A vip3 protein with improved activity and uses thereof

By performing specific amino acid mutations in Vip3Aa and Vip3Ca proteins, the interaction between domain III and domain I was reduced, thereby improving the insecticidal activity of Vip3 proteins. This solved the problem of decreased insecticidal activity caused by the development of pest resistance, and achieved efficient control of lepidopteran pests.

CN119775374BActive Publication Date: 2025-12-09JIANGSU OCEAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510001471.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-02
Publication Date
2025-12-09
Estimated Expiration
2045-01-02

AI Technical Summary

Technical Problem

The insecticidal activity of Vip3 protein in existing Bt crops is threatened by the development of pest resistance, making it difficult to effectively control lepidopteran pests such as fall armyworm.

Method used

By making specific amino acid mutations in the Vip3Aa and Vip3Ca proteins, the N-terminal interaction between domain III and domain I is reduced, thereby improving the activation efficiency of the proteins and enhancing their insecticidal activity.

Benefits of technology

It significantly improved the insecticidal activity against fall armyworm, beet armyworm, cotton bollworm and cotton bollworm, reduced the amount of protein used, and expanded the agricultural application range of Vip3 proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119775374B_ABST
    Figure CN119775374B_ABST
Patent Text Reader

Abstract

The application discloses a Vip3 protein with improved activity and application thereof, wherein the Vip3Aa mutant protein is obtained by single-point mutation of a residue Y19 in a domain I or a residue V383 in a domain III; and the Vip3Ca mutant protein is obtained by single-point mutation of a residue K383 in the domain III. The Vip3 mutant protein disclosed by the application has obviously improved insecticidal activity on various Lepidoptera pests compared with wild-type proteins.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biological control and biotechnology, specifically relating to an enhanced Vip3 protein and its applications. Background Technology

[0002] National food security is related to national security, therefore it is essential to focus on the production of grain and important agricultural products. However, severe agricultural pests are causing reduced grain yields and declining crop quality. For example, fall armyworm, armyworm, and bollworm seriously threaten the production security of grain crops such as corn in my country.

[0003] Bacillus thuringiensis (Bt) Bacillus thuringiensis Bt (Bt for short) is an important entomopathogenic fungus. Bt toxins are toxic to an increasing number of insects, including Hemiptera, Diptera, Coleoptera, Hymenoptera, and Lepidoptera, as well as other organisms such as mites and nematodes. Due to their high specificity towards target pests, harmlessness to vertebrates, and easy biodegradability, Bt insecticidal proteins have been widely used worldwide. Bt insecticidal proteins are the most successful alternative to synthetic pesticides, and Bt crops are now planted on over 190 million hectares globally. However, the sustainable use of Bt crops is threatened by the development of pest resistance, and many insects resistant to Bt's Cry-like proteins have been reported. Expressing at least two Bt proteins with different binding sites in the insect gut can achieve relatively long-lasting control of target pests. Therefore, research on Vip3-like proteins derived from Bt but acting on different receptors than Cry-like proteins, and which can also effectively control lepidopteran pests such as the fall armyworm, has significant theoretical and practical implications.

[0004] Vip3 protein is a soluble protein secreted by Bt (Lepidoptera tataricus) during its vegetative growth phase. It is classified into three types: Vip3A, Vip3B, and Vip3C, and possesses insecticidal activity against various lepidopteran pests. Vip3A protein can be hydrolyzed by trypsin or insect midgut fluid into two fragments of approximately 22 kDa and 66 kDa, but these fragments remain bound together. Vip3 protein exists as a tetramer both before and after hydrolysis, and only acquires membrane perforation function after hydrolysis activation. Therefore, Vip3 protein before and after hydrolysis activation is referred to as the protoxin and toxin, respectively. Studies have shown that trypsin induces a conformational change in domain I of the Vip3Aa protein, providing the conditions for its membrane perforation function. After trypsin digestion, during the activation of the Vip3Aa protein, the N-terminus (P... 14 -G 22) from the groove formed by domain III and the tetrameric core, and then forms a parallel four-helix bundle, which is large enough to reach and pierce the lipid bilayer. Therefore, reducing the interaction between domain III and the N-terminus of domain I in Vip3Aa protein can accelerate the activation of Vip3Aa protein, and in turn improve its insecticidal activity, which is helpful to expand the agricultural application of Vip3 proteins. SUMMARY

