Construction and application of plasmid-free and auxotrophy-free L-tryptophan production strain
By introducing anti-feedback mutants and CRISPR-associated-transponses gene editing system in E. coli, we constructed a tryptophan high-efficiency synthetic engineering strain without plasmids and no nutritional defects, solving the problems of insufficient L-tryptophan production and unstable fermentation in the prior art, and achieving efficient, green and stable tryptophan production.
Patent Information
- Application Number
- CN202510188239.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-20
- Publication Date
- 2025-06-06
AI Technical Summary
In the prior art, in the absence of plasmid expression, antibiotics, and inducers, the yield of L-tryptophan is insufficient and the fermentation level is unstable, making it difficult to achieve efficient, green and stable production.
By introducing the anti-feedback mutant serAH344A/N364A and using the CRISPR-associated-transponses gene editing system, a tryptophan efficient synthesis engineered strain without plasmids and without nutritional defects was constructed, specifically including integrating and expressing specific gene combinations on the genome of E. coli, optimizing metabolic pathways and transport systems.
In the absence of plasmid expression, antibiotics and inducers, the efficient production of L-tryptophan was achieved, with the total output reaching 43g/L and the sugar acid conversion rate increased to 0.180g/g, which significantly improved the fermentation level and stability.
Smart Images

Figure CN120098874A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the construction and application of a plasmid-free and auxotrophic L-tryptophan production strain, belonging to the technical field of bioengineering. Background Art
[0002] L-tryptophan is an aromatic amino acid and an essential amino acid for the human body. As a precursor, it can be metabolized to produce a variety of important physiologically active substances and is widely used in food, health products, medicine, animal feed, etc. At present, the production of tryptophan by fermentation in microbial cell factories has been widely used, but it also faces risks such as plasmid loss, antibiotic and inducer residues. The use of synthetic biology technology to develop the next generation of plasmid-free and nutritionally defective tryptophan industrial production strains has become the mainstream research.
[0003] According to literature reports, the synthetic pathway from glucose to tryptophan requires more than twenty steps, which can be mainly divided into three modules: the central carbon metabolic pathway, the shikimic acid pathway, and the chorismate pathway. The central carbon metabolic pathway includes glycolysis, the citric acid cycle, and the pentose phosphate pathway. This module provides the common precursors of aromatic amino acids, phosphoenolpyruvate (PEP) and erythrulose-4-phosphate (E4P). The two condense to form 3-deoxy-α-arabinoheptulose-7-phosphate (DAHP). DAHP sequentially generates shikimic acid and chorismate (CHA) through the shikimic acid pathway, and finally generates L-tryptophan (L-trp) from CHA. The strategies for strain modification mainly include enhancing precursor supply, relieving feedback inhibition of key enzymes, optimizing transport systems, blocking competitive pathways, reducing power balance, and reducing acetate production. For example, Xiong Bo et al. theoretically reduced the consumption of PEP by modifying the glucose transport system (PTS), so that more carbon flux flowed to tryptophan synthesis; Guo Liang et al. overexpressed the tryptophan export protein YddG, which increased the yield by nearly 30%.
[0004] Compared with plasmid expression, genomic integration expression is stable and controllable, and can also reduce the metabolic burden of the strain. At present, the CRISPR-Cas9 gene editing system is widely used in the construction of genome-integrated expression tryptophan production strains. This tool is convenient and efficient for gene knockout or integration of small gene fragments (≤4kb), but it is difficult to complete the integration of very large fragments (>10kb). At present, under fermentation conditions without plasmid expression, antibiotics, inducers, and additional substances added (such as citric acid, additional addition of certain amino acids, etc.), the production of tryptophan is mostly below 40g / L, and the overall fermentation level needs to be further strengthened.
[0005] Therefore, further optimizing the synthesis of L-tryptophan, transforming the starting strain based on plasmid expression into a genome-integrated expression strain without nutritional deficiencies, reducing the metabolic burden of the strain, and making fermentation production more green, economical, stable and controllable are technical issues that need to be solved urgently. Summary of the invention
[0006] In order to solve the above technical problems, the present invention uses anti-feedback mutants to reduce the inhibition of substrates on enzymes in metabolic pathways, enhances the target metabolic flow, and uses the CRISPR-associated-transponses gene editing system to construct a plasmid-free and nutritionally defective tryptophan efficient synthesis engineering strain.
