Antimicrobial peptide CL18 and its application
By providing antimicrobial peptide CL18 and its homologous polypeptides, the drug abuse and drug resistance problems of Salmonella infection are solved, and the effect of effectively inhibiting bacteria and promoting livestock and poultry health is achieved at low concentrations.
Patent Information
- Application Number
- CN202411989474.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2044-12-31
AI Technical Summary
The prior art has problems with drug abuse, drug resistance and drug residues in the treatment of salmonella infections, and it is urgent to find alternative prevention and control solutions.
An antibacterial peptide CL18 and its homologous polypeptide are provided. The amino acid sequence is shown in SEQ ID NO.1 and has broad-spectrum antibacterial activity. It is used to inhibit Salmonella and prepare it into antibacterial drugs, feed additives or preservatives, combining pharmaceutical active agents and nutritional components.
The antibacterial peptide CL18 effectively inhibits salmonella at low concentrations, avoids the influence of drug resistance, and is applied to antibacterial drugs and feed compositions to promote the healthy development of livestock and poultry.
Smart Images

Figure CN119775364B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular biotechnology, and in particular relates to an antimicrobial peptide CL18 and an application thereof. Background Art
[0002] Salmonella is the most common zoonotic pathogen in the Enterobacteriaceae family, commonly parasitizing the intestines of animals and humans. Its hosts include humans and various animals, with poultry being the primary animal. Salmonella is a major foodborne bacterium that causes human infection. Food poisoning caused by Salmonella is the most common and widespread of all bacterial food poisonings, accounting for approximately 42.6% to 60% of bacterial food poisoning cases. The most common sources of Salmonella infection include cut fruit, unclean vegetables, and raw food. Raw meat and eggs are particularly important sources of infection.
[0003] Salmonella treatment in China and abroad typically uses antimicrobial drugs to mitigate its harmful effects. However, there is considerable confusion regarding the choice of drug type, route of administration, method, dosage, and duration of administration, leading to a considerable degree of blindness and widespread misuse and waste. Furthermore, long-term, repeated use of these drugs not only increases treatment costs but also leads to a series of problems, including increased bacterial resistance and drug residues in livestock and poultry products. Relying solely on drug control has proven to be an inadequate strategy for preventing and controlling Salmonella. With the current widespread prevalence of broadly drug-resistant Salmonella (such as Indiana, Salmonella Typhimurium, and Kentucky), and the implementation of policies prohibiting and restricting the use of antibiotics, the search for alternative antibiotic prevention and control options is urgent.
[0004] Antimicrobial peptides (AMPs) are small polypeptides composed of multiple amino acids and are an important component of the body's innate immune defense system. Previous studies have shown that AMPs possess broad-spectrum antibacterial, antiviral, antifungal, antiparasitic, and immunomodulatory biological activities. Currently, several AMP-based drugs have entered clinical trials, demonstrating promising application prospects. This present invention aims to provide an AMP that effectively inhibits Salmonella, laying the foundation for the development of novel drugs to prevent and block Salmonella infections. Summary of the Invention
[0005] The purpose of this section is to summarize some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the abstract and title of this application to avoid obscuring the purpose of this section, the abstract and the title of the invention, and such simplifications or omissions should not be used to limit the scope of the present invention.
[0006] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.
[0007] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide an antimicrobial peptide CL18.
[0008] To solve the above technical problems, the present invention provides the following technical solution: the amino acid sequence of the antimicrobial peptide CL18 is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2.
[0009] Furthermore, the antimicrobial peptide also includes a polypeptide having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% homologous to the polypeptide as shown in SEQ ID NO. 1 and having antimicrobial activity.
[0010] It should be noted that homology in the present invention refers to the "sequence identity" between two amino acid sequences, that is, the percentage of identical amino acids between the sequences. Methods for assessing the degree of sequence identity between amino acids or nucleotides are known to those skilled in the art. For example, amino acid sequence identity is typically measured using sequence analysis software. For example, it can be determined using the BLAST program in the NCBI database.
