Construction and fermentation method of a genetically engineered strain with high indigo production

Abstract

The present invention relates to the construction of a high-yield indigo genetic engineering strain and a fermentation method. The present invention uses Escherichia coli as a starting strain, knocks out at least one of the yddG gene, trpR gene, tyrA gene or pheA gene in the host cell; integrates the tryptophanase gene tnaA and / or the flavin monooxygenase gene MaFMO on the genome; integrates one or more genes related to biofilm modification on the genome, and obtains the optimal engineering strain by comparing the fermentation yield; then transfers a plasmid into the strain to further strengthen the tryptophanase gene tnaA and the flavin monooxygenase gene MaFMO; finally, the yield is significantly increased by supplementing carbon sources and substrates and adding surfactants. The present invention provides an indigo-producing genetic engineering strain and a fermentation method with good stability and high synthesis efficiency, providing a reference for the subsequent development of more advantageous engineering strains.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a construction and fermentation method of a genetic engineering strain with high indigo production. Background Art

[0002] Indigo is a natural dye with important economic value. It is one of the oldest dyes and is widely used in many industries such as textiles, pharmaceuticals, cosmetics and food. Due to its bright color and good light fastness, indigo is favored in painting pigments and other artistic creations. In recent years, with the in-depth study of indigo, it has been found that it also has certain effects in antibacterial, anti-inflammatory, antiviral and anti-tumor, and can be used in the fields of cosmetics and medicine. In addition, due to its bipolarity and high electron mobility, indigo has also attracted much attention in the field of organic semiconductors.

[0003] Indigo was originally extracted from indigo plants (such as Indigofera), however, the total annual production of natural indigo is only about 1%, which cannot meet market demand. Therefore, the production of indigo mainly relies on chemical synthesis, usually using cheap petrochemical products as starting materials. Although this method has more cost advantages, it involves toxic compounds such as aniline, formaldehyde and hydrocyanic acid, causing environmental pollution and potential threats to the health of workers and consumers. To solve these problems, microbial synthesis of indigo has gradually become a sustainable and environmentally friendly alternative.

[0004] At present, the strains used for indigo microbial synthesis are usually constructed by knocking out genes related to tryptophan synthesis and metabolic competition pathways on the host, and expressing genes encoding enzymes of biosynthetic indigo-related pathways. Although they can achieve microbial synthesis of indigo, their yield has not achieved satisfactory results. Therefore, the construction and fermentation method of a high-yield indigo genetically engineered strain is crucial to increase the yield of indigo and realize environmentally friendly and pollution-free industrial production of indigo. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects in the prior art and provide a method for constructing and fermenting a genetically engineered strain with high indigo production, which has good stability, high indigo production and fast production rate.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] A genetically engineered strain with high indigo production is obtained by using Escherichia coli as the initial strain and undergoing the following transformations:

[0008] A: knocking out at least one gene related to the competition pathway for tryptophan synthesis and metabolism in the Escherichia coli,

[0009] B: express at least one gene encoding an enzyme in the biosynthetic pathway of indigo,

[0010] C: Expression of at least one gene associated with biofilm modification.

[0011] The Escherichia coli includes any one of Escherichia coli MG1655, BL21 (DE3), JM109, DH5α, and W3110.

[0012] As a further technical solution, E. coli was used as the initial strain and the D transformation was also performed;

[0013] D: The expression vector pCO-tac-tac is used to overexpress at least one gene encoding an enzyme in the biosynthetic indigo pathway.

[0014] As a further technical solution, the genes encoding enzymes in the pathway related to the biosynthesis of indigo include the tryptophanase gene tnaA and the flavin-containing monooxygenase gene MaFMO.

[0015] As a further technical solution, in the modification of item B, at least one gene encoding an enzyme in the biosynthetic indigo-related pathway is expressed, including one or more of the modifications of items B1-3;

[0016] B1: integration of the flavin monooxygenase gene MaFMO at the arsB locus;

[0017] B2: integration of the flavin monooxygenase gene MaFMO at the ldhA locus;

[0018] B3: Integration of the tryptophanase gene tnaA at the yghWX site.

[0019] As a further technical solution, in the transformation of items B1 and B2, the flavin monooxygenase gene MaFMO is expressed by the promoter tac70

[0020] As a further technical solution, in the transformation of item B3, the tryptophanase gene tnaA is driven by the promoter P tac70 , P J23100 , P tac3 or P 2.1 Control expression.

[0021] As a further technical solution, genes related to the competition pathway for tryptophan synthesis and metabolism include one or more of the aromatic amino acid transporter gene yddG, the tryptophan repressor protein gene trpR, the mycolate mutase (CM) / prephenate dehydratase (PD) bifunctional enzyme protein gene pheA or the prephenate dehydratase gene tyrA.