[0007] The first technical solution provided by the present invention is an L-tryptophan production engineering bacterium based on plasmid-free expression, using Escherichia coli as a host, and integrating and expressing aroG encoding a DAHP synthase mutant in the genome of the host. S211F Gene, trpE encoding an anthranilate synthase mutant Q71K / S94N / C465Y genes, the structural genes trpABCD genes in the tryptophan operon, and the serA gene encoding a glycerol phosphate dehydrogenase mutant H344A / N364A A combination of genes.
[0008] In certain embodiments, the integrated copy number of the combined gene is 1-4.
[0009] In certain embodiments, the site of combined gene integration includes an intergenic spacer sequence approximately 50 bp downstream of one or more targeted positions of panC, ompW, rluF, cspA, and eda.
[0010] In certain embodiments, the integrated copy number of the combined gene is 3, and the integration sites are intergenic spacer sequences approximately 50 bp downstream of the panC, ompW and rluF targeting positions, respectively.
[0011] In certain embodiments, aroG S211F gene, trpE Q71K / S94N / C465Y gene, trpABCD gene and serA H344A / N364A The nucleotide sequences of the genes are shown in SEQ ID NOs: 1 to 4, respectively.
[0012] In some embodiments, the combination gene also includes a gene driving the aroG S211F Gene expression is driven by the promoter Ptac and trpE Q71K / S94N / C465Y The promoter Ptac of gene and trpABCD gene expression.
[0013] Further, the combined gene is Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A The nucleotide sequence of the combined gene is shown in SEQ ID NO:5.
[0014] In certain embodiments, the engineered E. coli TS-0 is used as a host, and the engineered E. coli TS-0 is E. coli KW3110 in which the trpR gene, the pheA gene and the tnaAB gene are knocked out.
[0015] The second technical solution provided by the present invention is a method for constructing an L-tryptophan production engineering bacterium based on plasmid-free expression, wherein the method uses the CRISPR-associated-transponses system to perform multi-site targeted integration of a combination gene in the Escherichia coli genome, wherein the combination gene includes aroG encoding a DAHP synthase mutant. S211F Gene, trpE encoding an anthranilate synthase mutant Q71K / S94N / C465Y genes, the structural genes trpABCD genes in the tryptophan operon, and the serA gene encoding a glycerol phosphate dehydrogenase mutant H344A / N364A Gene.
[0016] In certain embodiments, the E. coli is an engineered E. coli TS-0, and the engineered E. coli TS-0 is E. coli KW3110 with four genes knocked out, and the knocked-out genes include trpR, pheA, tnaA and tnaB.
[0017] In some embodiments, the combination gene is Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A The nucleotide sequence of the combined gene is shown in SEQ ID NO:5.
[0018] In certain embodiments, the integrated copy number of the combined gene is 1-4.
[0019] In certain embodiments, the site of combined gene integration includes an intergenic spacer sequence approximately 50 bp downstream of one or more targeted positions of panC, ompW, rluF, cspA, and eda.
[0020] In certain embodiments, the integrated copy number of the combined gene is 3, and the integration sites are intergenic spacer sequences approximately 50 bp downstream of the panC, ompW and rluF targeting positions, respectively.
[0021] The third technical solution provided by the present invention is a method for producing L-tryptophan by fermentation, wherein the method is to produce L-tryptophan by fermentation using the engineered bacteria described in the first technical solution.
[0022] In certain embodiments, the engineered bacteria described in the first technical solution are activated and then introduced into a reaction system using glucose as a carbon source, and fermented at 37° C. and 200 rpm for no less than 48 hours.