[0011] The above-mentioned polypeptides have 70%, 75%, 80%, 85%, 90%, 95%, 99% or more (such as 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8% or more, or even 99.9% or more) homology with the polypeptide shown by the antimicrobial peptide CL18 and have antibacterial activity, and their active sites, active pockets, active mechanisms, polypeptide structures, etc. are most likely the same as those of the antimicrobial peptide CL18.
[0012] Those skilled in the art may also perform conservative substitutions on amino acids according to amino acid substitution rules well known to those skilled in the art, such as the "blosum62 scoring matrix" in the prior art.
[0013] Conservative amino acid substitutions or replacements are well known in the art. For example, conservative amino acid substitutions preferably involve replacing one amino acid residue from the following groups (1)-(5) with another amino acid from the same group: (1) smaller aliphatic non-polar or weakly polar residues: Ala, Ser, Thr, Pro, and Gly; (2) polar negatively charged residues and their (uncharged) amides: CL, Asn, Glu, and Gln; (3) polar positively charged residues: His, Arg, and Lys; (4) larger aliphatic non-polar residues: Met, Leu, Ile, Val, and Cys; and (5) aromatic residues: Phe, Tyr, and Trp. Particularly preferred conservative amino acid substitutions are as follows: Ala is substituted by Gly or Ser; Arg is substituted by Lys; Asn is substituted by Gln or His; CL is substituted by Glu; Cys is substituted by Ser; Gln is substituted by Asn; Glu is substituted by CL; Gly is substituted by Ala or Pro; His is substituted by Asn or Gln; Ile is substituted by Leu or Val; Leu is substituted by Ile or Val; Lys is substituted by Arg, Gln or Glu; Met is substituted by Leu, Tyr or Ile; Phe is substituted by Met, Leu or Tyr; Ser is substituted by Thr; Thr is substituted by Ser; Trp is substituted by Tyr; Tyr is substituted by Trp or Phe; and Val is substituted by Ile or Leu.
[0014] In the present invention, the preparation method of the antimicrobial peptide is not strictly limited. For example, it can be prepared by artificial synthesis, or the corresponding gene sequence can be obtained by bioinformatics means based on the amino acid sequence, and the antimicrobial peptide with the corresponding amino acid sequence can be obtained by expressing the gene sequence.
[0015] As used herein, the terms "antimicrobial peptide," "antimicrobial polypeptide," "antimicrobial protein," and "antimicrobial protein" are synonymous and are used herein to refer to polymers of amino acid residues that possess antimicrobial, bacteriostatic, or bactericidal function. The term applies to amino acid polymers in which one or more amino acid residues is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. Unless otherwise indicated, a particular polypeptide sequence also implicitly encompasses conservatively modified variants thereof.
[0016] The term "amino acid" refers to the twenty common naturally occurring amino acids. Naturally occurring amino acids include alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine (C); glutamic acid (E), glutamine (Q), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y), and valine (V).
[0017] Another object of the present invention is to provide the use of the antimicrobial peptide CL18 in inhibiting Salmonella.
[0018] As a preferred embodiment of the use of the antimicrobial peptide CL18 in the present invention for inhibiting Salmonella, the Salmonella includes Salmonella enterica and Salmonella bongori;
[0019] Among them, the enteric Salmonella includes enteric Salmonella subsp. enterica (S. enterica subsp. enterica), enteric Salmonella subsp. salamae (S. enterica subsp. salamae), enteric Salmonella subsp. arizonae (S. enterica subsp. arizonae), enteric Salmonella subsp. diarizonae (S. enterica subsp. houtenae), and enteric Salmonella subsp. indica (S. enterica subsp. indica).
[0020] As a preferred embodiment of the use of the antimicrobial peptide CL18 of the present invention in inhibiting Salmonella, the minimum inhibitory concentration of the antimicrobial peptide CL18 against Salmonella enterica subspecies is 64 μg / ml; the minimum inhibitory concentration against Salmonella enterica subspecies is 32 μg / ml; the minimum inhibitory concentration against Salmonella enterica subspecies is 32 μg / ml; the minimum inhibitory concentration against Salmonella enterica subspecies is 32 μg / ml; the minimum inhibitory concentration against Salmonella enterica subspecies is 64 μg / ml; the minimum inhibitory concentration against Salmonella enterica subspecies is 32 μg / ml; the minimum inhibitory concentration against Salmonella bongori is 64 μg / ml.
