A molecular marker affecting sheep meat quality, a detection method and its application

Abstract

The present invention provides a molecular marker, a detection method and an application thereof that affect the quality of sheep meat, and belongs to the technical field of molecular marker-assisted breeding. The present invention provides a molecular marker related to the tenderness of sheep meat, the molecular marker comprises a sequence shown in SEQ ID No.1, and a polymorphic site A>G exists at the 33rd site of the 3'UTR region. The molecular marker of the present invention is significantly correlated with the tenderness of sheep meat, and the molecular marker can be used to accurately perform genotyping, thereby improving the accuracy and reliability of genetic evaluation, and facilitating the early screening of sheep individuals with excellent meat quality, thereby increasing the speed of breeding superior meat sheep and saving feeding costs.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker assisted breeding, and specifically relates to a molecular marker affecting sheep meat quality, a detection method and an application thereof. Background Art

[0002] Livestock and poultry meat is an important source of protein and is closely related to human health. Consumers' demand for meat is increasing day by day, and their requirements for meat quality are also getting higher and higher. How to improve the quality of meat products has become an urgent problem for animal husbandry workers. At present, simply relying on nutritional level regulation cannot significantly improve meat quality. Analyzing the factors affecting meat quality from the perspective of genetic basis and molecular mechanism provides a new idea for solving the above problems, in order to lay the foundation for meeting the needs of animal husbandry production and market for meat quality.

[0003] Single nucleotide polymorphism (SNP) in the 3' untranslated region (3'UTR) has an important impact on gene expression and function. 3'UTR SNP affects mRNA stability, subcellular localization and protein translation efficiency. Variations in the 3'UTR sequence can cause abnormal gene expression, leading to the occurrence and development of diseases. At the same time, it can be used as a molecular marker to study the evolutionary relationship of species and the genetic structure of populations. Therefore, seeking molecular markers that can affect the quality of sheep meat, such as tenderness, is of great significance for improving the quality of livestock and poultry meat. Summary of the invention

[0004] The present invention provides a molecular marker affecting the quality of sheep meat, a detection method and application thereof. The molecular marker can quickly screen individuals with higher meat tenderness in a sheep population, which is of great significance for improving breeding efficiency, reducing feeding costs and improving mutton quality.

[0005] The invention provides a molecular marker sequence affecting the quality of sheep meat. The molecular marker sequence comprises a sequence shown in SEQ ID No. 1, and an A / G mutation exists at the 33rd site of the 3'UTR region.

[0006] In a preferred embodiment of the present invention, the quality of sheep meat includes tenderness.

[0007] The invention also provides a specific primer pair designed for amplifying the molecular marker sequence.

[0008] In a preferred embodiment of the present invention, the upstream primer comprises a nucleotide sequence as shown in SEQ ID No.2 and a downstream primer as shown in SEQ ID No.3.

[0009] The present invention also provides a method for identifying the quality of sheep meat, comprising using the genomic DNA of the sheep to be tested as a template, amplifying using the above-mentioned specific primer pair, sequencing the amplified product, comparing the sequencing result with the reference sequence, and determining the A / G polymorphism of the 33rd site of the 3'UTR region.

[0010] In a preferred embodiment of the present invention, the amplification procedure includes: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s, annealing at 64.5°C for 30 s, extension at 72°C for 50 s, 30 cycles; extension at 72°C for 5 min, and storage at 12°C.

[0011] In a preferred embodiment of the present invention, GG is the dominant genotype.

[0012] The present invention also provides the application of the molecular marker sequence or the specific primer pair or the method in molecular marker-assisted breeding of high-quality sheep.

[0013] In a preferred embodiment of the present invention, the quality standard of the high-quality sheep includes tenderness.

[0014] The present invention also provides a breeding method for high-quality sheep varieties, comprising screening varieties and / or strains containing the above molecular marker sequence and having a GG dominant genotype at the 33rd site of the 3'UTR region.

[0015] Beneficial effects: The present invention provides a molecular marker related to the quality of sheep meat, the molecular marker comprises the sequence shown in SEQID No.1, and there is a polymorphic site A>G at the 33rd site of the 3'UTR region. The molecular marker of the present invention is significantly correlated with meat tenderness, and the molecular marker can be used to accurately perform genotyping, thereby improving the accuracy and reliability of genetic evaluation, and facilitating early screening of sheep individuals with excellent meat quality, thereby increasing the speed of superior meat sheep breeding and saving feeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Picture 1 For Sheep SERPINA Electrophoresis of PCR amplification products of 3'UTR region of 1 gene;

[0017] Picture 2 For Sheep SERPINA 1. Sequencing alignment of 3'UTR region of gene;

[0018] Picture 3 For Sheep SERPINA 1. AA typing results of gene 3'UTR region;

[0019] Picture 4 For Sheep SERPINA 1 AG typing results of gene 3'UTR region;

[0020] Picture 5 For Sheep SERPINA 1. GG typing results of 3'UTR region of gene. DETAILED DESCRIPTION

[0021] The invention provides a molecular marker sequence affecting the quality of sheep meat. The molecular marker sequence comprises a sequence shown in SEQ ID No. 1, and an A / G mutation exists at the 33rd site of the 3'UTR region.

