Table 1 Determination of phenotypic values ​​of IMF content in 485 Rongchang pigs

[0026] Example 2 Primer design and screening verification of SNP markers associated with IMF content in Rongchang pigs After the target SNP marker (chr7:121626638) was screened and obtained in Example 1, the gene sequence where the SNP site was located was extracted, and the specific primers of the SNP marker were designed and synthesized, and then the SNP marker was screened and tested, as follows: (1) After obtaining the target SNP marker (chr7:121626638), the reference genome is Sus Scrofa 11.1, and the sequence of 400 bp before and after the gene containing the SNP marker is extracted. The specific nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2. Primer Premier 6 is used to design specific primers for the SNP marker. The nucleotide sequences of the upstream primer F and the downstream primer R are as follows: F: 5'-CGTGTGTGTGTTGGGACTCA-3' (SEQ ID NO.3); R: 5'-GAAGGAGCTGAGAGGTTGGG-3' (SEQ ID NO. 4).

[0027] (2) Fifty purebred Rongchang pigs at 35 days of age were randomly selected from the Rongchang Pig National Seed Farm in Rongchang District, Chongqing City to verify the application effect of the specific primers designed for the SNP marker on the early prediction of IMF content in Rongchang pigs. Ear samples of 50 Rongchang pigs to be tested were collected, genomic DNA was extracted as a template, and the DNA was diluted to 100 ng / μL; the specific primers were diluted to 10 μmol / L, and PCR amplification was performed using the specific primers to obtain PCR products; wherein the amplification system is shown in Table 2, and the amplification procedure is shown in Table 3. The PCR products of the Rongchang pigs to be tested were purified and recovered by electrophoresis on 2% agarose, and the genotypes of the polymorphic sites of the Rongchang pig SNP marker were analyzed by sequencing results. The sequencing results showed that among the 50 Rongchang pigs to be tested, 8 had a genotype of CT and 42 had a genotype of TT.

[0028] Table 2 Amplification system

[0029] Table 3 Amplification procedures

[0030] (3) The 50 Rongchang pigs to be tested were slaughtered when they reached 6 months of age, and the IMF content was measured (see step 2 of Example 1 for the specific method). The IMF content was compared with the IMF content predicted based on the genotype at 35 days of age to verify the effectiveness of SNP markers in the early judgment of the IMF content trait of Rongchang pigs and the application of IMF content trait evaluation.

[0031] The results are shown in Table 4. Among the 50 tested Rongchang pigs, the IMF content of Rongchang pigs with genotype CT was higher than that of Rongchang pigs with genotype TT, and the difference was significant ( p< 0.0001), indicating that the primers designed for this SNP marker have practical significance in the early prediction of IMF content in Rongchang pigs.

[0032] Table 4 Genotypes and corresponding IMF content of 50 Rongchang pigs tested

[0033] The nucleotide sequence of the gene where the SNP marker of the present invention is located is as follows: 1.TTGAGAATTCTACCCAACACCCTCTGCATCTGAGTATTTCCAAGCCGTTGGGTGGAAATAGACATGGGTCCCAGGCCCGTGTGTGTGTTGGGACTCACTCTTCGCTCTCCTCGTTTTGAATGGCGTGAGGGTTTTGTTGTTGTTGTTTTATTCTTGGGTTTCAGCAACTACCAACCTCAGCTGGTTTTCCCCAGAAGGGCA CTGTCAGTCCTCTGCTGGGGACACGGGGGACCCTGTGCCGCCCTCCAGGGCCTTCTTTCCCCTGGCGGAACTCCTCTAGGCACTCTAGTGGCCTTGGTGTCCCCAACCTCTCAGCTCCTTCCTGGACTCGGGGCCCTTCAGGGGCCGCCCCAGCCCCCATCCCTGCCCCACAGCCCGGAGGGCTCCCAAGGAAGG (SEQ ID NO.1); 2.TTGAGAATTCTACCCAACACCCTCTGCATCTGAGTATTTCCAAGCCGTTGGGTGGAAATAGACATGGGTCCCAGGCCCGTGTGTGTTGTGGGACTCACTCTTCGCTCTCCTCGTTTTGAATGGCGTGAGGGTTTTGTTGTTGTTGTTTTATTCTTGGGTTTCAGCAACTACCAACCTCAGCTGGTTTTCCCCAGAAGGGCA CTGTTAGTCCTCTGCTGGGGACACGGGGGACCCTGTGCCGCCCTCCAGGGCCTTCTTTCCCCTGGCGGAACTCCTCCTAGGCACTCTAGTGGCCTTGGTGTCCCAACCTCTCAGCTCCTCTCCTGGACTCGGGGCCCTTCAGGGGCCGCCCCAGCCCCCATCCCTGCCCCACAGCCCGGAGGGCTCCCAAGGAAGG (SEQ ID NO.2).

[0034] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A SNP marker associated with the intramuscular fat content trait of Rongchang pigs, characterized in that: The SNP marker is located at 121626638bp on chromosome 7 of Rongchang pig; the nucleotide sequence of the gene where the SNP marker is located is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. The SNP marker according to claim 1, characterized in that The Rongchang pig is a purebred Rongchang pig.

3. The SNP marker according to claim 1 or 2, characterized in that The SNP marker is located at the 206th bp of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2; the genotype of the SNP marker is CT or TT.

4. A primer composition for detecting a SNP marker according to any one of claims 1 to 3, characterized in that: It comprises an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID NO.3; the nucleotide sequence of the downstream primer R is shown in SEQ ID NO.

4.

5. Use of the SNP marker according to any one of claims 1 to 3 in determining the intramuscular fat content of Rongchang pigs, improving the intramuscular fat content of Rongchang pigs, or in genetic breeding of Rongchang pigs.

6. A method for detecting the intramuscular fat content of Rongchang pigs, characterized in that: The following steps are involved: (1) Extracting genomic DNA from Rongchang pigs to be tested; (2) using the genomic DNA of the Rongchang pig to be tested as a template, and performing PCR amplification using the primer combination described in claim 4 to obtain a PCR product; (3) Sequencing the PCR product and analyzing the genotype of the SNP marker; if its genotype is CT, the intramuscular fat content of the Rongchang pig to be tested is determined to be high fat content; if its genotype is TT, the intramuscular fat content of the Rongchang pig to be tested is determined to be low fat content.

7. The method for detecting the intramuscular fat content of Rongchang pigs according to claim 6, characterized in that: The PCR amplification system includes: SYBR, upstream primer F, downstream primer R, DNA template and RNase Free H2O; the PCR amplification program is: 98°C pre-denaturation for 3 minutes, 1 cycle; 98°C denaturation for 10 seconds, 55-65°C annealing for 20-30 seconds, 72°C extension for 30 seconds / kb, 23-35 cycles; 72°C final extension for 1-5 minutes, 1 cycle; 4°C insulation.

8. A method for genetically improving the intramuscular fat content trait of Rongchang pigs, characterized in that: The following steps are involved: The genomic DNA of the Rongchang pig to be tested is amplified by PCR using the primer combination described in claim 4, the genotype of the SNP marker of the Rongchang pig to be tested is analyzed, and the Rongchang pig with high / low intramuscular fat content is determined according to its genotype for subsequent production.

9. A method for breeding Rongchang pigs with high intramuscular fat content, characterized in that: The method comprises the following steps: adopting the method described in claim 8 to select Rongchang pigs whose SNP marker genotype is CT for subsequent production.

10. A kit for detecting the intramuscular fat content of Rongchang pigs, characterized in that: Comprising the primer composition described in claim 4.

Images