[0022] As a further technical solution, the genes related to biofilm transformation include one or more of cav1 gene, cav2 gene, tsr gene, srpB gene and plsC gene.

[0023] As a further technical solution, the cav1 gene and cav2 gene are derived from Homo sapiens,

[0024] As a further technical solution, the srpB gene is derived from Pseudomonas,

[0025] As a further technical solution, the tsr gene and plsC gene are derived from Escherichia coli.

[0026] As a further technical solution, the tnaA gene is derived from Escherichia coli,

[0027] As a further technical solution, the MaFMO gene is derived from Methylophagaaminisulfidivorans,

[0028] As a further technical solution, the Genebank ID of the yddG gene is 945942;

[0029] As a further technical solution, the Genebank ID of the trpR gene is 948917;

[0030] As a further technical solution, the Genebank ID of the pheA gene is 947081;

[0031] As a further technical solution, the Genebank ID of the tyrA gene is VWQ04783.1;

[0032] As a further technical solution, the Genebank ID of the tnaA gene is 948221;

[0033] As a further technical solution, the Genebank ID of the cav1 gene is CAA79476.1;

[0034] As a further technical solution, the Genebank ID of the cav2 gene is KAI2547554.1;

[0035] As a further technical solution, the Genebank ID of the srpB gene is WP_014003970.1;

[0036] As a further technical solution, the Genebank ID of the plsC gene is CAD6003390.1;

[0037] As a further technical solution, the nucleotide sequence of the MaFMO gene is shown in SEQ ID NO.1;

[0038] As a further technical solution, the nucleotide sequence of the tsr gene is shown in SEQ ID NO.2;

[0039] As a further technical solution, the promoter P tac70 The nucleotide sequence is shown in SEQ ID NO.3;

[0040] As a further technical solution, the promoter P J23100 The nucleotide sequence is shown in SEQ ID NO.4;

[0041] As a further technical solution, the promoter P tac3 The nucleotide sequence is shown in SEQ ID NO.5;

[0042] As a further technical solution, the promoter P 2.1 The nucleotide sequence is shown in SEQ ID NO.6.

[0043] As a further technical solution, Escherichia coli MG1655 was used as the initial strain, and the following af items were transformed to obtain:

[0044] a: The flavin monooxygenase gene MaFMO was integrated at the arsB locus;

[0045] b: knocking out one or more of the aromatic amino acid transporter gene yddG, the tryptophan repressor gene trpR, the mycolate mutase (CM) / prephenate dehydratase (PD) bifunctional enzyme protein gene pheA or the prephenate dehydratase gene tyrA in Escherichia coli MG1655;

[0046] c: Integration of the flavin monooxygenase gene MaFMO at the ldhA locus;

[0047] d: Integration of the tryptophanase gene tnaA at the yghWX site;

[0048] e: Integrate at least one gene related to biofilm modification at the poxB site

[0049] f: The expression vector pCOLADuet-1 was used to overexpress the tryptophan hydrolase gene tnaA and the flavin-containing monooxygenase gene MaFMO.

[0050] A fermentation method of a high-indigo-producing genetically engineered strain, using glycerol or glucose as a carbon source and tryptophan as a substrate, and using the high-indigo-producing genetically engineered strain for fermentation culture to produce indigo;

[0051] Among them, the initial concentration of tryptophan in the fermentation medium is 7 to 21 mM;

[0052] The fermentation conditions are:

[0053] Ferment at 37°C until OD 600 After the pH value is 0.6-0.8, the inducer IPTG is added to a final concentration of IPTG in the fermentation broth of 0.05-1.0 mM, and the induction culture is carried out at 18-30°C for at least 48 h.

[0054] As a further technical solution, after 48 hours of induction culture, feeding is carried out, and then culture is continued to 72 hours to end the fermentation;

[0055] The feeding scheme during the feeding is one or more of feeding A to C;

[0056] Feed A: Supplement with glucose to a final concentration of 4 g / L;

[0057] Feed B: supplemented with tryptophan to a final concentration of 7 mM;

[0058] Feed C: Surfactant was added to a final concentration of 5% (V / V).

[0059] As a further technical solution, the surfactant includes one or more of Tween-20, Tween-80 or Triton X-100.

