Elastin peptide fusion protein as well as preparation method and application thereof

Abstract

The invention relates to the technical field of bioengineering, and discloses an elastin peptide fusion protein as well as a preparation method and application thereof. Based on the elastin with an amino acid sequence such as SEQ ID NO.8, high-yield expression of the elastin is realized through pichia pastoris GS115. According to the elastin, bovine lactoferrin peptide with a natural antibacterial function is fused, bovine lactoferrin N-leaf small peptide, bovine lactoferrin peptide and elastin peptide with an amino acid sequence as shown in SEQ ID NO.8 are fused, on the premise that the high expression quantity of the fusion protein is guaranteed, the fusion protein is endowed with more functions, and the fusion protein has the advantages of being capable of resisting bacteria and resisting bacteria. Therefore, the fusion protein can be applied to cosmetics, such as artificial blood vessels and other medical equipment products, and the elastin has good biocompatibility and a natural preservative function.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to an elastin peptide fusion protein and a preparation method and application thereof. Background Art

[0002] Elastin is the most stable protein in the extracellular matrix. It is an important structure present in multiple connective tissues. It is synthesized and secreted by fibroblasts and keratinocytes and has good elasticity and unique physiological functions. Although elastin accounts for only 2-4% of the total protein content in the skin, it is essential for the maintenance of skin structure. Elastin is rich in non-polar amino acids such as glycine, proline, alanine, leucine and valine, and usually contains a large number of 3-9 amino acid repeating sequences to form a flexible and stable structure.

[0003] Elastin plays an important role in maintaining skin elasticity, moisturizing, promoting wound healing, maintaining blood vessel health, and protecting the skin barrier, and is widely used in skin care products, medicine, food processing and other fields. Currently, most of the raw materials for elastin in the industry are extracted from biological tissues rich in elastic fibers, for example, from arterial walls, ligaments, skin and other tissues. The supply of biological tissue raw materials is affected by many factors, such as animal epidemics, environmental protection policies, etc. The instability of raw material supply may lead to increased production costs.

[0004] In the cosmetics industry, the addition of elastin to skin care products makes the skin more hydrated and elastic. At the same time, the addition of chemical preservatives to skin care products can cause skin irritation, allergies, inflammation, and potential safety risks. In addition, chemical preservatives can also cause cumulative chronic harm to the human body, such as forming an unhealthy stratum corneum and accelerating skin aging. Therefore, it is extremely urgent to find a natural antibacterial agent to replace chemical preservatives. Summary of the invention

[0005] In order to solve the problem of preparing elastin, the present invention provides an elastin peptide fusion protein and a preparation method and application thereof.

[0006] The specific technical scheme of the present invention is: In a first aspect, the present invention provides an elastin peptide fusion protein, the fusion protein comprising bovine lactoferrin N-lobe small peptide, bovine lactoferrin peptide, and elastin peptide, and the amino acid sequence of the fusion protein is shown in SEQ ID NO.1.

[0007] Based on the elastin of amino acid sequence such as SEQ ID NO.8, the present invention constructs a fusion protein. The elastin of the present invention fuses bovine lactoferrin peptide with natural antibacterial function, and by fusing bovine lactoferrin N-lobe small peptide, bovine lactoferrin peptide and elastin peptide encoded by nucleotide sequence SEQ ID NO.3, the fusion protein is endowed with more functions while ensuring a high expression amount of the fusion protein, so that the fusion protein can be applied to cosmetics, medical device products such as artificial blood vessels, etc. The elastin of the present invention has good biocompatibility and natural antiseptic function.

[0008] In a second aspect, the present invention provides a gene encoding the above-mentioned fusion protein.

[0009] Preferably, the nucleotide sequence of the fusion protein is as shown in SEQ ID NO.2.

[0010] In a third aspect, the present invention provides a recombinant vector comprising the above-mentioned encoding gene.

[0011] Preferably, the vector is a pPIC9K plasmid.