[0005] In order to achieve the purpose in the background art, reduce the interaction between domain III and the N-terminus of domain I in Vip3Aa protein, accelerate the activation of Vip3Aa protein, and improve its insecticidal activity, an insecticidal Vip3 protein and its application are proposed.

[0006] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0007] The first object of the present application is an active Vip3 protein, which includes Vip3Aa and Vip3Ca mutant proteins, the Vip3Aa mutant protein has a mutated amino acid sequence in which the residue Y19 in domain I or the residue V383 in domain III is mutated to any other amino acid, and the Vip3Ca mutant protein has a mutated amino acid sequence in which the residue K383 in domain III is mutated to any other amino acid.

[0008] Amino acids are also represented by the following standard abbreviations: alanine (Ala; A), arginine (Arg; R), asparagine (Asn; N), aspartic acid (Asp; D), cysteine (Cys; C), glutamine (Gln; Q), glutamic acid (Glu; E), glycine (Gly; G), histidine (His; H), isoleucine (Ile; 1), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y), and valine (Val; V).

[0009] Further, the residue tyrosine at position 19 in domain I of the Vip3Aa protein is mutated to alanine, and the residue valine at position 383 in domain III is mutated to alanine or glycine.

[0010] Further, the residue lysine at position 383 in domain III of the Vip3Ca protein is mutated to alanine.

[0011] The second object of the present application is to provide genes encoding Vip3 mutant proteins, such as SEQ ID No. 2 and SEQ ID No. 4.

[0012] The third object of the present application is to provide an expression cassette encoding a gene.

[0013] The fourth object of the present application is to provide the use of Vip3 mutant proteins in the prevention and control of Lepidoptera pest organisms.

[0014] Further, the Vip3 mutant proteins are prepared into insecticides for preventing and controlling Lepidoptera pests, and the Lepidoptera pests are Spodoptera frugiperda Spodoptera frugiperda , Spodoptera exigua Spodoptera exigua , Spodoptera litura Spodoptera litura and Helicoverpa armigera Helicoverpa armigera .

[0015] The above technical solutions can achieve the following beneficial effects:

[0016] The mutant proteins of the present application have significantly improved insecticidal activity against Spodoptera frugiperda, Spodoptera exigua, Spodoptera litura and Helicoverpa armigera, significantly reducing the amount of protein used in actual prevention and control operations, and being conducive to biological control of Spodoptera frugiperda, Spodoptera exigua, Spodoptera litura and Helicoverpa armigera at a lower cost, so as to enhance the application of Vip3 proteins in the prevention and control of Lepidoptera pests. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Structure diagram of amino acid residues interacting with the N-terminal of domain I in Vip3Aa protein domain III.

[0018] Figure 2 Purification result diagram of Vip3Aa protein domain III mutant protein.

[0019] Figure 3 Membrane perforation activity result diagram of Vip3Aa protein domain III mutant protein.

[0020] Figure 4 Purification result diagram of mutant Vip3Aa-V383G and Vip3Aa-Y19A proteins.

[0021] Figure 5 Structure diagram of amino acid residues K383 and N390 in Vip3Ca protein domain III.