[0060] Compared with the prior art, the present invention has the following beneficial effects:

[0061] (1) The present invention knocks out genes encoding relevant enzymes in the tryptophan competition pathway, and integrates the tryptophan enzyme gene tnaA and the flavin monooxygenase gene MaFMO into Escherichia coli in which genes encoding relevant enzymes in the tryptophan competition pathway have been knocked out, and at the same time optimizes the promoter of the tnaA expression frame, so that the recombinant Escherichia coli can efficiently express genes related to indigo production, thereby obtaining a full-genome recombinant strain that can produce indigo without adding antibiotics and inducers and only relying on the genome;

[0062] (2) Considering that the area and fluidity of the cell membrane may affect the attachment and accumulation of the product indigo, the present invention screens and verifies genes with different functions but all related to biofilm modification, and integrates them into the genome respectively to obtain recombinant strains with further improved indigo production;

[0063] (3) In order to further enhance the metabolic flux, the present invention introduces a recombinant plasmid containing the enhanced tryptophanase gene tnaA and the flavin monooxygenase gene MaFMO into the host to obtain a recombinant strain with further improved indigo production;

[0064] (4) In order to solve the problem of stagnation of indigo production during the fermentation process, glucose, tryptophan and surfactant were added to the system after 48 hours of fermentation, which had a significant effect on increasing indigo production.

[0065] In summary, the present invention obtains a genetically engineered strain and fermentation method for high indigo production with good stability, high synthesis yield and fast rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 A graph showing indigo production by fermentation of strains MG-Ind01 to MG-Ind06 in Example 2 of the present invention;

[0067] Figure 2 A graph showing indigo production by fermentation of strains MG-Ind06 to MG-Ind10 in Example 2 of the present invention;

[0068] Figure 3 A graph showing indigo production by fermentation of strain MG-Ind07 and strains MG-Ind11 to MG-Ind15 in Example 2 of the present invention;

[0069] Figure 4 Indigo and OD of MG-Ind11, MG-Ind15 and MG-Ind16 under different fermentation methods in Example 3 of the present invention 600 Plot of changes over time;

[0070] exist Figure 4 Middle, A: MG-Ind11, no feeding; B: MG-Ind16, no feeding; C: MG-Ind16, fed with glucose; D: MG-Ind16, fed with glucose and tryptophan; E: MG-Ind16, fed with glucose, tryptophan, and Tween-20; F: MG-Ind16, fed with glucose, tryptophan, and Tween-80; G: MG-Ind16, fed with glucose, tryptophan, and Triton X-100. DETAILED DESCRIPTION

[0071] The technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0072] In addition, it should be noted that the terms "comprises", "includes" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or apparatus.

[0073] In the present invention,

[0074] 1. The plasmid, endonuclease, PCR enzyme, column DNA extraction kit and DNA gel recovery kit used in the present invention are commercial products, and the specific operations are carried out according to the instructions of the kit. Colony PCR, nucleic acid agarose gel electrophoresis, protein SDS-PAGE gel electrophoresis, heat shock transformation, electrotransformation and preparation of competent cells and extraction and storage of bacterial genomes and other conventional operating methods are carried out according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0075] 2. Culture medium

[0076] (1) LB liquid medium: 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride.

[0077] (2) LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder.

[0078] (3) M9-YE medium: 6.8 g / L disodium hydrogen phosphate, 3 g / L potassium dihydrogen phosphate, 0.5 g / L sodium chloride, 1 g / L ammonium chloride, 5 g / L yeast extract, 0.4929 g / L magnesium sulfate heptahydrate, 0.02 g / L calcium chloride and 4 g / L glucose.

[0079] (4) Antibiotic concentration: kanamycin 50 mg / L, spectinomycin 50 mg / L.

[0080] 3. Fermentation production of indigo

[0081] The constructed strain was inoculated into 4 mL LB liquid medium without antibiotics or containing kanamycin, and cultured overnight at 37°C, 200 rpm for 9-12 h to obtain seed solution. 250-1000 μL of seed solution was inoculated into 25 mL fermentation medium, and cultured at 37°C, 200 rpm until OD 600 The concentration of IPTG was 0.6-1, and the final concentration was 0.2-1 mM IPTG. The induction culture was continued at 20-33°C and 200 rpm for at least 48 h.

[0082] 4. Detection of Indigo

[0083] The entire fermentation system was mixed and sampled (1 mL was sampled from each fermentation system), centrifuged at 12000 rpm for 10 min and the precipitate was collected. The precipitate was fully washed twice with 100% methanol and centrifuged at 12000 rpm for 5 min. After the methanol was fully evaporated, 2-10 mL DMSO was added and the precipitate was dissolved by ultrasonic disruption (when the extraction was completed, the precipitate had no color), centrifuged at 12000 rpm for 5 min and the supernatant was collected. The absorbance at 620 nm was detected by an enzyme marker, and the standard curve of the indigo standard was substituted to calculate the yield of indigo in the fermentation system.

[0084] 5. Strains The statistical table of the strains involved in the present invention is shown in Table 1.

[0085] Table 1 The strains involved in the present invention

[0086]

[0087]

[0088] 6. Primer:

[0089] The primers selected for gene editing of Escherichia coli strains are shown in Table 2.

[0090] Table 2 Statistics of primers selected for gene editing of Escherichia coli strains

[0091]

[0092]

[0093]

[0094]

[0095]

[0096] 7. In the present invention, the raw materials used are commercially available unless otherwise specified.

