Enzymatic preparation process of histamine dihydrochloride

Abstract

The invention provides an enzymatic preparation method of histamine dihydrochloride, and belongs to the technical field of biochemistry. According to the method, L-histidine is taken as a substrate, a histidine decarboxylase mutant is taken as a biocatalyst, the substrate is decarboxylated and converted into histamine under proper enzyme catalytic reaction conditions, and finally, histamine dihydrochloride is extracted through a proper extraction and purification process. Wherein the conversion rate of the enzyme catalytic reaction substrate reaches 99% or above, and the purity of the extracted product is greater than 98%. The enzyme catalysis method has the advantages of high conversion rate, short conversion time, easiness in extraction and purification and the like, and has a great industrial prospect. The method has the advantages of high conversion rate and high yield, and the obtained product has market competitive advantages.

Description

Technical Field

[0001] The invention relates to an enzymatic preparation method of histamine dihydrochloride, belonging to the technical field of biochemistry. Technical Background

[0002] Histamine dihydrochloride, CAS 56-92-8, white solid, melting point 249-252℃. It has strong biological activity and is also an important drug intermediate and additive. Histamine dihydrochloride is used to maintain remission and prevent relapse of adult patients with acute myeloid leukemia (AML) after first remission treatment. The drug can reduce the oxygen radicals produced by autophagic cells, inhibit nicotinamide adenine dinucleoside phosphate oxidase and prevent interleukin-2 from activating NK cells and T cells. The approval of histamine dihydrochloride injection is based on the fact that its complete remission in combination with interleukin-2 significantly reduces the relapse of AML patients. The proportion of patients who received Ceplene / interleukin-2 combination treatment for a long time without leukemia is greater than 50%, and patients have good tolerance to this product. Therefore, the synthesis of histamine and histamine compounds became a hot research issue that year. There are two amino groups on histamine that can form salts, so a relatively stable histamine dihydrochloride is formed.

[0003] Chemistry letters, 1986, 893-896 discloses that the synthesis uses L-histidine as a raw material, and histamine dihydrochloride is obtained through decarboxylation and salt formation steps, which is expressed by the following reaction equation:

[0004]

[0005] This synthesis method was first published in , which uses 2-cyclohexene-1-one as a catalyst and decarboxylates at 160°C, but the overall reaction contains a lot of impurities and is not suitable for actual production.

[0006] JP05255204 uses acetophenone as a catalyst and diethylene glycol as a solvent for the reaction; the patent application CN1008594A uses 2,4-dihydroxybenzophenone for decarboxylation, and the product also contains a large number of unknown impurities and is not suitable for pharmaceutical grade production.

[0007] CN102477014A uses p-methylacetophenone as a catalyst to react with methylcyclohexanol at 170-175°C to prepare histamine, and forms dihydrochloride by dripping hydrogen chloride / methylcyclohexanol solvent. The high temperature in the reaction places high demands on the equipment, and there are certain difficulties and risks in production, and energy consumption is also increased. In addition, this route requires the preparation of a methylcyclohexanol solution of hydrogen chloride, which is more complicated in process, and the price of methylcyclohexanol is relatively high, which invisibly greatly increases the cost of raw materials.

[0008] CN104402825A uses a catalyst cuprous bromide to lower the decarboxylation temperature to 100-110° C., which can reduce the types and contents of unknown impurities and improve the raw material conversion rate.

[0009] CN106432089A uses histidine as a starting material, and prepares a nitrile methylimidazole intermediate by strong chlorine oxidation under alkaline conditions, and then prepares the product by catalytic hydrogenation and salt formation. This method requires a pressure of 10MPa, or the combination of Raney nickel and hydrazine hydrate, which is relatively dangerous.

[0010] In summary, the current research and development focuses are concentrated on decarboxylation catalysts and matching solvents, and different reaction systems are sought to improve reaction purity and reduce reaction temperature. However, in general, the above methods all have complex reaction systems and high raw material costs, which ultimately lead to cumbersome processes, difficult purification, and difficulty in industrial production. Summary of the invention

[0011] In order to overcome the above technical defects, the purpose of the present invention is to provide a bioenzyme method for preparing histamine dihydrochloride. That is, the present invention provides an amino acid sequence of histidine decarboxylase and a process for preparing histamine dihydrochloride using the enzyme, thereby further promoting the industrial production of histamine dihydrochloride.

[0012] The method of the present invention uses L-histidine as a substrate and a histidine decarboxylase mutant as a biocatalyst. Under suitable enzyme catalytic reaction conditions, the substrate is decarboxylated and converted into histamine, and finally histamine dihydrochloride is extracted through a suitable extraction and purification process. The substrate conversion rate of the enzyme catalytic reaction reaches more than 99%, and the purity of the product after extraction is greater than 98%. The enzyme catalytic method has the advantages of high conversion rate, short conversion time, easy extraction and purification, and has great industrial prospects. The method has the advantages of high conversion rate and high yield, and the obtained product has market competitive advantages.