[0021] Another object of the present invention is to provide an antibacterial pharmaceutical composition.
[0022] To solve the above technical problems, the present invention provides the following technical solution: the antimicrobial pharmaceutical composition comprises the antimicrobial peptide CL18 or its homologues and a pharmaceutically active agent or other pharmaceutically acceptable excipients.
[0023] Specifically, in some embodiments, when the composition is an antimicrobial drug, the compositions described herein include, in addition to the aforementioned antimicrobial peptides, other components, such as physiologically / pharmaceutically acceptable carriers and excipients. The purpose of the composition is to facilitate administration to an organism, facilitating the absorption of the active ingredient and thereby exerting its biological activity. In this disclosure, the terms "composition" and "preparation" are not mutually exclusive.
[0024] As a preferred embodiment of the antibacterial drug composition of the present invention, the drug is an anti-Salmonella drug.
[0025] As a preferred embodiment of the antibacterial pharmaceutical composition of the present invention, the pharmaceutically active agent includes an antibiotic.
[0026] Types of antibiotics include penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc.
[0027] Penicillins combined with β-lactamase inhibitors, cephalosporins (e.g., cefaclor, cefazolin, cefuroxime, and ramoxef); carbapenems; monobactams; aminoglycosides; tetracyclines; macrolides; lincomycins; polymyxins; sulfonamides; quinolones; chloramphenicol; metronidazole; spectinomycin; trimethoprim; and vancomycin.
[0028] The pharmaceutically active agent may also be an anti-mycotic agent, including polyene compounds, such as amphotericin B, nystatin; 5-flucosyn;
[0029] and azoles, such as miconazole, ketoconazole, itraconazole, and fluconazol.
[0030] As a preferred embodiment of the antibacterial pharmaceutical composition of the present invention, the dosage form of the antibacterial pharmaceutical composition includes an injection, preferably a sodium chloride injection.
[0031] In some embodiments, when delivering the composition to animals (eg, poultry), a variety of delivery systems are known and can be used to administer the composition. Methods of introduction include, but are not limited to, eye drops, intranasal, and oral routes.
[0032] Another object of the present invention is to provide a feed composition.
[0033] In order to solve the above technical problems, the present invention provides the following technical solution: the feed composition comprises the antimicrobial peptide CL18 or its homologues and feed components or other nutritionally acceptable supplementary materials.
[0034] The antimicrobial peptides in the feed composition herein can be used in combination with one or more of the following: a nutritionally acceptable carrier, a nutritionally acceptable diluent, a nutritionally acceptable excipient, a nutritionally acceptable adjuvant, or a nutritionally active ingredient, specifically, for example, proteins, peptides, sucrose, lactose, sorbitol, glycerol, propylene glycol, sodium chloride, sodium sulfate, sodium acetate, sodium citrate, sodium formate, sodium sorbate, potassium chloride, potassium sulfate, potassium acetate, potassium citrate, potassium formate, potassium acetate, potassium sorbate, magnesium chloride, magnesium sulfate, magnesium acetate, magnesium citrate, magnesium formate, magnesium sorbate, sodium metabisulfite, methylparaben, and propylparaben.
[0035] In some embodiments, the feed composition can be fodder or a premix thereof, or a compound feed or a premix thereof. The feed additive can be mixed with a compound feed, a compound feed component, or mixed into a compound feed premix, or mixed into fodder, a fodder component, or a fodder premix. The feed composition includes the feed component, and the feed component and the antimicrobial peptide together constitute the feed composition.
[0036] In some embodiments, the antimicrobial peptides of the present invention are mixed with a feed component to form a feed. As used herein, "feed component" means all or part of a feed. A portion of a feed can refer to one component of a feed or more than one (e.g., two or three or four or more) components of a feed. In one embodiment, the term "feed component" encompasses a premix or a premix ingredient.