[0097] Example 1: Construction of engineered strains

[0098] The construction of a genetically engineered strain with high indigo production includes the following steps:

[0099] Step 1: Integrate single copy MaFMO

[0100] Taking the MG-Ind01 strain with the gene MaFMO integrated at the arsB site as an example, the construction steps of Escherichia coli with a single copy of MaFMO are introduced as follows:

[0101] Step 1-1: Using the E. coli MG1655 genome as a template, using arsB-up-F / R and arsB-down-F / R primers, amplify the upstream and downstream fragments of the arsB gene by PCR technology, and recover and purify the fragments by gel;

[0102] Construction of plasmid pCO-tac-tnaA-tac-MaFMO: First, the original promoters at positions 1 and 2 of the multiple cloning site of the pCOLADuet-1 vector were replaced with promoter P by two full plasmid amplifications using primers CO-tac-1F / R and CO-tac-2F / R. tac70 , obtain the vector pCO-tac-tac; then, construct the gene tnaA between the NcoI and NotI sites at the first position of the multiple cloning site of the expression vector pCO-tac-tac (linear vector amplified by primers CO-V1-F / R), and construct the gene maFMO between the NdeI and MfeI sites at the second position of the multiple cloning site of the expression vector pCO-tac-tac (linear vector amplified by primers CO-V2-F / R), to form the recombinant plasmid pCO-tac-tnaA-tac-maFMO;

[0103] Using plasmid pCO-tac-tnaA-tac-MaFMO as a template and primers B-tac70-MaFMO-F / R, the MaFMO gene expression cassette controlled by the tac70 promoter was amplified by PCR technology, and the fragment was purified by gel recovery; the fragment amplified by connecting the upstream and downstream fragments and the MaFMO gene expression cassette by overlapping PCR was used as the donor DNA fragment, recorded as donor DNA fragment 1;

[0104] Step 1-2 uses PCR amplification technology, with arsB-N23-F / R as primers, to replace the N23 sequence on the plasmid pcrEG with a specific 23bp sequence on the arsB gene (from the 388th base pair to the 410th base pair at the 5' end of the gene, GGGTTCAGTAAAGGCACTACGCT), and the PCR product uses DpnⅠ enzyme to remove the original plasmid template DNA, and uses the heat shock transformation method to transform it into the competent Escherichia coli JM109, and then spreads it on LB solid medium containing spectinomycin and cultures at 37°C for 8-12h (this embodiment is described by taking the culture time of 12h as an example), picks a single colony for expansion culture, extracts the plasmid and sequences it to obtain the plasmid pcrEG-arsB with targeting arsB;

[0105] Step 1-3: The pEcCpf1 plasmid was transferred into the competent cell of Escherichia coli MG1655, and the transformed bacterial solution was spread on LB solid medium containing kanamycin, and cultured in a 37° C. incubator for 8 to 12 hours (the culture time in this embodiment is 12 hours) to obtain the MG1655-pEcCpf1 strain;

[0106] Steps 1-4 prepare the MG1655-pEcCpf1 strain into electroporation competent cells:

[0107] Step 1-5: electrotransform the pcrEG-arsB plasmid and donor DNA fragment 1 into electrocompetent cells of Escherichia coli MG1655-pEcCpf1, spread them on LB solid medium containing kanamycin and spectinomycin, culture them at 37°C for 24 hours, perform PCR colony verification, and obtain positive clone colonies;

[0108] Step 1-6: Pick the positive clone colonies of step 1-5 into 4 mL LB liquid medium containing a final concentration of 10 mM rhamnose and 4 μL Kan, and culture at 37°C for 12 h to remove the pcrEG-arsB plasmid, and obtain Escherichia coli MG1655ΔarsB::tac70-MaFMO containing the pEcCpf1 plasmid and integrated with one copy of the MaFMO gene, which is used for the next round of gene editing;

[0109] Step 1-7: Inoculate the bacteria that have been successfully removed from the pcrEG-arsB plasmid into a liquid LB medium containing 5 g / L glucose and culture at 37°C, 200 rpm for 12 hours. Then, take about 1 μL of the bacterial liquid and streak it on a plate containing 5 g / L glucose and 10 g / L sucrose and culture it at 37°C for 12 hours. After removing the pEcCpf1 plasmid, the Escherichia coli MG1655ΔarsB::tac70-MaFMO with one copy of the MaFMO gene integrated is obtained, which is the MG-Ind01 strain.