[0023] In certain embodiments, the reaction system comprises 9.6 g·L -1 KH 2 PO 4 , 24g·L -1 K 2 HPO 4 , 10g·L -1 Glucose, 5 g L -1 (NH 4 ) 2 SO 4 , 4g·L -1 Peptone, 2 g L -1 Yeast powder, 1g·L -1 MgSO 4 7H 2 O, 2g·L -1 Citric acid, 3 mL trace element solution. Ammonia water adjusted to pH 7.2. Trace element solution: 0.75 g·L -1 CoSO 4 7H 2 O, 15g·L - 1 ZnSO 4 7H 2 O, 5g·L -1 CuSO 4 ·5H 2 O, 2g·L -1 Al2(SO 4 ) 3 18H 2 O, 5g·L -1 FeSO 4 7H 2 O, 4g·L - 1 MnSO 4 ·H 2 O, 3g·L -1 Na 2 MoO 4 ·2H 2 O, 2.5 g·L -1 NiSO 4 6H 2O, and 0.5 g·L -1 H 3 BO 3 .
[0024] In certain embodiments, the reaction system comprises 15 g·L -1 K 2 HPO 4 , 7.5 g·L -1 Glucose, 2 g L - 1 MgSO 4 7H 2 O, 2g·L -1 Yeast powder, 2 g L -1 Citric acid, 1.6 g·L -1 (NH 4 ) 2 SO 4 , 0.0129 g·L -1 CaCl 2 , 0.075 g·L -1 FeSO 4 7H 2 O and 3mL trace element solution.
[0025] In certain embodiments, the pH value of the reaction system is maintained at 6.5-7.2, and glucose solution is added to the reaction system every 8 hours.
[0026] Furthermore, the concentration of the glucose solution is 50% (w / v) or 800 g·L -1 .
[0027] The fourth technical solution provided by the present invention is the use of the Escherichia coli engineered bacteria described in the first technical solution, the method described in the second technical solution or the method described in the third technical solution in the production of L-tryptophan.
[0028] The technical effects of the present invention are as follows:
[0029] The present invention provides a method for introducing a feedback resistant mutant serA H344A / N364A The engineered strain ZH-3 constructed by combining the CRISPR-associated-transponses system for genome integration can significantly provide L-tryptophan fermentation levels. After 35 hours of cultivation in a 3L fermenter, the total L-tryptophan production reached 43g / L, and the sugar-acid conversion rate increased to 0.180g / g. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 Shake flask validation of strain optimization for a combination of enzyme mutants resistant to feedback inhibition.
[0031] Figure 2 Shake flask verification of strains with 1 to 4 copies of genome integration.
[0032] Figure 3 The fermentation results of the integrated strain ZH-3 in a 3L fermenter. DETAILED DESCRIPTION
[0033] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.
[0034] Test method:
[0035] Detect OD with a spectrophotometer 600 Characterization of cell density: After diluting the fermentation broth to an appropriate multiple, measure the absorbance at 600nm, OD 600 = absorbance at 600nm*dilution multiple;
[0036] Glucose concentration determination: 1 mL of fermentation liquid was centrifuged at 12000 r / min for 2 min to obtain the supernatant, which was diluted to an appropriate multiple and the glucose concentration (g / L) was detected using an M-100 biosensor analyzer (Shenzhen Silman Technology Co., Ltd.). Residual sugar value = test value * dilution multiple;
[0037] L-Tryptophan content: Agilent high performance liquid chromatograph was used for detection, the detection conditions were C18 column (250mm×4.6mm, 5μm), and the mobile phase was 0.3g / L KH 2 PO 4 Aqueous solution: methanol (90:10), column temperature 39°C, flow rate 1 mL / min, detection wavelength 278 nm.
[0038] Fermentation broth pretreatment: The fermentation broth was centrifuged at 12000r / min for 2min to obtain the supernatant, and the supernatant sample was appropriately diluted. The diluted sample was filtered with a 0.22μm filter head, and the treated sample was used for high performance liquid chromatography detection. The measured value*dilution factor represented the extracellular L-tryptophan concentration.
[0039] Take 5OD of bacteria (take the fermentation liquid volume 5 / OD 600 *1000ul centrifugation, the bacterial precipitate is 5OD bacteria), resuspended with 1mL sterile water, ultrasonically broken for 10min at 110w power, then centrifuged at 12000r / min for 2min, the broken supernatant was taken, filtered with a 0.22μm filter head, and the treated sample was used for high performance liquid chromatography detection, with (measured value / 5)*OD 600 Represents the intracellular L-tryptophan concentration.