[0022] Figure 6 Purification result diagram of mutant Vip3Ca-K383A and Vip3Ca-N390A proteins. DETAILED DESCRIPTION

[0023] The following will be described in conjunction with the accompanyingFigures 1-6 and the examples further illustrate the application:

[0024] In the activation process of Vip3Aa protein, the N-terminal of domain I (P 14 -G 22 ) is released from the groove formed by domain III and the tetramer core, and then forms a parallel four-helix bundle. Therefore, domain III can be involved in the activation process of Vip3Aa protein, thereby affecting its membrane perforation function and virulence. In this embodiment, the wild type Vip3Aa amino acid sequence used is shown in SEQ ID No. 1:

[0025] MNKNNTKLSTRALPSFIDYFNGIYGFATGIKDIMNMIFKTDTGGDLTLDEILKNQQLLNDISGKLDGVNGSLNDLIAQGNLNTELSKEILKIANEQNQVLNDVNNKLDAINTMLRVYLPKITSMLSDVMKQNYALSLQIEYLSKQLQEISDKLDIINVNVLINSTLTEITPAYQRIKYVNEKFEELTFATETSSKVKKDGSPADILDELTELTELAKSVTKNDVDGFEFYLNTFHDVMVGNNLFGRSALKTASELITKENVKTSGSEVGNVYNFLIVLTALQAKAFLTLTTCRKLLGLADIDYTSIMNEHLNKEKEEFRVNILPTLSNTFSNPNYAKVKGSDEDAKMIVEAKPGHALIGFEISNDSITVLKVYEAKLKQNYQVDKDSLSEVIYGDMDKLLCPDQSEQIYYTNNIVFPNEYVITKIDFTKKMKTLRYEVTANFYDSSTGEIDLNKKKVESSEAEYRTLSANDDGVYMPLGVISETFLTPINGFGLQADENSRLITLTCKSYLRELLLATDLSNKETKLIVPPSGFISNIVENGSIEEDNLEPWKANNKNAYVDHTGGVNGTKALYVHKDGGISQFIGDKLKPKTEYVIQYTVKGKPSIHLKDENTGYIHYEDTNNNLEDYQTINKRFTTGTDLKGVYLILKSQNGDEAWGDNFIILEISPSEKLLSPELINTNNWTSTGSTNISGNTLTLYQGGRGILKQNLQLDSFSTYRVYFSVSGDANVRIRNSREVLFEKRYMSGAKDVSEMFTTKFEKDNFYIELSQGNNLYGGPIVHFYDVSIK

[0026] The present application analyzed the amino acid residues in domain III that interact with the N-terminus of domain I (P 14 -G 22 ) using Chimera X software, and hypothesized that V 383 DK 385 and T 525 KLIV 529 , P 531 in domain III interact with the N-terminus of domain I (P14 -G 22 ) can interact with each other Figure 1 Reducing the interaction of these amino acids in domain III with the N-terminus of domain I can accelerate the activation process of Vip3Aa protein, thereby enhancing the insecticidal activity of Vip3Aa protein. Therefore, the inventors mutated the above 9 amino acid residues to alanine respectively, and obtained 9 alanine mutants.

[0027] PCR was performed using Vip3Aa protein coding gene as a template, and the sequence of Vip3Aa protein coding gene is shown in SEQ ID No. 2.

[0028]

[0029] The obtained PCR product was digested with DMT enzyme for 1 h, 5 μL of the enzyme-digested product was added to 50 μL of DMT competent cells, and after ice bath for 30 min, it was heat shocked at 45°C water bath for 45 s, immediately after heat shock, ice bath for 2 min, and 800 μL of antibiotic-free LB medium was added, and after 1 h of culture at 37°C, 200 rpm, 650 μL of supernatant was discarded, and 150 μL of bacterial solution was taken to Kan LB agar plates with resistance, and cultured at 37°C overnight, and single colonies were picked up in 5 mL LB test tubes with resistance) and cultured at 37°C for 8-10 h, and the bacterial solution was taken for preservation and sequencing; the bacterial solution with correct sequencing was used to extract plasmid, which was transformed into E. coli BL21 (DE3) to prepare glycerol bacteria, which were stored in a refrigerator at -80°C. Kan

[0030] (1) The stored glycerol bacteria were streaked on LB (containing Kan resistance) plates and cultured at 37°C overnight.