[0110] Step 2: Knockout

[0111] Using CRISPR / Cpf1 gene editing technology, the following genetic modifications were performed:

[0112] (1) Knocking out the trpR gene encoding the tryptophan repressor protein TrpR in Escherichia coli MG1655 to obtain the MG-Ind02 strain;

[0113] (2) knocking out the pheA gene encoding the bifunctional enzyme mycolate mutase (CM) / prephenate dehydratase (PD) in the MG-Ind02 strain to obtain the MG-Ind03 strain;

[0114] (3) Deletion of the tyrA gene encoding prephenate dehydratase in the MG-Ind03 strain to obtain the MG-Ind04 strain

[0115] (4) Knocking out the yddG gene encoding the aromatic amino acid transporter YddG in the MG-Ind04 strain to obtain the MG-Ind05 strain;

[0116] The following is an example of the MG-Ind03 strain with knockout genes trpR and pheA to introduce the specific steps:

[0117] Step (1) using the Escherichia coli MG1655 genome as a template, using ΔtrpR-up-F / R and ΔtrpR-down-F / R primers, respectively amplifying the upstream and downstream fragments of the trpR gene by PCR technology, and recovering and purifying the fragments by gel recovery; connecting the upstream and downstream amplified fragments by overlapping PCR as a donor DNA fragment, recorded as donor DNA fragment 2;

[0118] Step (2) using PCR amplification technology, with trpR-N23-F / R as primers, the N23 sequence on the plasmid pcrEG is replaced with a specific 23bp sequence on the trpR gene (from the 68th base pair to the 90th base pair at the 5' end of the gene, TCGACCTGCTTAAGAATGCCTAC), the PCR product is treated with DpnⅠ enzyme to remove the original plasmid template DNA, and the product is transformed into the competent Escherichia coli JM109 using the heat shock transformation method, and then spread on LB solid medium containing spectinomycin and cultured at 37°C for 8 to 12 hours (this embodiment is described using the culture time of 12 hours as an example), then a single colony is picked for expansion culture, the plasmid is extracted and sequenced, and the plasmid pcrEG-trpR with targeting trpR is obtained;

[0119] Step (3) preparing the Escherichia coli MG1655ΔarsB::tac70-MaFMO strain containing the pEcCpf1 plasmid and integrated with one copy of the MaFMO gene into electroporation competent cells;

[0120] Step (4) electrotransform the pcrEG-trpR plasmid and the donor DNA fragment 2 into the electrotransformation competent cells of Escherichia coli MG1655ΔarsB::tac70-MaFMO, spread them on LB solid medium containing kanamycin and spectinomycin, culture at 37°C for 24h, perform PCR colony verification, and obtain positive clone colonies;

[0121] Step (5) The positive clone colonies of step (4) were picked into 4 mL LB liquid medium containing a final concentration of 10 mM rhamnose and 4 μL Kan, and cultured at 37° C. for 12 h to remove the pcrEG-trpR plasmid, thereby obtaining Escherichia coli MG1655ΔarsB::tac70-MaFMOΔtrpR containing the pEcCpf1 plasmid and the knockout trpR gene, which was used for the next round of knockout;

[0122] Step (6) The bacteria that have been successfully verified to have removed the pcrEG-trpR plasmid were inoculated into a liquid LB medium containing 5 g / L glucose, and cultured at 37°C, 200 rpm for 12 h. Then, about 5 μL of the bacterial liquid was streaked on a plate containing 5 g / L glucose and 10 g / L sucrose and cultured at 37°C for 12 h, thereby removing the pEcCpf1 plasmid and obtaining the Escherichia coli MG1655ΔarsB::tac70-MaFMOΔtrpR with the trpR gene knocked out, which is the MG-Ind02 strain;

[0123] Step (7) using the E. coli MG1655 genome as a template and ΔpheA-up-F / R and ΔpheA-down-F / R as primers, respectively amplifying the upstream and downstream fragments of pheA by PCR, recovering and purifying the fragments by gel, and connecting the upstream and downstream amplified fragments by overlapping PCR as donor DNA fragments, recorded as donor DNA fragment 3;

[0124] Step (8) using PCR amplification technology to replace the N23 sequence on the plasmid pcrEG with a specific 23 bp sequence on the pheA gene (from the 790th base pair to the 812th base pair at the 5' end of the gene, CAGGTACTGGAGCGTATTGAAGC), using pheA-N23-F / R as primers to obtain the plasmid pcrEG-pheA carrying the targeted pheA gene;

[0125] Step (9) The correctly sequenced plasmid pcrEG-pheA and donor DNA fragment 3 were electrotransformed into electrocompetent cells of the MG-Ind02 strain, spread on LB solid medium containing kanamycin and spectinomycin, cultured at 37° C. for 24 h, and PCR colony verification was performed;

[0126] Step (10) The positive clones verified in step (9) were picked into a 4 mL LB liquid test tube (containing rhamnose with a final concentration of 10 mM and 4 μL Kan), cultured at 37° C. for 12 h, and the pcrEG-pheA plasmid was removed to obtain the recombinant E. coli containing the plasmid pEcCpf1 for the next round of knockout;