[0040] The raw materials used in the embodiment:
[0041] The culture media involved in the following examples: except for yeast powder and peptone purchased from Oxoid, the rest of the reagents were purchased from Sinopharm Group.
[0042] 1. Seed culture medium: 9.6 g·L -1 KH 2 PO 4 , 24g·L -1 K 2 HPO 4 , 10g·L -1 Glucose, 5 g L -1 (NH 4 ) 2 SO 4 , 15g·L -1 Yeast powder, 2 g L -1 Citric acid, 1 g·L -1 MgSO 4 7H 2 O. Ammonia water was adjusted to pH 7.2.
[0043] 2. Shake flask culture medium: 9.6 g·L -1 KH 2 PO 4 , 24g·L -1 K 2 HPO 4 , 10g·L -1 Glucose, 5 g L -1 (NH 4 ) 2 SO 4 , 4g·L -1 Peptone, 2 g L -1 Yeast powder, 1g·L -1 MgSO 4 7H 2 O, 2g·L -1 Citric acid, 3 mL of trace element solution. Ammonia water adjusted to pH 7.2.
[0044] 3. Trace element liquid: 0.75g·L -1 CoSO 4 7H 2 O, 15g·L -1 ZnSO 4 7H 2 O, 5g·L -1 CuSO 4 ·5H 2 O, 2g·L -1 Al 2 (SO 4 ) 3 18H 2 O, 5g·L-1 FeSO 4 7H 2 O, 4g·L -1 MnSO 4 ·H 2 O, 3g·L -1 Na 2 MoO 4 ·2H 2 O, 2.5 g·L -1 NiSO 4 6H 2 O, and 0.5 g·L -1 H 3 BO 3 .
[0045] 4. 3L fermentation tank medium: 15g·L -1 K 2 HPO 4 , 7.5 g·L -1 Glucose, 2 g L -1 MgSO 4 7H 2 O, 2g·L -1 Yeast powder, 2 g L -1 Citric acid, 1.6 g·L -1 (NH 4 ) 2 SO 4 , 0.0129 g·L -1 CaCl 2 , 0.075 g·L -1 FeSO 4 7H 2 O and 3 mL of trace element solution. Ammonia water adjusted to pH 7.2. Feed medium: 800 g·L -1 glucose.
[0046] The strains and plasmids involved in the following examples are:
[0047] 1. The genetic background of E. coli TS is E. coli W3110 (ATCC27325, wild type), △trpR, △pheA, △tnaAB, pBR322-Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y-trpABCD-serA, i.e. Escherichia coli FB-04, has been disclosed in the following reference: Lina, Liu, Sheng, Chen, Jing, Wu, Phosphoenolpyruvate: glucose phosphotransferase system modification increases the conversion rateduring L-tryptophan production in Escherichia coli. [J]. J Ind Microbiol Biotechnol, 2017, 44: 0.
[0048] 2. The CRISPR-associated transposase system involves four plasmids, including the plasmid pDonor (ampicillin resistance r , containing crRNA array for genome targeting, transposase recognition sequences LE and RE, and donor DNA), plasmid pTnsABC (kanamycin resistance Kan r , used to express transposases TnsAB and TnsC), plasmid pQCascade (spectinomycin resistance Spe r , used to express the fusion of Cas protein and transposase TniQ-Cas678) and a plasmid pCutamp (ampramycin resistance Apr r and sucrose lethal gene sacB, containing N20 sequence for AmpR promoter, for targeted cutting of pTnsABC, pQCascade and pDonor) for plasmid elimination. The specific sequence information of plasmid is disclosed in the following references: Yiwen, Zhang, Xiaoman, Sun, Qingzhuo, Wang et al. Correction to Multicopy Chromosomal Integration Using CRISPR-Associated Transposases. [J]. ACS Synth Biol, 2020, 9: 0.
[0049] Example 1 Combination Optimization of Anti-Feedback Inhibition Enzymes Related to Tryptophan Synthesis
[0050] Feedback inhibition plays an important role in regulating metabolic flux. Removing feedback inhibition of key enzymes or enhancing the expression of key enzymes can promote product synthesis. There are three key enzymes with feedback inhibition that have been widely studied in the L-tryptophan biosynthesis pathway of Escherichia coli, including DAHP synthase, anthranilate synthase and 3-phosphoglycerate dehydrogenase, which are encoded by aroG, trpE and serA, respectively.