[0037] Any feed described herein may comprise one or more feed materials selected from the group consisting of
[0038] a) Cereals, such as small grain cereals (e.g., wheat, barley, rye, oats, triticale, and combinations thereof) and / or large grain cereals such as maize or sorghum;
[0039] b) by-products from cereals, such as corn gluten meal, wetcake (especially corn-based wetcake), distillers dried grains (DDG) (especially corn-based distillers dried grains (cDDG)), distillers dried grains with solubles (DDGS) (especially corn-based distillers dried grains with solubles (cDDGS)), wheat bran, semolina, wheat short meal, rice bran, rice hulls, oat hulls, palm kernels and citrus pulp;
[0040] c) Proteins obtained from sources such as soy, sunflower, peanut, lupin, pea, bean, cotton, canola, fish meal, dried plasma protein, meat and bone meal, potato protein, whey, copra, sesame;
[0041] d) oils and fats of vegetable and animal origin;
[0042] e) Minerals and vitamins.
[0043] Another object of the present invention is to provide a preservative composition.
[0044] In order to solve the above technical problems, the present invention provides the following technical solution: the preservative composition comprises the antimicrobial peptide CL18 or its homologues.
[0045] Beneficial effects of the present invention:
[0046] The antimicrobial peptides of the present invention have strong antibacterial properties and can exert antibacterial effects even at relatively low concentrations. Furthermore, they are unaffected by Salmonella drug resistance and exhibit significant inhibitory effects against Salmonella, effectively preventing and controlling salmonellosis. The preparation of the antimicrobial peptides of the present invention into antimicrobial drugs, feed additives, or feedstuffs is of great significance for the healthy development of the livestock and poultry farming industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort. Among them:
[0048] Figure 1 This is a high performance liquid chromatography analysis chart of the antimicrobial peptide CL18.
[0049] Figure 2 This is the liquid chromatography-mass spectrometry analysis diagram of the antimicrobial peptide CL18. DETAILED DESCRIPTION
[0050] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.
[0051] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.
[0052] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive of other embodiments.
[0053] The amino acid sequence of the antimicrobial peptide CL18 of the present invention is shown in SEQ ID NO.1:
[0054] SEQ ID NO.1: Phe Val Phe Leu Lys Lys Pro Ala Phe MetLys Lys ArgPro PheLys His Leu
[0055] The nucleotide sequence of the antimicrobial peptide CL18 of the present invention is shown in SEQ ID NO.2:
[0056] SEQ ID NO.2:TTTGTGTTTCTAAAAAAACCTGCTTTTATGAAAAAGCGGCCATTCAAACATTTGTGA
[0057] Among them, G is guanine, A is adenine, T is thymine, and C is cytosine. SEQ ID NO.2 contains a total of 57 nucleotides. Every 3 nucleotides can be translated into 1 amino acid. The TGA position at the end of the sequence is the stop codon. SEQ ID NO.1 is obtained by translating SEQ ID NO.2.
[0058] Example 1 Synthesis and characterization of antimicrobial peptides
[0059] Feces of healthy green-shell laying hens were collected and the antimicrobial peptide CL18 of the present invention was obtained by metagenomic sequencing screening. The antimicrobial peptide CL18 was chemically synthesized (linear peptide solid phase synthesis) by Shanghai Sangon Biotechnology according to the sequence SEQ ID NO.1. The results were analyzed by high performance liquid chromatography and liquid chromatography-mass spectrometry. Figure 1 、 Figure 2 And shown in Table 1.
[0060] Table 1
[0061] Peak# Ret.Time Area Height Area% Height % 1 10.839 602163 20131 1.413 1.149 2 11.503 88205 8164 0.207 0.466 3 11.824 40830987 1644318 95.794 93.832 4 12.754 505120 38557 1.185 2.200 5 13.114 355653 20067 0.834 1.145 6 13.858 138538 11616 0.325 0.663 7 14.174 72965 6190 0.171 0.353 8 14.568 30061 3363 0.071 0.192 Total 42623692 1752406 100.000 100.000
[0062] Figure 1 Table 1 is a peak information table obtained from the HPLC analysis chart of the sequence synthesis. The results show that a total of five peaks were detected, with the main peak retention time of 11.824 minutes, accounting for 95.794% of the peak area, indicating that the purity of the target polypeptide is relatively high.