[0012] In a fourth aspect, the present invention provides a genetically engineered bacterium comprising the above-mentioned coding gene or the above-mentioned recombinant vector.

[0013] Preferably, the genetically engineered bacteria is Pichia pastoris GS115.

[0014] In a fifth aspect, the present invention provides a method for preparing the above-mentioned fusion protein, comprising the following steps: connecting the bovine lactoferrin N-lobe small peptide gene Lfcin gene, the bovine lactoferrin peptide gene LFcinB gene, and the elastin peptide gene ElT gene to the pPIC9K plasmid to obtain the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT, and then electro-transforming the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT into Pichia pastoris GS115 for fermentation expression.

[0015] In a sixth aspect, based on the above, the present invention provides the use of the above fusion protein in skin care products.

[0016] In a seventh aspect, based on the above, the present invention provides the use of the above fusion protein in the preparation of artificial blood vessels.

[0017] Compared with the prior art, the present invention has the following technical effects: In the process of foreign protein expression, the large intestine is prone to form inactive inclusion bodies, and there is a risk of plasmid shedding during long-term passage. At the same time, Escherichia coli has a simple structure and lacks protein post-translational modification function, which is not suitable for the expression of some proteins that require complex modifications, such as fusion proteins. Based on the amino acid sequence of elastin such as SEQ ID NO.8, the present invention achieves high-yield expression of elastin through Pichia pastoris GS115.

[0018] The elastin of the present invention is fused with bovine lactoferrin peptide having natural antibacterial function. By fusing bovine lactoferrin N-lobe small peptide and bovine lactoferrin peptide with the elastin peptide having an amino acid sequence as shown in SEQ ID NO.8, the fusion protein is endowed with more functions while ensuring a high expression amount of the fusion protein, so that the fusion protein can be applied to cosmetics, medical device products such as artificial blood vessels, etc. The elastin of the present invention has good biocompatibility and natural antiseptic function. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The map of the recombinant plasmid pPIC9K-Lfcin-LfcinB-E1T of the gene encoding the recombinant elastin peptide fusion protein of the present invention; Figure 2 This is an agarose gel verification image of the positive transformants of Escherichia coli DH5α transformed with the recombinant plasmid pPIC9K-Lfcin-LfcinB of Example 1 of the present invention; Figure 3 This is an agarose gel verification image of the positive transformants of Escherichia coli DH5α transformed with the recombinant plasmid pPIC9K-Lfcin-LfcinB-E1T of Example 2 of the present invention; Figure 4 This is an agarose gel verification image of the positive transformants of Pichia pastoris GS115 transformed with the recombinant plasmid pPIC9K-Lfcin-LfcinB-E1T of Example 3 of the present invention; Figure 5 This is an SDS-PAGE analysis diagram of the expression of the elastin peptide fusion protein according to an embodiment of the present invention, wherein lanes 1, 2, and 3 refer to parallel groups in three shake flasks, and the control is the Pichia pastoris GS115 strain containing an empty plasmid. DETAILED DESCRIPTION

[0020] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present invention.

[0021] In the examples of the present invention, the Pichia pastoris GS115 strain and the expression vector pPIC9K used were purchased from Invitrogen, USA.

[0022] In the embodiment of the present invention, the nucleotide sequences of bovine lactoferrin N-lobe small peptide gene (Lfcin gene), bovine lactoferrin peptide gene (LFcinB gene), and elastin peptide gene (ElT gene) are shown as SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively; the amino acid sequences of bovine lactoferrin N-lobe small peptide, bovine lactoferrin peptide, and elastin peptide are shown as SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, respectively. The amino acid sequence of the fusion protein is shown as SEQ ID NO.1, and the nucleotide sequence of the fusion protein is shown as SEQ ID NO.2.