[0031] (2) Single colonies were inoculated in 5 mL of LB (containing Kan resistance) liquid medium and cultured at 37°C, 180 r / min overnight.

[0032] (3) 10 mL of the overnight cultured bacterial solution was transferred to 1 L of LB (containing Kan resistance) liquid medium, and cultured at 37°C, 180 r / min until the OD600 was about 1.0. IPTG was added at a final concentration of 0.5 mmol / L to induce the expression of Vip3Aa protein, and the culture was incubated at 16°C, 180 r / min overnight.

[0033] (4) The bacterial cells were collected by centrifugation at 4°C, 8000 r / min for 5 min, and suspended with Lysis buffer (containing PMSF at a final concentration of 1 mmol / L), and then ultrasonically broken.

[0034] (5) The supernatant was collected by centrifugation at 4°C, 18000 r / min for 40 min, and used for purification of Vip3Aa protein.

[0035] (6) The supernatant was added to a nickel column for affinity chromatography, the flow rate was 0.8 mL / min, the column was hung twice, and the column was washed with 15 times the column volume of Washing buffer at a flow rate of 1.0 mL / min.

[0036] ​(7) Add 5-10 mL Elution buffer to the nickel column, stand for 10 min, control the flow rate at 0.5 mL / min, and collect the eluate.

[0037] (8) Suck the eluate into a dialysis bag, dialyze in dialysis buffer for 3 to 4 times, replace the dialysis buffer every 3 hours, and the dialysis end product is the Vip3Aa protein used in the experiment.

[0038] (9) Aliquot the purified protein, freeze it in liquid nitrogen, and store it at -80°C.

[0039] (10) The Vip3Aa protein and mutants obtained by purification in the application are detected by SDS-PAGE, and the results are shown in Figure 2 .

[0040] The Vip3Aa protein is activated by proteases in the insect midgut, then binds to specific receptors in the midgut, and forms channels in the midgut epithelial cells. The formation of these channels destroys the integrity of the cell membrane, leading to a rapid imbalance of ions and small molecules between the inside and outside of the cell, and ultimately leading to cell rupture and insect death. The present application analyzes the membrane perforation activity of Vip3Aa protein and its mutants by analyzing the leakage of calcein in the calcein liposome.

[0041] Preparation of calcein liposome

[0042] (1) Dissolve the lipid mixture of DOPE and DOPC 1:1 (w / w) in 5 mL chloroform, and evaporate to film under reduced pressure at 40°C.

[0043] (2) Add 3 mL of 60 mM calcein solution, and sonicate to hydrate, ensuring that all dry liposomes enter the solution to obtain a liposome suspension. Freeze-thaw the obtained liposome suspension for 5 cycles (freeze in liquid nitrogen and thaw in a 40°C water bath).

[0044] (3) Further reduce the particle size of the liposomes by probe sonication under ice water bath for 4 min (400W, 2s on, 2s off), and use a 1 mL hand push extruder to extrude the liposome solution 21 times using a 0.1 mm polycarbonate membrane.

[0045] (4) Add the well-extruded liposome solution to the G25 desalting column that has been pre-washed with 20 mM Tris-HCl and perform three desalting treatments. Rinse three times with 20 mM Tris-HCl buffer. Then take a sample and add it when the 20 mM Tris-HCl buffer solution just reaches the bottom of the column. When the sample liquid level just reaches the bottom, add a large amount of buffer solution. Then take 1 mL of sample and add it when the buffer solution just reaches the bottom of the G25 column. When the sample liquid level just reaches the bottom, add a large amount of buffer solution. Collect the 40 mL of the initially colored eluent. The collected eluent is the purified calcein liposome and is stored in a 4℃ refrigerator for later use.

[0046] (5) Take 200 μL of liposome (concentration 30 μM) solution into an ELISA plate and measure the fluorescence intensity of the reaction, which is recorded as F0. The excitation wavelength for fluorescence measurement is 485 nm and the emission wavelength is 510 nm.