[0127] Step (11) inoculating the bacteria that have been verified to have successfully removed the pCrEG-pheA plasmid into LB liquid culture medium containing 5 g / L glucose, and culturing at 37°C, 200 rpm for 12 h, then taking 1 μL of the above bacterial liquid and streaking it on a solid LB plate containing 5 g / L glucose and 10 g / L sucrose and culturing at 37°C for 12 h, thereby removing the pEcCpf1 plasmid and obtaining an engineered strain that has successfully knocked out the trpR gene and the pheA gene, named MG-Ind03 strain;

[0128] Step 3, using MG-Ind05 as the starting strain, a copy of the MaFMO gene expression cassette controlled by the tac70 promoter was integrated into the ldhA site to obtain strain MG-Ind06;

[0129] Step 4: Using MG-Ind06 as the starting strain, one copy of each of the promoters P was integrated into the yghWX site. tac70 , P J23100 , P tac3 , P 2.1 The tnaA gene expression cassette controlled by the strain MG-Ind07, strain MG-Ind08, ​​strain MG-Ind09 and strain MG-Ind10 were obtained.

[0130] Step 5: Using MG-Ind07 as the starting strain, a copy of the biofilm-related gene expression cassette controlled by the tac70 promoter was integrated into the poxB site.

[0131] When the biofilm-related gene was modified to be the cav1 gene, the strain MG-Ind11 was obtained;

[0132] When the biofilm-related gene was modified to be the cav2 gene, the strain MG-Ind12 was obtained;

[0133] When the biofilm-related gene was modified to be the tsr gene, the strain MG-Ind13 was obtained;

[0134] When the biofilm-related gene was modified to be srpB gene, strain MG-Ind14 was obtained;

[0135] When the biofilm-related gene was transformed into the plsC gene, the strain MG-Ind15 was obtained.

[0136] Step 6: Introduce the recombinant expression vector pCO-tac-tnaA-tac-MaFMO containing the tnaA gene and the MaFMO gene into the strain MG-Ind11 to obtain the strain MG-Ind16.

[0137] Example 2: Shake flask culture of strains

[0138] 1. Shake flask culture method

[0139] MG-Ind01 to MG-Ind16 strains were inoculated into 4 mL LB liquid medium without antibiotics (only MG-Ind16 contained kanamycin) and cultured overnight at 37°C and 200 rpm for 9 to 12 h to obtain seed solution. 250 to 1000 μL of seed solution was inoculated into 25 mL fermentation medium and cultured at 37°C and 200 rpm until OD 600 The concentration of IPTG was 0.6-0.8, and only the shake flask of MG-Ind16 was induced by adding IPTG with a final concentration of 0.1-1 mM. The temperature of all strains was lowered to 20-33°C and the induction culture was continued at 200 rpm for at least 48 h.

[0140] The engineered bacteria were fermented using M9-YE medium, and the medium formulas were as follows:

[0141] Fermentation medium M9-YE: 6.8 g / L disodium hydrogen phosphate, 3 g / L potassium dihydrogen phosphate, 0.5 g / L sodium chloride, 1 g / L ammonium chloride, 5 g / L yeast extract, 0.4929 g / L magnesium sulfate heptahydrate, 0.02 g / L calcium chloride and 4 g / L glucose.

[0142] The indigo content in the fermentation system was tested and the indigo yield in the fermentation system was calculated. The results are shown in Figure 1-3 ;

[0143] 2. Results Analysis

[0144] 1. From Figure 1 It can be seen that after 48 hours of induced expression, the indigo fermentation yields of strains MG-Ind1, MG-Ind2, MG-Ind3, MG-Ind4, MG-Ind5 and MG-Ind6 were 128, 192, 230, 265, 528 and 603 mg / L, respectively, among which the strain MG-Ind6 with MG1655ΔarsB::tac70-MaFMOΔtrpRΔpheAΔtyrAΔyddGΔldhA::tac70-MaFMO had the highest yield.

[0145] 2. From Figure 2 It can be seen that the integration is carried out by different promoters P tac70 , P J23100 , P tac3 or P 2.1 The expression of the tryptophanase gene tnaA controlled by the promoter can affect the yield of indigo, and the yields are 654, 626, 410 and 238 mg / L respectively. tac70 The control expression strain MG-Ind07 had the highest yield.

[0146] 3. From Figure 3It can be seen that different genes related to biofilm modification will also affect the yield of indigo. When the genes related to biofilm modification are cav1 gene, cav2 gene, tsr gene, srpB gene or plsC gene, the indigo yields are 1039, 858, 892, 978 and 789 mg / L respectively. Therefore, the most suitable membrane engineering gene is cav1, and the optimal strain is MG-Ind11, that is, Escherichia coli MG1655ΔarsB::tac70-MaFMOΔtrpRΔpheAΔtyrAΔyddGΔldhA::tac70-MaFMOΔyghWX::tac70-tnaAΔpoxB::tac70-cav1.