[0063] Figure 2 The liquid chromatography-mass spectrometry analysis chart synthesized for the sequence showed that the detected multiply charged ions matched the theoretical molecular weight well, and the measured values were close to the theoretical values, indicating that the target polypeptide of the sample was accurate.
[0064] The above results indicate that the antimicrobial peptide CL18 has been accurately synthesized, freeze-dried and stored at -80°C until use.
[0065] Example 2 Minimum inhibitory concentration (MIC) detection of antimicrobial peptides
[0066] The minimum inhibitory concentrations of different antimicrobial peptides were compared. The sequences of the antimicrobial peptides are shown in Table 2.
[0067] Table 2
[0068] antimicrobial peptides Amino acid sequence CL18 FVFLKKPAFMKKRPFKHL CL14 KPYKKILNHLGITG CL23 QRLLKTVAPRRYPILKSPHCQRK CL12 KSLISLKISLFI CL16 SINLHTAIRSFHLFWR
[0069] Salmonella enteritidis ATCC13076 was cultured in MH broth at 37°C until the logarithmic phase, and then the bacterial suspension was diluted to a final concentration of 1×10 7 CFU / mL;
[0070] 100 μL of the antimicrobial peptides of different concentrations shown in Table 2 was mixed with 100 μL of bacterial solution and added to a 96-well plate. After incubation at 37°C for 16 h, the plate was observed for turbidity under a light source to obtain the MIC (Minimum Inhibitory Concentration) of the different antimicrobial peptides. All experimental groups were repeated three times to determine the final results (MIC). The results are shown in Table 3.
[0071] Table 3 Minimum inhibitory concentration (MIC) detection of antimicrobial peptides
[0072] antimicrobial peptides MIC value CL18 32 μg / ml CL14 >1024 μg / ml CL23 256 μg / ml CL12 1024 μg / ml CL16 >1024 μg / ml
[0073] It can be seen that among the five antimicrobial peptides, three have obvious antibacterial effects, among which the MIC value of CL18 is 32 μg / ml, which is significantly better than that of the other peptides. Therefore, CL18 was further analyzed and tested.
[0074] Example 3 In vitro antibacterial assay of antimicrobial peptide CL18 against different Salmonella species
[0075] Different Salmonella species (subspecies) reference strains, including ATCC 13076, ATCC 14028, ATCC 43972, ATCC 13314, ATCC 12325, ATCC 43974, ATCC 43976, and ATCC 43975, were selected to test the in vitro antibacterial activity of the antimicrobial peptide CL18 against these different Salmonella species (subspecies). The results are shown in Table 4.
[0076] Table 4 In vitro antibacterial test of antimicrobial peptide CL18
[0077]
[0078]
[0079] As can be seen from Table 4, the MIC values of CL18 against different species (subspecies) of Salmonella ranged from 32 to 64 μg / ml, and the minimum bactericidal concentration (MBC) values ranged from 64 to 256 μg / ml, indicating that CL18 had good antibacterial activity.
[0080] Example 4 Cytolytic Hemolytic Safety Experiment of Antimicrobial Peptide CL18
[0081] Blood from healthy adult chickens was collected and centrifuged at 1500g for 5 minutes at 4°C. The obtained red blood cells were washed with PBS solution until colorless and transparent, and diluted with PBS solution to a red blood cell concentration of 2%. After that, an equal volume of antimicrobial peptide CL18 was added (the final concentration in PBS ranged from 0.5 to 200 μg / mL). After incubation at 37°C for 60 minutes, the absorbance value was measured at 570 nm using a microplate reader. Red blood cells treated with 0.1% Triton X-100 and red blood cells treated with an equal volume of PBS were used as positive and negative controls, respectively. Three replicates were performed for each treatment group, and the degree of hemolysis was calculated according to the following formula:
[0082] Hemolysis rate (%) = (absorbance of test tube - absorbance of negative control tube) / (absorbance of positive control tube - absorbance of negative control tube) × 100%.
[0083] Testing found that when the concentration of antimicrobial peptide CL18 was in the range of 0.5 to 200 μg / mL, the cell hemolysis rate was less than 10%. Even when the concentration was 200 μg / mL, the cell hemolysis rate was only about 8.5%, which shows that the antimicrobial peptide CL18 has good safety.