[0047] (6) Add 20 μL of Vip3Aa protein and protein complex to the microplate, and measure its fluorescence intensity every 40 s and record it as Ft, for a total of 20 min.

[0048] (7) Add 5 μL of 0.01% Triton-100 and react for 5 min. Measure the final fluorescence intensity F100.

[0049] (8) Leakage rate of calcein % = (Ft-F0) / (F100-F0)*100.

[0050] This invention involves incubating mixtures of various mutant proteins and trypsin with artificially prepared liposomes encapsulated with calcein. The membrane perforation activity of each protein complex is analyzed by liposome leakage efficiency, and the results are as follows: Figure 3 As shown. From Figure 3 It can be seen that the release rate of calcein caused by the mutant Vip3Aa-V383A is significantly higher than that of Vip3Aa protein and other mutants. That is, the mutation of residue 383 of Vip3Aa protein to alanine helps to enhance the membrane perforation activity of Vip3Aa protein.

[0051] In order to analyze the reason why the membrane perforation activity of the Vip3Aa-V383A protein is increased from the structural point of view, the present application uses two servers, Phyre2 and alphafold3, to predict the protein structure of the Vip3Aa protein mutant. The difference between the two is that Phyre2 uses the reported Vip3Aa protein structure as a template to predict the structure of the Vip3Aa protein mutant, while alphafold3 does not rely on a template. Then, the present application uses Chimera X to analyze the contact between the mutant domain III and the N-terminal of domain I, and the hydrogen bond between residues Y19 and A383 in the mutant Vip3Aa-V383A disappears. These results show that reducing the interaction between residues Y19 and 383 can help improve the membrane perforation activity of the Vip3Aa protein.

[0052] The indoor bioactivity of Spodoptera frugiperda was determined (24-well plate feed method), and insect feed containing different concentrations of insecticidal proteins was prepared. The blank feed and the feed added with 20 mmol / L Tris-HCL buffer were used as blank control and negative control, respectively, and newly hatched larvae of Spodoptera frugiperda were selected as test insects.

[0053] (1) 20 g of artificial feed was weighed into a sterile culture dish, and the feed was pressed until there were no lumps, and then spread in a 9 cm sterile culture dish;

[0054] (2) 3 mL of the prepared sample mixture solution was taken using a pipette, and the protein sample was mixed with the feed, and then evenly distributed into 24 wells, and then left to evaporate the excess water in the feed under room temperature conditions for a period of time;

[0055] (3) The feed was evenly distributed into 24-well culture plates using a spoon, and the feed was attached to one side;

[0056] (4) The larvae were first shaken onto A4 paper, and then the one-day-old larvae with fast crawling and active individuals were picked up using a brush and placed in the 24-well culture plates, one head per well;

[0057] (5) After the larvae were placed, the top cover of the 24-well plate was covered (blown plate was placed), and then two rubber bands were used to fix it to prevent the larvae from escaping;

[0058] (6) The 24-well culture plates were placed in an insect incubator with a temperature of 28°C and a RH of 65%;

[0059] (7) The dry and wet conditions of the feed, the normal light period of the incubator, and the suitable conditions were observed regularly, and after 7 days of culture, the survival and death of the test insects were counted, and the data were arranged for calculating the mortality rate, and the LC50 was calculated using SPSS software.

[0060] Among the 9 alanine mutant proteins, the insecticidal activity of mutant Vip3Aa-V383A was significantly enhanced, increased by 1.5 times, which was related to the enhanced membrane perforation activity.