[0051] In the starting strain Escherichia coli TS, several key enzymes related to the L-trp biosynthesis pathway were overexpressed in the form of plasmids to degrade the feedback mutant aroG S211F , wild-type serA and mutant trpE Q71K / S94N / C465Y .
[0052] The mutant of the enzyme was constructed by a pair of primers containing point mutation bases and amplifying the entire plasmid using the megawhop method. The plasmid after sequencing was correctly introduced into the strain TS-0, which does not contain the plasmid pBR322-Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA TS strain.
[0053] Based on strain TS, mutant serA was selected according to literature reports. H344A / N364A Replace the wild-type serA to obtain strain TS-1. The specific process is as follows:
[0054] The entire original plasmid was circularly amplified twice by two pairs of primers, and the mutant base was introduced into the serA coding frame to obtain the plasmid pBR322-Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A , the mutation site primer sequence (5'-3') is as follows:
[0055] H344A-F:TGATGCACATCGCCGAAAACCGTCCGGGCG;
[0056] H344A-R:GGACGGTTTTCGGCGATGTGCATCAGACGACGCC;
[0057] N364A-F:CCGAGCAGGGCGTCGCCATCGCCGCCGCAATATCTGC;
[0058] N364A-R: GATATTGCGCCGGCGATGGCGACGCCCTGCTCGGCGAAG.
[0059] The correctly sequenced plasmid pBR322-Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A It was introduced into strain TS-0 to obtain strain TS-1.
[0060] The strains TS-1 and TS were streaked on solid LB plates, and then single colonies were picked into 10 mL LB liquid medium and cultured at 37°C, 200 rpm for 10 h. Then, 2‰ (v / v) of the seed culture inoculum was transferred to 50 mL shake flask fermentation medium and cultured at 37°C, 200 rpm for 48 h. The pH value was maintained at 6.5-7.2 by adding 100% ammonia water, and an appropriate amount of glucose solution (50%, w / v) was added every 8 h.
[0061] like Figure 1 As shown in the shake flask results, the biomass of TS-1 decreased by about 45% and the yield of L-trp decreased by 15% compared with TS. However, the unit biomass yield of TS-1 strain increased by about 60%, indicating that the introduction of serA H344A / N364A It may be detrimental to the growth of the strain, but it improves the strain's ability to synthesize L-trp.
[0062] Based on strain TS-1, the anti-feedback trpE S40F and trpE A63V Replaces the mutant trpE in TS-1 Q71K / S94N / C465Y , and obtained TS-2 and TS-3 strains. The specific construction method is as follows:
[0063] First, the mutant trpE in the original plasmid Q71K / S94N / C465Y The wild-type trpE of E. coli was replaced by one-step cloning, and then the entire original plasmid was circularly amplified using two pairs of primers to introduce the mutant base into the trpE coding frame. The primer sequences (5'-3') of the mutation site are as follows:
[0064] S40F-F:GCAACGCTGCTGCTGGAATTCGCAGATATCGACAGCAAAGATG;
[0065] S40F-R:ATCATCTTTGCTGTCGATATCTGCGAATTCCAGCAGCAGCGTTGC;
[0066] A63V-F:AGTGCGCTGCGCATTACAGTATTAGGTGACACTGTCACAATTAAGGCG;
[0067] A63V-R:CGCCTTAATTGTGACAGTGTCACCTAATACTGTAATGCGCAGCGCACT.
[0068] The correctly sequenced plasmid pBR322-Ptac-aroG S211F -Ptac-trpE S40F-trpABCD-serA H344A / N364A , plasmid pBR322-Ptac-aroG S211F -Ptac-trpE A63V -trpABCD-serA H344A / N364A They were respectively introduced into strain TS-0 to obtain strains TS-2 and TS-3.
[0069] like Figure 2 As shown, the shake flask results showed that compared with TS-1, the growth of TS-2 and TS-3 was not affected, and the production of L-trp increased by 2.3% and decreased by 54.2%, respectively.