[0147] Example 3: Staged shake flask fermentation culture

[0148] 1. Staged shake flask fermentation culture method

[0149] Considering that the carbon source and substrate tryptophan were almost exhausted after 48 hours, in order to further optimize the fermentation conditions, prolong the effective time for the strain to grow, metabolize and produce the target product, and at the same time increase the nonspecific permeability of the cells and optimize the transport and exchange of substrates and products, the strain MG-Ind16 was fermented according to the shake flask culture method described in Example 2. After 48 hours of fermentation, the culture was carried out according to the following feeding methods until the end of the culture. During the culture process, samples were taken at different times to detect the yield of indigo in the fermentation system and OD 600 The changes in the fermentation system were also investigated, and the yield of indigo in the fermentation system after the fermentation was completed was determined. The results are shown in Figure 4 .

[0150] (1) Glucose was added to the system to a final concentration of 4 g / L, and then cultured for 24 h. The test results are shown in Figure 4 (C);

[0151] (2) Glucose was added to the system to a final concentration of 4 g / L, and tryptophan was supplemented to a final concentration of 7 mM; the culture was then continued for 24 h. The test results are shown in Figure 4 (D);

[0152] (3) Glucose was added to the system to a final concentration of 4 g / L, tryptophan was supplemented to a final concentration of 7 mM, and surfactant Tween-20 was added to a final concentration of 5% (V / V), and then cultured for 24 h. The test results are shown in Figure 4 (E);

[0153] (4) Glucose was added to the system to a final concentration of 4 g / L, tryptophan was supplemented to a final concentration of 7 mM, and surfactant Tween-80 was added to a final concentration of 5% (V / V), and then cultured for 24 h. The test results are shown in Figure 4(F);

[0154] (5) Glucose was added to the system to a final concentration of 4 g / L, tryptophan was supplemented to a final concentration of 7 mM, and the surfactant Triton X-100 was added to a final concentration of 5% (V / V), and then cultured for 24 h. The test results are shown in Figure 4 (F);

[0155] Also make the following comparisons:

[0156] (6) The strain MG-Ind11 was fermented using the shake flask culture method described in Example 2. During the culture process, samples were taken at different times to measure the indigo content and OD in the fermentation system. 600 Changes, results see Figure 4 (A);

[0157] (7) The strain MG-Ind16 was fermented using the shake flask culture method described in Example 2. During the culture process, samples were taken at different times to measure the indigo content and OD in the fermentation system. 600 Changes, results see Figure 4 (B).

[0158] 2. Results Analysis

[0159] from Figure 4 (A) It can be seen that strain MG-Ind11 produced 1,039 mg / L of indigo after 48 hours of shake flask culture when the initial tryptophan content was 14 mM;

[0160] from Figure 4 (B) It can be seen that strain MG-Ind16 produced 1,265 mg / L of indigo after 48 hours of shake flask culture when the initial tryptophan content was 14 mM, which was 22% higher than that of strain MG-Ind11, indicating the importance of the expression of the enzyme pair TnaA and MaFMO for the production of indigo;

[0161] from Figure 4 (C) It can be seen that when the strain MG-Ind16 was cultured in a shake flask for 48 hours and glucose was added to a final concentration of 4 g / L, the indigo production increased slightly to 1,334 mg / L. 600 The significant increase indicated that the two-stage culture had a positive effect on indigo production;

[0162] from Figure 4 (D) It can be seen that: when the strain MG-Ind16 was cultured in a shake flask for 48 hours, glucose was added to a final concentration of 4 g / L, and tryptophan was supplemented to a final concentration of 7 mM. The indigo production was slightly increased to 1,697 mg / L, and the indigo production was further increased;

[0163] from Figure 4 (E) It can be seen that when the strain MG-Ind16 was cultured in a shake flask for 48 hours, glucose was added to a final concentration of 4 g / L, tryptophan was supplemented to a final concentration of 7 mM, and surfactant Tween-20 was added to a final concentration of 5% (V / V), which further increased the indigo production to 1,950 mg / L.

[0164] from Figure 4 (F) It can be seen that when the strain MG-Ind16 was cultured in a shake flask for 48 hours, glucose was added to a final concentration of 4 g / L, tryptophan was supplemented to a final concentration of 7 mM, and surfactant Tween-80 was added to a final concentration of 5% (V / V), and the indigo production was 1,873 mg / L;

[0165] from Figure 4 (G) It can be seen that when the strain MG-Ind16 was cultured in a shake flask for 48 hours, glucose was added to a final concentration of 4 g / L, tryptophan was supplemented to a final concentration of 7 mM, and the surfactant Triton X-100 was added to a final concentration of 5% (V / V), and the indigo production was 1,896 mg / L;

[0166] It can be seen that the strain MG-Ind16 constructed in the present invention has certain advantages in yield. After optimizing the fermentation conditions (supplementing carbon source and substrate, adding surfactant), the yield is significantly improved, which provides a reference for the subsequent development of more advantageous engineering strains.