[0023] In the embodiment of the present invention, the culture medium formula composition is as follows: LB culture medium: peptone 10g / L, yeast powder (5g / L), sodium chloride 10g / L (solid culture medium contains 2% agar); YPD culture medium: yeast powder 10 g / L, glucose 20 g / L, peptone 20 g / L (solid culture medium contains 2% agar); MD culture medium: glucose 20 g / L, ammonium sulfate 10 g / L, amino-free yeast nitrogen source 3.4 g / L (solid culture medium contains 2% agar); BMG culture medium: dipotassium hydrogen phosphate 3 g / L, potassium dihydrogen phosphate 11.8 g / L, amino-free yeast nitrogen source 3.4 g / L, ammonium sulfate 10 g / L, glycerol 10 g / L, 115°C steam autoclave for 30 min, after cooling, add 2 ml of biotin in the clean bench; BMM culture medium: dipotassium hydrogen phosphate 3 g / L, potassium dihydrogen phosphate 11.8 g / L, amino-free yeast nitrogen source 3.4 g / L, ammonium sulfate 10 g / L, glycerol 10 g / L, steam autoclave at 115℃ for 30 min, add 2mL biotin and 1% methanol in a clean bench after cooling.

[0024] In the examples of the present invention, the sequence information of the primers used is shown in Table 1.

[0025] Table 1 Primer information Primer name Primer sequences Lfcin-F CACCATCATCACCACCATTAATACGT Lfcin-R GCGGCTTTTGTTTTTGCCA LfcinB-F TTTAAATGCCGCCGCTGG LfcinB-R AAACGCGCGGCGCAC LF-F CACCATCATCACCACCATTAATACGT LF-R AAACGCGCGGCGCAC ElT-F ATGGCGGGCCTGACCG ElT-R CGGCAGGCCATAGCCGC α-F TACTATTGCCAGCATTGCTGCT 3AOX GCAAATGGCATTCTGACATCC Example 1 Construction of pPIC9K-Lfcin-LfcinB cloning vector This example constructs a recombinant elastin peptide fusion expression gene cloning vector. The recombinant elastin peptide fusion expression gene has a total length of 294 amino acids, and the base sequence of the coding gene of the recombinant elastin peptide fusion protein is shown in SEQ ID NO.5. The method for constructing a recombinant elastin peptide fusion expression gene cloning vector is carried out in the following steps: 1. The gene sequences of bovine lactoferrin N-lobe peptide (Lfcin), elastin peptide (ElT), and bovine lactoferrin peptide (LfcinB) were connected to the multiple cloning site of the pPIC9K plasmid by EcoRI and Not I double restriction digestion, and the recombinant plasmids pPIC9K-Lfcin, pPIC9K-ElT, and pPIC9K-LfcinB were synthesized respectively. The genes were synthesized by Nanjing GenScript Biotech Co., Ltd.

[0026] 2. Use Lfcin-F and Lfcin-R primers to perform PCR amplification on pPIC9K-Lfcin, digest the amplified PCR product with DpnⅠ enzyme to remove the original template interference, and purify the digested PCR product with a purification kit (the kit was purchased from Shanghai Bioengineering Co., Ltd., and the specific operation was carried out according to the kit instructions); use LfcinB-F and LfcinB-R primers to perform PCR amplification on pPIC9K-LfcinB, digest the amplified PCR product with DpnⅠ enzyme to remove the original template interference, and purify the digested PCR product with a purification kit (the kit was purchased from Shanghai Bioengineering Co., Ltd., and the specific operation was carried out according to the kit instructions); connect the above-mentioned purified products into a ring through a recombination reaction using a one-step cloning kit (purchased from Nanjing Novezan Biotechnology Co., Ltd., and the specific operation was carried out according to the kit instructions) to obtain the recombinant product pPIC9K-Lfcin-LfcinB, which was stored at -20°C for use.

[0027] The PCR amplification system is shown in Table 2 below.

[0028] Table 2 PCR amplification system Reagents Usage Primer F 1 μL Primer R 1 μL Template DNA 1 μL High-fidelity enzyme 25 μL <![CDATA[dd H 2 The]]> Add to 50 μL The PCR product digestion system is shown in Table 3 below.

[0029] Table 3 Digestion system Reagents Usage PCR stock solution 50μL DpnⅠ 1μL Among them, the reaction system of the recombination reaction is shown in Table 4 below.