[0013] The present invention discloses a histidine decarboxylase mutant, which is obtained by double mutation of the 47th isoleucine and the 340th cysteine ​​of the amino acid sequence (shown in SEQ ID NO.2) of the wild-type histidine decarboxylase from Photobacterium sp.

[0014] Furthermore, in the above technical solution, the sequence of the histidine decarboxylase mutant is shown in SEQ ID NO.3.

[0015] The present invention also provides a recombinant expression vector constructed by the above histidine decarboxylase mutant sequence.

[0016] The present invention also provides a recombinant genetic engineering bacterium prepared by transforming the above recombinant expression vector.

[0017] The present invention also provides the use of the histidine decarboxylase mutant in catalyzing L-histidine to prepare histamine dihydrochloride.

[0018] Furthermore, in the above technical solution, the crude enzyme solution is used as the biocatalyst, L-histidine is used as the substrate, and the enzyme catalytic reaction is carried out in a reaction system at pH=6.5.

[0019] Furthermore, in the above technical solution, the recombinant engineered bacteria containing the histidine decarboxylase mutant encoding gene are cultured by IPTG induction to obtain whole-cell wet bacteria, and the bacterial cells are ultrasonically disrupted to obtain a crude enzyme solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the histidine decarboxylase expression vector map;

[0021] Figure 2 This is the HPLC detection spectrum of the reaction solution in which the histidine decarboxylase mutant catalyzes L-histidine to produce histamine. DETAILED DESCRIPTION

[0022] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0023] Example 1

[0024] 1. Construction of wild-type aspartase cloning strain

[0025] The amino acid sequence of histidine decarboxylase from Photobacterium sp. was searched and obtained in the NCBI database (SEQ ID NO.2). Codon optimization (SEQ ID NO.1) was performed based on this sequence, and codon optimization and gene synthesis services were entrusted to Beijing Qingke Biotechnology Co., Ltd. The optimized and synthesized gene was cloned between the restriction sites NdeI and NotI on the pET-30a(+) plasmid to obtain the pET30a-HDC recombinant plasmid. The recombinant plasmid pET30a-HDC was heat-shock transformed into Escherichia coli E.coli BL21(DE3) competent cells to obtain the wild-type histidine decarboxylase expression engineered bacteria Ec-HDC.

[0026] SEQ ID NO.1

[0027]

[0028]

[0029] SEQ ID NO.2

[0030]

[0031] Activate and culture the engineered bacteria Ec-HDC using LB medium:

[0032] LB medium preparation method: 5g / L yeast powder, 10g / L peptone, 10g / L sodium chloride. After preparation, sterilize with high-pressure steam at 121℃ for 20min and set aside. Add 2% (w / v) agar as LB solid medium for strain plate culture and single colony isolation and purification. Add 50μg / mL kanamycin to the medium at a final concentration before use. Activation and culture method: The glycerol tube containing the engineered bacteria is streaked on the LB solid medium plate for separation and activation, and cultured at 37℃ overnight. Subsequently, a single colony is picked from the plate and inoculated into 5mL LB resistance liquid medium, and cultured overnight at 37℃ and 220rpm. Collect the bacterial cells by centrifugation, and extract the plasmid according to the operating instructions of the plasmid extraction kit. 2. Construction of histidine decarboxylase mutant cloning strain

[0033] The wild-type histidine decarboxylase expression vector extracted above was used as a DNA template, and a PCR mutation kit (Nanjing Novogene Biotech Co., Ltd., catalog number: C214-01) was used to perform gene mutation on histidine decarboxylase. First, primers I47K-F and I47K-R were used to construct the 47th amino acid mutation sequence HDC-I47K.

[0034] Subsequently, the mutant sequence vector was used as a template to mutate the amino acid sequence at position 340 using primers C340D-F and C340D-R, and finally an expression vector containing a double mutant histidine decarboxylase sequence (SEQ ID NO. 3) was obtained.