[0167] The above-described embodiments are only preferred embodiments of the present invention, and are not exhaustive of the feasible implementations of the present invention. For those skilled in the art, any obvious changes made thereto without departing from the principles and spirit of the present invention should be considered to be included in the scope of protection of the claims of the present invention.

Claims

1. A genetically engineered strain for high indigo production, characterized in that: Using Escherichia coli as the initial strain, the following transformations were performed to obtain: A: knocking out at least one gene related to the competition pathway for tryptophan synthesis and metabolism in the Escherichia coli, B: express at least one gene encoding an enzyme in the biosynthetic pathway of indigo; C: Expression of at least one gene associated with biofilm modification.

2. A genetically engineered strain for high indigo production according to claim 1, characterized in that: Using E. coli as the initial strain, D transformation was also performed; D: The expression vector pCO-tac-tac is used to overexpress at least one gene encoding an enzyme in the biosynthetic indigo pathway.

3. A genetically engineered strain for high indigo production according to claim 1 or 2, characterized in that: The genes encoding enzymes in the pathway related to biosynthesis of indigo include the tryptophanase gene tnaA and the flavin-containing monooxygenase gene MaFMO.

4. A genetically engineered strain for high indigo production according to claim 3, characterized in that: In item B, at least one gene encoding an enzyme in the biosynthetic pathway related to indigo is expressed, including one or more of the B1-3 schemes; B1: integration of the flavin monooxygenase gene MaFMO at the arsB locus; B2: integration of the flavin monooxygenase gene MaFMO at the ldhA locus; B3: Integration of the tryptophanase gene tnaA at the yghWX site.

5. A genetically engineered strain for high indigo production according to claim 1, characterized in that: The genes related to the competition pathway for tryptophan synthesis and metabolism include one or more of the aromatic amino acid transporter gene yddG, the tryptophan repressor gene trpR, the mycolate mutase / prephenate dehydratase bifunctional enzyme protein gene pheA or the prephenate dehydratase gene tyrA.

6. A genetically engineered strain for high indigo production according to claim 1, characterized in that: The genes related to biofilm transformation include one or more of cav1 gene, cav2 gene, tsr gene, srpB gene and plsC gene.

7. A genetically engineered strain for high indigo production according to claim 6, characterized in that: The cav1 gene and cav2 gene are derived from Homo sapiens, The srpB gene is derived from Pseudomonas, The tsr gene and plsC gene are derived from Escherichia coli.

8. The high indigo-producing genetically engineered strain according to claim 1, characterized in that: Using Escherichia coli MG1655 as the initial strain, the following af items were transformed to obtain: a: The flavin monooxygenase gene MaFMO was integrated at the arsB locus; b: knocking out one or more of the aromatic amino acid transporter gene yddG, the tryptophan repressor gene trpR, the mycolate mutase / prephenate dehydratase bifunctional enzyme protein gene pheA or the prephenate dehydratase gene tyrA in Escherichia coli MG1655; c: Integration of the flavin monooxygenase gene MaFMO at the ldhA locus; d: Integration of the tryptophanase gene tnaA at the yghWX site; e: Integrate at least one gene related to biofilm modification at the poxB locus; f: The expression vector pCOLADuet-1 was used to overexpress the tryptophan hydrolase gene tnaA and the flavin-containing monooxygenase gene MaFMO.

9. A fermentation method of a genetically engineered strain with high indigo production, characterized in that: Using glycerol or glucose as a carbon source and tryptophan as a substrate, the high-indigo-producing genetically engineered strain according to any one of claims 1 to 8 is used for fermentation culture to produce indigo; Among them, the initial concentration of tryptophan in the fermentation medium is 7 to 21 mM; The fermentation conditions are: Ferment at 37°C until OD 600 After the pH value is 0.6-0.8, the inducer IPTG is added to a final concentration of IPTG in the fermentation broth of 0.05-1.0 mM, and the induction culture is carried out at 18-30°C for at least 48 h.

10. The fermentation method of a genetically engineered strain with high indigo production according to claim 9, characterized in that: After 48 h of induction culture, feeding was performed, and then culture was continued for 72 h to terminate the fermentation; The feeding scheme during the feeding is one or more of feeding A to C; Feed A: Supplement with glucose to a final concentration of 4 g / L; Feed B: supplemented with tryptophan to a final concentration of 7 mM; Feed C: Surfactant was added to a final concentration of 5% by volume.

Images