[0061] From the results of the membrane perforation activity and insecticidal activity of mutant Vip3Aa-V383A, it can be seen that eliminating the hydrogen bond between the residue at position 383 and the residue Y19 is beneficial to the insecticidal activity of Vip3Aa protein. In the present application, Y19 is mutated to alanine and V383 is mutated to glycine. The predicted protein structure analysis shows that the hydrogen bond between the residue at position 19 and the residue at position 383 is eliminated in both mutants. The mutant was obtained by PCR amplification with Vip3Aa protein expression plasmid as template, DMT enzyme treatment, E. coli transformation and DNA sequencing verification. The protein expression and purification of the mutant are the same as in Example 1. The purified mutant protein was detected by SDS-PAGE, and the results are shown in Figure 4 . The insecticidal activity determination is the same as in Example 3. The newly hatched larvae of Spodoptera frugiperda were selected as test insects, and the survival and death of the test insects were counted after 7 days of culture. The data were arranged for calculation of mortality and LC50.

[0062] Compared with Vip3Aa protein, the insecticidal activity of Vip3Aa-Y19A and Vip3Aa-V383G was significantly enhanced, increased by 1.3 and 1.4 times, respectively.

[0063] In order to explore whether reducing or eliminating the hydrogen bond between domain III and the N terminus of domain I is also beneficial to improve the insecticidal activity of other Vip3 proteins, the present application selects Vip3Ca protein as the research object. The inventors found that K383 and N390 ( Figure 5 ) in domain III of Vip3Ca protein have hydrogen bond effect with the N terminus (P 14 -G 22 ) of domain I by using Chimera X software analysis. In the amino acid sequence SEQ ID No. 3, K383 and N390 are mutated to alanine to eliminate the hydrogen bond effect.

[0064] SEQ ID No. 3 is as follows:

[0065] MNMNNTKLNARALPSFIDYFNGIYGFATGIKDIMNMIFKTDTGGDLTLDEILKNQQLLNEISGKLDGVNGSLNDLIAQGNLNTELSKEILKIANEQNQVLNDVNNKLDAINTMLNIYLPKITSMLSDVMKQNYALSLQIEYLSRQLQEISDKLDVINLNVLINSTLTEITPSYQRIKYVNEKFDKLTFATESTLRAKQGIFNEDSFDNNTLENLTDLAELAKSITKNDVDSFEFYLHTFHDVLIGNNLFGRSALKTASELITKDEIKTSGSEIGKVYSFLIVLTSLQAKAFLTLTTCRKLLGLSDIDYTSIMNEHLNNEKNEFRDNILPALSNKFSNPSYAKTIGSDNYAKVILESEPGYALVGFEIINDPIPVLKAYKAKLKQNYQVDNQSLSEIVYLDIDKLFCPENSEQKYYTKNLTFPDGYVITKITFEKKLNNLIYEATANFYDPSTGDIDLNKKQVESTFPQTDYITMDIGDDDGIYMPLGVISETFLTPINSFGLEVDAKSKTLTLKCKSYLREYLLESDLKNKETGLIAPPNVFISNVVKNWDIEEDSLEPWVANNKNAYVDNTGGIERSKALFTQGDGEFSQFIGDKLKPNTDYIIQYTVKGKPAIYLKNKSTGYITYEDTNGNSEEFQTIAVKFTSETDLSQTHLVFKSQNGYEAWGDNFIILEAKLFETPESPELIKFNDWERFGTTYITGNELRIDHSRGGYFRQSLNIDSYSTYDLSFSFSGLWAKVIVKNSRGVVLFEKVKNNGSSYEDISESFTTASNKDGFFIELTAERTSSTFHSFRDISIKEKIE

[0066] The Vip3Ca protein expression plasmid (the sequence of the Vip3Ca gene is shown as SEQ ID No. 4) was used as a template for PCR amplification, and the primers are shown in Table 1. The PCR product was treated with DMTase, transformed into E. coli, and verified by DNA sequencing to obtain the corresponding mutant. The protein expression of the mutant was the same as in Example 1. The Vip3Ca protein and its mutants used were detected by SDS-PAGE, and the results are shown in Figure 6 .