[0070] Considering that TS-1 has more stable production performance, we used aroG in subsequent studies. S211F ,trpE Q71K / S94N / C465Y -trpABCD and serA H344A / N364A As a combinatorial expression cassette.
[0071] The specific combination of the expression cassette is Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A , serA is regulated by the original promoter in Escherichia coli, the expression cassette sequence size is 10056 bp, and the nucleotide sequence is shown in SEQ ID NO.5.
[0072] Example 2 Construction of L-trp plasmid-free expression strain based on multi-site genome targeted integration of CRISPR-associated-transponses system.
[0073] The CRISPR-associated transposase system is mainly composed of the crRNA-guided complex Cascade, transposase proteins TniQ and TnsABC, and donor DNA of variable length. It achieves multi-site targeting in the genome of Gram-negative bacteria by designing crRNA arrays, thereby completing genome-specific site integration independent of homologous recombination.
[0074] First, prepare the electroporation competent state of strain TS-0, and then introduce 500 ng of plasmid pQCascade and plasmid pTnsABC into strain TS-0 by electroporation at 2500 V. After plating, culture the strain at 37°C for 12 h, pick a single colony and culture it at 37°C and 200 rpm for 8 h. After collecting the cells and verifying the plasmid enzyme digestion, the positive transformant TS-01 was obtained.
[0075] Construct a gene containing 8 crRNAs and the donor DNA is Ptac-aroGS211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A The specific steps are as follows:
[0076] The pDonor backbone fragment containing 20 bp homologous sequence (containing 8 crRNAs, the nucleotide sequence of 8 crRNAs is shown in SEQ ID NO.6) and the donor DNA fragment (Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A ), the primer sequences are as follows.
[0077] Amplify the donor DNA fragment, the template is strain TS-1:
[0078] cargo-F:CGAGATCTCGATCCCGCGAAATCTATAAAAATAGGCGTATCACGAGGCCCTT TC;
[0079] cargo-R:GGCTTTGTTAGCAGCCGGATCTCAGACTCTAGAGCAGCAACGCGGCAAC.
[0080] Amplify the pDonor backbone fragment, using the plasmid pDonor as template:
[0081] 8site donor-F:TTGCTGCTCTAGAGTCTGAGATCCGGCTGCTAACAAAGCC.
[0082] 8site donor-R:ATACGCCTATTTTTATAGATTTCGCGGGATCGAGATCTCG.
[0083] The recombinant plasmid pDonor-Ptac-aroG was obtained by one-step cloning. S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A The recombinant plasmid pDonor (recombinant plasmid pDonor-Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A ).
[0084] Prepare the electroporation competent state of strain TS-01. Under the condition of 2500V voltage, 500ng of recombinant plasmid pDonor-Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A , introduced into strain TS-01 by electroporation, and cultured at 37°C for 12 h after plating to obtain a colony plate with an undetermined number of genomic integration copies.
[0085] The obtained colonies on the plate were washed with an appropriate amount of sterile water, and after gradient dilution, they were spread or streaked onto plates containing three types of resistance, and this cycle was repeated 6 to 8 times.
[0086] The enzymes related to this system are constitutively expressed, and the number of copies of genome integration will increase during continuous plate transfer and subculture.
[0087] Preliminary verification of the integrated copy number: design primers on the LE or RE sequence, and design primers at appropriate positions upstream or downstream of the eight target sites (including panC, tktB, aroG-gpmA (indicating that the target site is between genes aroG and gpmA), yghA, ompW, cspA-hokA, eda, and rluF-yjdD). Take the primers on the LE or RE sequence and the primers upstream or downstream of the target site, perform colony PCR verification on the plates obtained by the previous 6 to 8 transfer cycles, and preserve the strains verified as positive bands by nucleic acid electrophoresis.
[0088] The strain with the preliminarily determined copy number was prepared as competent, electroporated into the plasmid pCutamp, added with 1 mL LB medium and revived at 37°C for 1 h, then centrifuged. All the bacteria were transferred to 4 mL LB supplemented with Apr and 10 mM rhamnose, and cultured at 37°C for 3-4 h to enrich the positive transformants. After centrifugation, the strain was spread on a plate supplemented with Apr and 10 mM rhamnose and cultured at 37°C for 10-12 h.