[0030] Table 4 Reaction system of recombination reaction Reagents Usage Recombinase 1μL Buffer 2μL pPIC9K-Lfcin purified product 1.71μL LfcinB gene fragment purification product 1.2μL Sterile water 14.09μL 3. The above recombinant product pPIC9K-Lfcin-LfcinB was transformed into E. coli DH5α competent cells, and positive transformants were picked and verified. The agarose gel verification gel image is shown in Figure 2 The correct transformant strains were stored in a -80°C freezer.

[0031] Example 2 Construction of pPIC9K-Lfcin-LfcinB-E1T cloning vector In this example, a recombinant elastin peptide fusion expression gene cloning vector pPIC9K-Lfcin-LfcinB-E1T is constructed. The plasmid map of pPIC9K-Lfcin-LfcinB-E1T is shown in Figure 1 . Follow these steps: 1. Clone using primers LF-F and LF-R.

[0032] The E1T gene fragment was cloned using E1T-F and E1T-R.

[0033] The pPIC9K-Lfcin-LfcinB was amplified by PCR using primers LF-F and LF-R, and the amplified PCR product was purified to obtain the pPIC9K-Lfcin-LfcinB gene fragment; the pPIC9K-E1T was amplified by PCR using primers ElT-F and ElT-R, and the amplified PCR product was purified to obtain the ElT gene fragment; the pPIC9K-Lfcin-LfcinB gene fragment and the ElT gene fragment were connected into a ring by a recombination reaction using a one-step cloning kit to obtain the recombinant product pPIC9K-Lfcin-LfcinB-E1T, which was stored at -20°C for future use. The plasmid map of pPIC9K-Lfcin-LfcinB-E1T is shown in Figure 1 .

[0034] Among them, the reaction system of the recombination reaction is shown in Table 5 below.

[0035] Table 5 Reaction system of recombination reaction Reagents Usage Recombinase 1μL Buffer 2μL pPIC9K-Lfcin-LfcinB gene fragment 1.53μL E1T gene fragment 1.1μL Sterile water 14.37μL 2. The above recombinant product pPIC9K-Lfcin-LfcinB-E1T was transformed into E. coli DH5α competent cells, and positive transformants were picked and verified. The agarose gel verification gel image is shown in Figure 3 The correct transformant strains were stored in a -80°C freezer.

[0036] Example 3 Construction of recombinant Pichia pastoris engineered bacteria GS115-Lfcin-LfcinB-E1T In this example, the recombinant Pichia pastoris engineering bacteria GS115-Lfcin-LfcinB-E1T was constructed according to the following steps: 1. The expression vector pPIC9K-Lfcin-LfcinB-E1T was linearized by restriction endonuclease SacⅠ at 37°C for 30 min. The reaction system is shown in Table 6. Then 1% agarose gel electrophoresis was used to detect whether it was completely cut. After complete cutting, the next step of the experiment was carried out.

[0037] Table 6 Reaction system Reagents Usage Plasmid pPIC9K-Lfcin-LfcinB-E1T 1 μg 10×buffer 2μL SacⅠ 1μL Sterilized water Add to 20 μL 2. The linearized plasmid pPIC9K-Lfcin-LfcinB-E1T was electroporated into Pichia pastoris GS115 competent cells, and positive transformants were picked and verified by gel electrophoresis. Figure 4 As shown, the band around 792 bp is the target gene, and the corresponding strain is the positive transformant. The correct transformant strain was stored in a -80°C refrigerator and recorded as Pichia pastoris engineered strain GS115-Lfcin-LfcinB-E1T.

[0038] Among them, the method for selecting positive transformants for verification is: PCR verification using α-F, 3AOX primers as amplification primers, and the PCR conditions are 98°C pre-denaturation, 5 minutes, one thermal cycle; 98°C thermal denaturation for 10 seconds, 55°C annealing for 15 seconds, 30 thermal cycles; 72°C final extension for 5 minutes.