[0067] SEQ ID No. 4 is as follows:

[0068]

[0069] Table 1 Primers required for constructing K383A and N390A mutants in domain III of Vip3Ca protein

[0070] Primer name Sequence (5'-3') K383A-F TAAAGCAAAACTAGCTCAAAATTATCAAGTT K383A-R AGCTAGTTTTGCTTTATACGCTTTTAATACCGG N390A-F CAAAATTATCAAGTTGATGCTCAGTCGTTATCAG N390A-R GCATCAACTTGATAATTTTGTTTTAGTTTTGCTTTAT

[0071] The insecticidal activity was determined according to Example 3, and newly hatched larvae of Spodoptera frugiperda were selected as the test insects. After 7 days of culture, the survival and death of the test insects were counted, and the data were arranged to calculate the mortality and LC50. Compared with Vip3Ca protein, the insecticidal activity of Vip3Ca-K383A was obviously enhanced by 1.8 times, but the insecticidal activity of Vip3Ca-N390A was decreased, and the reason for the decrease needs to be studied.

[0072] The insecticidal activity of the Vip3 proteins (Vip3Aa-V383A, Vip3Aa-Y19A, Vip3Aa-V383G and Vip3Ca-K383A) with increased insecticidal activity on Spodoptera exigua, Prodenia litura and Helicoverpa armigera was detected, and the insecticidal activity was determined according to Example 3. Newly hatched larvae of Spodoptera exigua, Prodenia litura and Helicoverpa armigera were selected as the test insects. After 7 days of culture, the survival and death of the test insects were counted, and the data were arranged to calculate the mortality and LC50.

[0073] The insecticidal activity of the Vip3 mutant proteins on Prodenia litura, Spodoptera exigua and Helicoverpa armigera was increased. Compared with Vip3Aa protein, the insecticidal activity of Vip3Aa-V383A on Prodenia litura, Spodoptera exigua and Helicoverpa armigera was increased by 2.7 times, 1.8 times and 1.8 times, respectively; the insecticidal activity of Vip3Aa-Y19A on Prodenia litura, Spodoptera exigua and Helicoverpa armigera was increased by 1.6 times, 1.2 times and 1.1 times, respectively; the insecticidal activity of Vip3Aa-V383G on Prodenia litura, Spodoptera exigua and Helicoverpa armigera was increased by 1.7 times, 1.2 times and 1.1 times, respectively; and the insecticidal activity of Vip3Ca-K383A on Prodenia litura, Spodoptera exigua and Helicoverpa armigera was increased by 2.5 times, 1.7 times and 2.2 times, respectively, compared with Vip3Ca protein. In summary, based on the reduction or elimination of the hydrogen bond between domain III and the N terminus (P 14 -G 22 ) of domain I of Vip3 protein, the mutant protein with obviously increased insecticidal activity was obtained.

[0074] The above-mentioned are preferred embodiments of the present application, and for those skilled in the art, various equivalent modifications of the present application without departing from the principles of the present application are within the protection scope of the appended claims of the present application.

Claims

1. A Vip3 protein with enhanced activity, characterized in that: The Vip3 protein is either a Vip3Aa mutant protein or a Vip3Ca mutant protein. The amino acid sequence of the Vip3Aa mutant protein is as follows: a single-point mutation of residue Y19 in domain I to alanine or a single-point mutation of residue V383 in domain III to alanine or glycine in the amino acid sequence shown in SEQ ID No.

1. The amino acid sequence of the Vip3Ca mutant protein is as follows: a single-point mutation of residue K383 in domain III to alanine in the amino acid sequence shown in SEQ ID No.

3.

2. The gene encoding the Vip3 mutant protein of claim 1.

3. An expression cassette containing the encoding gene as described in claim 2.

4. The Vip3 mutant protein of claim 1 in controlling fall armyworm Spodoptera frugiperda Beet armyworm Spodoptera exigua Spodoptera litura Spodoptera litura and cotton bollworm Helicoverpa armigera Application of pest organisms.

Citation Information

Patent Citations

  • Mutant insecticidal protein Vip3 and application thereof

    CN117624314A

  • Plants having increased tolerance to herbicides

    US20200270625A1