[0089] According to the replica plate method, the picked colonies were re-inoculated on four LB agar plates containing Amp, Kan, Spe and Apr. Colonies that only grew on the Apr plate and could not grow on the plates containing Amp, Kan, and Spe were considered to have eliminated pDonor, pTnsABC, and pQCascade.
[0090] After eliminating the pDonor, pTnsABC and pQCascade plasmids, the copy number was determined again by colony PCR, which was the final genome integration copy number.
[0091] Elimination of pCutamp: Pick the colonies that grow only on the Apr plate and put them into 1mL of LB medium without antibiotics, culture at 37℃ for 4-5h, and spread them on 10g / L sucrose plates by centrifugation. Pick the colonies that grow on the sucrose plate and re-inoculate them on the plates without antibiotics and containing Apr according to the replica plate method to verify the elimination of pCutamp. The colonies that grow only on the plates without antibiotics are multi-copy integrated strains without plasmids.
[0092] Finally, 1 to 4 copies of L-trp were integrated into the genome to produce resistance-free strains, named ZH-1 to 4, and the integration sites were panC, panC and rluF, panC, ompW and rluF, ompW, cspA, eda and the intergenic sequence about 50 bp downstream of rluF. Strains ZH-1 to 4 can be used for the next fermentation verification.
[0093] Example 3 Screening and verification of the optimal copy number strain and fermentation amplification verification of the optimal strain
[0094] 1. Selection of strains The starting strain TS and integrated strains ZH-1 to ZH-4 were verified by shake flask fermentation according to the method of Example 2.
[0095] The results are as follows Figure 2 As shown, the OD of ZH-1, ZH-2 and ZH-3 600 Similar to TS, the yield of L-trp gradually increased with the increase of copy number, reaching 92% of TS, and the shake flask yield was 5.1 g / L. 600 and glucose consumption decreased by 40% and 24%, respectively, which was very similar to that of TS-1 shake flask fermentation.
[0096] It is speculated that the high expression level of the synthetic pathway genes in the 4 copies leads to an imbalance between L-trp biosynthesis and central metabolism, thus affecting cell growth.
[0097] Although the yield of ZH-4 is 7.7% higher than that of ZH-3, its OD 600 However, it was 40% lower than that of ZH-3, so ZH-3 was selected as the strain for subsequent studies because its vigorous growth could ensure higher fermentation levels during the scale-up fermentation process.
[0098] 2. 3L fermentation tank scale-up verification of strain ZH-3.
[0099] ZH-3 strain and TS-1 strain were activated on LB solid medium, and then single colonies were picked and placed in 10 ml LB medium. After culturing at 37°C for 10 hours, they were transferred to seed medium at an inoculum of 2‰ (v / v) and cultured at 37°C for about 10 hours.
[0100] 100 mL of seed culture was transferred to a 3 L fermenter containing 900 mL of fermentation medium by flame inoculation.
[0101] During the whole fermentation process, the pH value was maintained at about 6.5 by feeding ammonia water (50%, v / v), the temperature was maintained at 37° C., and the dissolved oxygen (DO) content was controlled at 20%.
[0102] After the dissolved oxygen concentration suddenly increased, that is, after the dissolved oxygen rebounded, 80% (m / v) glucose solution was added to the 3L bioreactor to keep the glucose concentration in the fermentation medium at 0-1 g / L.
[0103] OD detection during fermentation 600 , take a sample every 3 hours to test the residual sugar and L-trp concentration, and retain an appropriate amount of fermentation liquid. The extracellular L-trp concentration is measured by diluting the fermentation supernatant; the intracellular L-trp concentration requires taking 5OD of bacterial cells for ultrasonic cell wall breakage and calculating it based on the actual OD value.
[0104] The fermentation results of 3L fermenter are as follows Figure 3 Shown: OD of strain ZH-3 at 35h 600 The total conversion rate of ZH-3 was 0.180 g L-trp / g glucose, 80% higher than that of TS-1. After 35 h, the total L-trp production of ZH-3 accumulated to 43.0 g / L, 16% higher than that of the control strain, of which the highest amount of L-trp accumulated in the cell was 12.1 g / L, accounting for 28.1% of the total production.