[0039] Example 4 Fermentation culture In this example, the fermentation culture of Pichia pastoris engineering bacteria GS115-Lfcin-LfcinB-E1T was carried out according to the following steps: The correct transformant strain stored at -80°C obtained in Example 3 was inoculated into BMG medium at a 5% inoculum (volume ratio) and cultured at 30°C and 200 rpm for 14 hours until the OD 600 is 3.6.

[0040] Centrifuge at 4500 rpm for 5 min at room temperature to collect the cells and resuspend them in BMM medium until OD 600 The concentration of the culture medium was 1.0, and the cells were transferred to BMM medium, sealed with gauze, and cultured in a shaking incubator at 30°C and 220 rpm for three days. During the culture period, 100% methanol was added to the BMM medium every 24 h to a final concentration of 1%.

[0041] After three days of shaking culture, 1 mL of bacterial sample was taken and centrifuged at 12000 rpm for 2 min at room temperature. The supernatant was collected for SDS-PAGE electrophoresis detection (three sets of parallel experiments). Figure 5 As shown. The band around 25.15 kDa is the recombinant elastin peptide fusion protein. Figure 5 It can be seen that the fermentation was in line with the expected size and the recombinant elastin peptide fusion protein was successfully fermented.

[0042] After three days of shaking culture, the fermentation broth was taken and the expression level of the fusion protein was quantitatively determined using a BCA kit (purchased from Shanghai Shenggong Biotechnology Co., Ltd.). The specific operation steps were referred to the instruction manual of the BCA kit. The expression level of the recombinant Pichia pastoris GS115-Lfcin-LfcinB-ElT fusion protein was measured to be 0.9 g / L.

[0043] It can be seen from this that the recombinant Pichia pastoris GS115-Lfcin-LfcinB-ElT of the present invention expresses an elastin peptide fusion protein, and its expression level is relatively large. Further, the preparation process of the elastin peptide fusion protein is completed only by strain fermentation, and the elastin peptide fusion protein has no output of harmful waste liquid; and the present invention achieves a higher expression level through Pichia pastoris GS115, which can greatly reduce the acquisition cost of elastin; in addition, the bovine lactoferrin peptide with natural antibacterial function is fused in the elastin peptide fusion protein, while ensuring the higher expression level of the fusion protein, giving the fusion protein more functions, so that the fusion protein can be applied to cosmetics, such as artificial blood vessels and other medical device products. In the fields of and so on, there is no need to add preservatives separately, while ensuring the functionality of the product, it also has higher safety and has broad application prospects.

[0044] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0045] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. An elastin peptide fusion protein, characterized in that: The fusion protein comprises bovine lactoferrin N-lobe small peptide, bovine lactoferrin peptide and elastin peptide. The amino acid sequence of the fusion protein is shown in SEQ ID NO.

1.

2. A gene encoding the fusion protein as claimed in claim 1.

3. The coding gene according to claim 2, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

2.

4. A recombinant vector, characterized in that: Comprising the coding gene according to claim 2 or 3.

5. The recombinant vector according to claim 4, characterized in that: The vector is pPIC9K plasmid.

6. A genetically engineered bacterium, characterized in that: Comprising the coding gene according to claim 2 or the recombinant vector according to claim 4.

7. The genetically engineered bacterium according to claim 6, characterized in that: The genetically engineered bacteria is Pichia pastoris GS115.

8. The method for preparing the fusion protein according to any one of claims 1 to 2, characterized in that: The following steps are involved: The bovine lactoferrin N-lobe small peptide gene, bovine lactoferrin peptide gene and elastin peptide gene were connected to the pPIC9K plasmid to obtain the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT, and then the recombinant plasmid pPIC9K-Lfcin-LfcinB-ElT was electro-transformed into Pichia pastoris GS115 for fermentation expression.

9. Use of the fusion protein according to any one of claims 1 to 2 in skin care products.

10. Use of the fusion protein according to any one of claims 1 to 2 in the preparation of an artificial blood vessel.

Images