[0022] In one embodiment of the present invention, sheep (such as double dry mutton sheep) are used as an example for the experiment. The molecular marker is located on the serpin peptidase inhibitor clade A member 1 of chromosome 18 of sheep. SERPINA 1) Gene, SERPINA 1 contains 4 exons and encodes 416 amino acids, which can regulate the meat quality traits of sheep. It is mainly involved in fat synthesis, muscle growth and development, and amino acid metabolism, and is significantly correlated with meat tenderness.

[0023] The molecular marker of the present invention is located in sheep SERPINA 1 gene 3'UTR region 33rd site (specific location: chr18: 56838856), which has the sequence shown in SEQ ID No. 1, in which the molecular marker has an A / G mutation at the site, wherein the GG type is the dominant genotype, and individuals with the GG genotype have higher meat tenderness.

[0024] The invention also provides a specific primer pair designed for amplifying the molecular marker sequence.

[0025] In one embodiment of the present invention, the sequence shown in SEQ ID No.1 is used as the target sequence, and a primer pair is designed according to the target sequence, wherein the primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID No.2 and a downstream primer as shown in SEQ ID No.3.

[0026] Target sequence SEQ ID No.1:Cagggctgggtagacagtgatggggaaggacaggaggctgggagagaggccagcacgtgccccaccctgggcaaggcgctcctccccgcctggctcccaggtctgggtggggg cctgtctccactctcacgcagcctcgttgctttccccccttccaggcgctccacaaggctgcgctgaccattgatgagaaagggacagaagctgctggggccacgtttctggaagcta tccccatgtcccttccccgacgtcgagttcaacagacccttcctctgcatcctctacgacagaaacaccaagtctcccctcttcgtgggaaaggtggtgaatcccacccaagccta agtgcctctcggggttcagctttcccctcccaggccaggtccccttcttccctccatggcattaaaggataactgacctagcccgagcttgtgtgtggcgtgtcaaccctccgtcct;

[0027] Upstream primer (SEQ ID No. 2): 5′-CAGGGCTGGGTAGACAGTGAT-3′;

[0028] Downstream primer (SEQ ID No. 3): 5′-AGGACGGAGGGTTGACACG-3′.

[0029] The present invention also provides a method for identifying the quality of sheep meat, comprising using the genomic DNA of the sheep to be tested as a template, amplifying using the above-mentioned specific primer pair, sequencing the amplified product, comparing the sequencing result with the reference sequence, and determining the A / G polymorphism of the 33rd site of the 3'UTR region.

[0030] The genomic DNA of the present invention can be extracted from the blood of the livestock species to be tested, such as sheep, and the genomic DNA is extracted using a blood genomic DNA rapid extraction kit. The genomic DNA is used as an amplification template and a PCR amplification system is prepared with the primer pairs shown in SEQ ID No. 2 and SEQ ID No. 3. The PCR amplification system, in 20 μL, includes: 10 μL of 2×ES Taq MasterMix, 0.5 μL of upstream and downstream primers, 1 μL of DNA and the balance of ddH2O.

[0031] After the PCR amplification system is prepared, PCR amplification is performed. The reaction procedure of the PCR amplification can be: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 64.5°C for 30 seconds, extension at 72°C for 50 seconds, 30 cycles; extension at 72°C for 5 minutes; and storage at 12°C.

[0032] The present invention performs 2.0% agarose gel electrophoresis on the PCR products obtained by the above PCR amplification, and sequences the recovered fragments to determine the genotype of site 33 in the 3'UTR region, which are AA, AG and GG, respectively, among which GG is the dominant genotype, that is, sheep containing the GG genotype in the molecular marker sequence have better meat quality, which is mainly reflected in higher tenderness.

[0033] The present invention can also prepare the molecular marker sequence or the above-mentioned specific primer pair into a kit, and the kit contains other reagents for detecting the molecular marker sequence, and the detection method can be conventional PCR amplification, and of course, it can also be other detection schemes, such as gene chips, etc. The present invention does not specifically limit the other components in the kit, and the specific detection of the molecular marker sequence can be completed according to the corresponding method.

[0034] The present invention also provides the application of the molecular marker sequence or the specific primer pair or the method in molecular marker-assisted breeding of high-quality sheep varieties.

[0035] The molecular marker sequence of the present invention can be used to screen and cultivate sheep breeds with higher meat tenderness.

[0036] The present invention also provides a breeding method for high-quality sheep varieties, comprising screening varieties and / or strains containing the above molecular marker sequence and having a GG dominant genotype at the 33rd site of the 3'UTR region.

[0037] The present invention does not specifically limit the method of molecular marker-assisted breeding, and it can be carried out using conventional methods in the art, as long as the molecular markers of the present invention can be detected, especially screening the GG genotype for variety breeding, or selecting for the next generation of breeding.