[0035] SEQ ID NO.3

[0036] 1 MetThrLeu SerIleGluAsnGlnAsnLysLeuAsp GluPheTrpAlaTyrCysValLys 21 AsnGlnTyrPheAsnIle GlyTyrPro Glu SerAlaAspPheAspTyrThrIleLeuGlu 41 ArgPheMetArgPheSerLysAsnAsnCys GlyAspTrpAlaGluTyrCysAsnTyrLeu 61 LeuAsn SerPheAspPheGluLys GluValMetGluTyrPheAlaAspLeuPheLys Ile 81 ProPheGluAsp SerTrp GlyTyrValThrAsnGlyGlyThrGlu SerAsnMetPhe Gly 101 Cys TyrLeuGlyArgGluLeuPheProAsp GlyThrLeuTyrTyr SerLysAspThrHis 121 Tyr SerValAlaLys IleValLysLeuLeuArgIleLys SerGlnLeuValGlu SerLeu 141 ProAsnGlyGluIleAspTyrAspAspLeuIleAlaLys IleLys GlnAspAsp GluLys 161 HisPro Ile IlePheAlaAsnIle GlyThrThrValArgGlyAlaIleAspAsp Ile Ser 181 Lys Ile GlnAlaMetIle GlyGluLeuGlyIleLysArgGluAspTyrTyrIleHisAla 201 AspAlaAlaLeu SerGlyMetIleLeuProPheValAsp GluPro Gln GlyPheAsnPhe 221 AlaAsp GlyIleAsp SerIle GlyVal SerGlyHisLys MetIle Gly SerProIlePro 241 Cys GlyIleValValAlaLysLysArgAsnValAspAlaIle SerVal GluIleAsp Tyr 261 Ile SerAlaHisAspLysThrIleThrGly SerArgAsnGlyHisThrProLeuMetMet 281 Trp CysAlaValLys SerHisThrHis GluAspPheLysArgArgIleAsnArg SerLeu 301 AspLeuAlaGlnHisAlaVal GlnArgLeuGln SerAlaGlyIleAsnAlaTrp CysAsn 321 LysAsn SerIleThrValValPhePro CysPro SerGluAlaValTrpLysLys HisAsp 341 LeuAlaThr SerGly GlyGlnAlaHisLeuIleThrThrAlaHis HisLeuAspAlaSer 361 LysValAspAlaLeuIleAspAspVal IleLysAspAlaAsnGly GluThrIleAlaAla

[0037] The mutation primers are shown in Table 1, the PCR reaction system composition is shown in Table 2, and the PCR reaction conditions are shown in Table 3.

[0038] Table 1 Primers used for PCR mutation

[0039] Primer sequence (5'-3')

[0040] 147K-F AATAACAAAGGCGACTGGGCCGAATATTGCAA

[0041] 147K-R CAGTCGCCTTTGTTATTGATGCTAAAGCGCATA

[0042] C340D-F GAAAAAACACGATCTGGCTACTTCTGGTGGCCAGG

[0043] C340D-R GTAGCCAGATCGTGTTTTTTCCAAACTGCTTCGGA

[0044] Table 2 PCR reaction system

[0045] Components Volume (μL) 2×MaxBuffer 25 dNTPMix (10 mM each) 1 Template DNA (100~500ng) 1 Primer F (10 μM) 2 Primer R (10 μM) 2 DNA Polymers 1 ddH2O Upto50

[0046] Table 3 PCR reaction conditions

[0047]

[0048] After the PCR product was verified by agarose gel electrophoresis to be consistent with the theory, the template plasmid was digested with DpnI restriction endonuclease. The digested product was transformed into Escherichia coli BL21 (DE3) competent cells, then spread on LB kanamycin resistance plates and cultured overnight at 37°C. Single colonies on the plate were randomly picked, and the plasmids were extracted and sequenced after liquid culture. Finally, the mutant plasmid with the correct sequence was obtained, indicating that the expression vector and recombinant engineered bacteria containing the aspartase mutant gene were obtained. Finally, the strains were stored in a -80°C refrigerator in glycerol tubes. The expression vectors of the aspartase mutant gene were named pET30a-HDC-M2. The engineered bacteria were named Ec-HDC-M2.

[0049] Example 2

[0050] 1. Preparation of crude enzyme solution of histidine decarboxylase mutant

[0051] The engineered bacteria Ec-HDC-M2 was inoculated into 5 mL LB liquid medium (kanamycin concentration 50 μg / mL) and cultured overnight at 37°C for 12 h to obtain seed solution. Subsequently, 1 mL of seed solution was transferred to 500 mL of LB liquid medium containing the same resistance and cultured at 37°C with shaking until OD 600 When the pH value reaches 0.8, add IPTG inducer to a final concentration of 0.5 mM. Induce and culture for 20 h at 28 °C. After the culture is completed, centrifuge the bacterial cell culture at 8000 rpm for 20 min, discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cells in pH = 7.0 PBS buffer, prepare a 25% (w / v) bacterial suspension, perform low-temperature ultrasonic disruption, and collect the supernatant as a crude enzyme solution.