[0084] Example 5 Animal Experiments on Antimicrobial Peptide CL18
[0085] To verify the application prospect of antimicrobial peptide CL18 in the prevention and treatment of salmonellosis, an injection containing antimicrobial peptide CL18 was prepared in this example. The injection contained 200 μg / mL antimicrobial peptide CL18 in sodium chloride (0.9 g / mL) injection.
[0086] Healthy 21-day-old chickens were randomly divided into a control group (injected with normal saline), a streptomycin group, and an antimicrobial peptide CL18 group. Each group received a 500 μL injection of 200 μg / mL streptomycin, with 10 chickens in each group. Following the injections, the experimental groups were infected with Salmonella, and the number of surviving chickens was counted. The results are shown in Table 5.
[0087] Table 5 Preventive and therapeutic effects of antimicrobial peptide CL18 injection
[0088] Group 24-hour survival rate 48-hour survival rate 72-hour survival rate Antimicrobial peptide CL18 group 100% 80% 80% Streptomycin group 100% 90% 80% control group 70% 50% 40%
[0089] As can be seen from Table 5, compared with streptomycin, the antimicrobial peptide CL18 can also achieve similar preventive and therapeutic effects and can be used for clinical prevention and treatment.
[0090] In summary, the present invention discloses the antimicrobial peptide CL18 and its applications. The amino acid sequence of the antimicrobial peptide CL18 is shown in SEQ ID NO. 1. The antimicrobial peptide of the present invention exhibits strong antibacterial activity, exerting an antimicrobial effect even at relatively low concentrations. Furthermore, the antimicrobial peptide of the present invention is unaffected by Salmonella drug resistance, exhibits significant inhibitory effects against Salmonella, and can effectively prevent and control salmonellosis. The preparation of the antimicrobial peptide of the present invention into antimicrobial drugs, feed additives, or feedstuffs is of great significance for the healthy development of the livestock and poultry farming industry.
[0091] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.
Claims
1. Antimicrobial peptide CL18, characterized by: The amino acid sequence of the antimicrobial peptide CL18 is shown in SEQ ID NO. 1, and the nucleotide sequence is shown in SEQ ID NO.
2.
2. Use of the antimicrobial peptide CL18 according to claim 1 in the preparation of a drug for inhibiting Salmonella, characterized in that: The Salmonella ( Salmonella ) contains Salmonella enterica ( Salmonella enterica ), Salmonella bongori ( Salmonella bongori ); Wherein, the enteric Salmonella comprises enteric Salmonella enterica subspecies ( S. enterica subsp. enterica ), Salmonella enterica subspecies Salamé ( S. enterica subsp. salamae ), Salmonella enterica ssp. arizona ( S. enterica subsp. arizonae ), Salmonella enterica ssp. arizona ( S. enterica subsp. diarizonae ), Salmonella enterica subspecies Houghtonii ( S. enterica subsp. houtenae ), Salmonella enterica subspecies indicus ( S. enterica subsp. indica ).
3. The use according to claim 2, characterized in that: The minimum inhibitory concentration of the antimicrobial peptide CL18 against enteric Salmonella enterica subspecies is 64 μg / ml; the minimum inhibitory concentration against enteric Salmonella salami subspecies is 32 μg / ml; the minimum inhibitory concentration against enteric Salmonella arizona subspecies is 32 μg / ml; the minimum inhibitory concentration against enteric Salmonella biphasic arizona subspecies is 64 μg / ml; the minimum inhibitory concentration against enteric Salmonella houghton subspecies is 32 μg / ml; the minimum inhibitory concentration against enteric Salmonella indica subspecies is 32 μg / ml; and the minimum inhibitory concentration against Salmonella bongori is 64 μg / ml.
4. An antibacterial pharmaceutical composition, characterized in that: The invention comprises the antimicrobial peptide CL18 as claimed in claim 1 and a pharmaceutically active agent or other pharmaceutically acceptable excipients.
5. The antibacterial pharmaceutical composition according to claim 4, wherein: The drug is an anti-Salmonella drug.
Citation Information
Patent Citations
Metalnikowin-like antibacterial peptide and application thereof
CN104140463A
Antibacterial peptide and application thereof
CN118955648A