[0038] In order to further illustrate the present invention, a molecular marker affecting sheep meat quality, a detection method and its application provided by the present invention are described in detail below in combination with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] 1. Sample collection

[0041] Blood was collected from the jugular vein of 35 double-dried mutton sheep born in the same farm and raised in the same environment. The blood was placed in anticoagulant tubes and stored in a 4℃ refrigerator for future use.

[0042] 2. Genomic DNA Extraction

[0043] Genomic DNA was extracted using a blood genomic DNA rapid extraction kit (Axygen, USA), and its concentration and purity were determined using an ultra-micro spectrophotometer. DNA samples that passed the test were packaged and stored at -80°C.

[0044] 3. Primer design and synthesis

[0045] According to the sheep published in GenBank SERPINA 1 gene sequence information (XM_012098288.3), Primer Premier 5.0 software was used to design primers SEQ ID No. 2 and SEQ ID No. 3, and the target fragment length was 466 bp. The primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0046] 4. PCR amplification

[0047] PCR reaction system 20μL: 2×ES Taq Master Mix 10μL, upstream and downstream primers 0.5μL each, DNA 1μL, ddH2O 8μL. PCR reaction program: 95℃ pre-denaturation 5min; 95℃ denaturation 30s, 64.5℃ annealing 30s, 72℃ extension 50s, 30 cycles; 72℃ extension 5min; 12℃ storage. PCR products were detected by 2.0% agarose gel electrophoresis, and the PCR products with bright bands were sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. SERPINA The electrophoresis diagram of PCR amplification of the 3'UTR region of gene 1 is shown in Picture 1 The fragment length was approximately 466 bp, consistent with the expected size.

[0048] 5. Sequencing and sequence analysis

[0049] The PCR amplification product of the target fragment of 466 bp was recovered from the gel and then subjected to Sanger sequencing. SERPINA 1 gene mRNA sequence (XM_012098288.3) and the peak graph were compared and analyzed, sheep SERPINA 1Gene 3'UTR region sequencing sequence alignment diagram as shown Picture 2 As shown, it was found SERPINA There is a polymorphic site A>G in the 3'UTR region of gene 1 (chr18:56838856).

[0050] 6. Sheep SERPINA1Gene polymorphism analysis

[0051] The genotype frequencies and gene frequencies are shown in Table 1. SERPINA 1 gene 3'UTR region 33rd site (specific location: chr.18: 56838856) has genotypes: AA, AG and GG. Chi-square fitness test as Pictures 3~5 As shown, the three loci were in Hardy-Weinberg equilibrium in the double dry mutton population (P>0.05). The polymorphism information content (PIC) was 0.3538, which was moderately polymorphic (0.25<PIC<0.5), indicating that the genetic marker could provide a certain amount of genetic information.

[0052]

[0053] 7. Sheep SERPINA 1. Analysis of association between genetic variation and meat quality traits

[0054] The cooked meat rate, drip loss (24h, 48h and 72h), bright fat, initial moisture, pH value, squeezed moisture, meat tenderness and protein content of the above 35 double dry mutton sheep were tested. The association analysis between the three genotypes and meat quality traits in the double dry mutton sheep population is shown in Table 2. The meat tenderness of the GG genotype individuals in this population is significantly higher than that of the AA genotype individuals and the AG genotype individuals, indicating that the meat tenderness of individuals containing the G allele is significantly higher than that of the homozygous wild-type AA individuals. SERPINA Except for being associated with meat tenderness, this SNP locus in gene 1 had no significant difference with other meat quality traits (P>0.05).

[0055]

[0056] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for identifying the quality of sheep meat, characterized in that: The method comprises using the genomic DNA of the sheep to be tested as a template, amplifying using a specific primer pair, sequencing the amplified product, comparing the sequencing result with the reference sequence, and determining the A / G polymorphism of the amplified product at the 420th position of the reference sequence; the meat quality is the tenderness of the meat; the sheep to be tested is a double dry meat sheep; The specific primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID No.2 and a downstream primer as shown in SEQ ID No.3; The nucleotide sequence of the reference sequence is shown in SEQ ID No.

1.

2. The method according to claim 1, characterized in that: The amplification procedure includes: pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 30 seconds, annealing at 64.5°C for 30 seconds, extension at 72°C for 50 seconds, 30 cycles; extension at 72°C for 5 minutes, and storage at 12°C.

3. The method according to claim 1, characterized in that: GG was the dominant genotype.

4. Application of the method according to any one of claims 1 to 3 in molecular marker-assisted breeding of high meat quality sheep, characterized in that: The high-quality meat sheep are highly tender double-dry meat sheep.

5. A method for breeding sheep breeds with high meat tenderness, characterized in that: The method comprises screening a breed and / or strain comprising a sequence shown in SEQ ID No. 1 and having a GG dominant genotype at the 420th position of the SEQ ID No. 1 sequence, wherein the sheep is a double dry meat sheep.

Images