[0052] II. Determination of histidine decarboxylase activity

[0053] The enzyme activity U of histidine decarboxylase is defined as: using L-histidine as a substrate, the amount of enzyme used to catalyze the production of 1 micromole of histamine per minute is defined as one enzyme activity unit, i.e. 1U.

[0054] Prepare a 30g / L histidine solution with PBS buffer and adjust the pH to 6.5. Take 20mL of histidine solution and add pyridoxal phosphate (PLP) to a final concentration of 10mM. Add 2mL of crude enzyme solution, shake at 35℃ for 30min, and then take a sample for HPLC detection. Calculate the histamine content generated by the reaction by detecting the peak area and the histamine standard curve, and then calculate the enzyme activity.

[0055] Example 3 Optimization of the reaction system for catalyzing histidine to prepare histamine dihydrochloride

[0056] The single factor optimization method was used to optimize the components of the enzyme catalytic reaction system. The engineered bacteria Ec-HDC-M2 constructed in Example 1 was used as the research object, and the crude enzyme solution was prepared using the method in Example 2. Use pure water to prepare 200mL of enzyme catalytic reaction solution, add 15g of histidine, 0.1g of coenzyme PLP, and 15mL of crude enzyme solution, adjust the initial pH to 7.0, and start the reaction. The reaction process temperature was controlled at 35°C, and hydrochloric acid was used to adjust the pH to 6.5. After 18 hours of reaction, samples were taken for HPLC detection. Subsequently, the addition amounts of histidine, coenzyme PLP, and crude enzyme solution were adjusted respectively to determine the optimal enzyme catalytic reaction system (Table 4).

[0057] Table 4 Optimization of enzyme catalytic reaction system

[0058] Serial number Histidine(g) Coenzyme PLP(g) Crude enzyme solution mL Conversion rate (%) 1 15 0.1 15 99.6 2 20 0.1 15 99.5 3 25 0.1 15 91.3 4 20 0.1 15 99.5 5 20 0.08 12 99.4 6 20 0.05 12 99.3 7 20 0.02 8 99.5 8 20 0.01 6 90.4

[0059] Example 4 Enzyme catalyzed reaction test

[0060] According to the results obtained in Example 3, a 1L enzyme catalytic reaction test was carried out. In the 1L catalytic system, 100g of histidine and 0.1g of PLP coenzyme were added, and the volume was fixed to 960mL with pure water, and the initial pH was adjusted to 7.0, and then 40mL of crude enzyme solution was added to start the reaction. The temperature during the reaction was controlled at 35°C, and the pH was adjusted to 6.5 with hydrochloric acid. After 18h of reaction, samples were taken for HPLC detection. The histamine conversion rate in the solution was detected to reach 99.4%.

[0061] After the reaction was completed, the reaction solution was adjusted to pH = 2.0 with concentrated hydrochloric acid. A layer of activated carbon was placed in a Buchner funnel for suction filtration and rotary evaporation. The obtained solid was washed with methanol and filtered and dried to obtain 104.2 g of histamine dihydrochloride with a yield of 87.8%. The product purity was >98% by HPLC.

[0062] The above is only a preferred embodiment of the present invention, but the protection scope of the present invention is not limited thereto. For those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered as the protection scope of the present invention.

Claims

1. A histidine decarboxylase mutant, characterized in that: The mutant is obtained by double mutation of the 47th isoleucine and the 340th cysteine ​​of the amino acid sequence (shown in SEQ ID NO.2) of the wild-type histidine decarboxylase from Photobacterium sp.

2. The histidine decarboxylase mutant according to claim 1, characterized in that: The sequence of the histidine decarboxylase mutant is shown in SEQ ID NO.

3.

3. A recombinant expression vector constructed from the histidine decarboxylase mutant sequence according to claim 1 or 2.

4. A recombinant genetically engineered bacterium prepared by transformation with the recombinant expression vector according to claim 3.

5. Use of the histidine decarboxylase mutant as claimed in claim 1 or 2 in catalyzing the preparation of histamine dihydrochloride from L-histidine.

6. The use of the histidine decarboxylase mutant according to claim 5 in catalyzing the preparation of histamine dihydrochloride from L-histidine, characterized in that: The crude enzyme solution was used as a biocatalyst, L-histidine was used as a substrate, and an enzyme catalytic reaction was carried out in a reaction system at pH=6.

5.

7. The use of the histidine decarboxylase mutant according to claim 6 in catalyzing the preparation of histamine dihydrochloride from L-histidine, characterized in that: The recombinant engineering bacteria containing the histidine decarboxylase mutant encoding gene are cultured by IPTG induction to obtain whole-cell wet bacteria, and the bacterial cells are ultrasonically disrupted to obtain a crude enzyme solution.

Images