[0105] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
Claims
1. An L-tryptophan production engineering bacterium, characterized in that: Using Escherichia coli as a host, the aroG encoding a DAHP synthase mutant is integrated and expressed in the genome of the host. S211F Gene, trpE encoding an anthranilate synthase mutant Q71K / S94N / C465Y genes, the structural genes trpABCD genes in the tryptophan operon, and the serA gene encoding a glycerol phosphate dehydrogenase mutant H344A / N364A The combination of genes, the aroG S211F gene, the trpE Q71K / S94N / C465Y gene, the trpABCD gene and the serA H344A / N364A The nucleotide sequences of the genes are shown in SEQ ID NOs: 1 to 4, respectively.
2. The engineered bacteria according to claim 1, characterized in that The integrated copy number of the combined gene is 1 to 4; optionally, the site of integration of the combined gene includes an intergenic spacer sequence 48 to 50 bp downstream of one or more targeted positions of panC, ompW, rluF, cspA and eda.
3. The engineered bacteria according to claim 1 or 2, characterized in that: The integration copy number of the combined gene is 3, and the integration sites are the intergenic spacer sequences 48 to 50 bp downstream of the panC, ompW and rluF targeting positions, respectively.
4. The engineered bacteria according to claim 1, characterized in that The combined gene also includes a gene driving aroG S211F Gene expression is driven by the promoter Ptac and trpE Q71K / S94N / C465Y gene and the promoter Ptac of trpABCD gene expression; optionally, the combined gene is Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A The nucleotide sequence of the combined gene is shown in SEQ ID NO:
5.
5. The engineered bacteria according to claim 1, characterized in that The E. coli engineered bacteria TS-0 is used as a host, and the E. coli engineered bacteria TS-0 is E. coli KW3110 in which the trpR gene, the pheA gene, the tnaA gene and the tnaB gene are knocked out.
6. A method for constructing an L-tryptophan production engineering bacterium, characterized in that: The method comprises using a CRISPR-associated-transponses system to carry out targeted integration of a combination gene at the panC, ompW, rluF, cspA and / or eda sites of the Escherichia coli genome, wherein the combination gene comprises aroG encoding a DAHP synthase mutant. S211F Gene, trpE encoding an anthranilate synthase mutant Q71K / S94N / C465Y genes, the structural genes trpABCD genes in the tryptophan operon, and the serA gene encoding a glycerol phosphate dehydrogenase mutant H344A / N364A , the aroG S211F gene, the trpE Q71K / S94N / C465Y gene, the trpABCD gene and the serA H344A / N364A The nucleotide sequences of the genes are shown in SEQ ID NOs: 1 to 4, respectively.
7. The method according to claim 6, characterized in that The combined gene also includes a gene driving aroG S211F Gene expression is driven by the promoter Ptac and trpE Q71K / S94N / C465Y gene and the promoter Ptac of trpABCD gene expression; optionally, the combined gene is Ptac-aroG S211F -Ptac-trpE Q71K / S94N / C465Y -trpABCD-serA H344A / N364A The nucleotide sequence of the combined gene is shown in SEQ ID NO:
5.
8. A method for producing L-tryptophan by fermentation, characterized in that: The method is to produce L-tryptophan by fermentation using the engineered bacteria described in any one of claims 1 to 5.
9. The method according to claim 8, characterized in that The engineered bacteria according to any one of claims 1 to 5 are activated and then introduced into a reaction system with glucose as a carbon source, the fermentation temperature is 36 to 38° C., the rotation speed is 180 to 220 rpm, and the fermentation time is not less than 48 hours; Optionally, the pH value of the reaction system is maintained at 6.5-7.2, and glucose solution is added to the reaction system every 8 hours.
10. Use of the engineered Escherichia coli according to any one of claims 1 to 5, the method according to claim 6 or 7, or the method according to claim 8 or 9 in the production of L-tryptophan.
Citation Information
Cited By
High-yield L-tryptophan evolutionary strain as well as construction method and application thereof
CN121950659A
A high-L-tryptophan-producing evolved strain, its construction method and application
CN121950659B