A fluorescent PCR amplification primer probe set and kit for detecting canine parvovirus

Abstract

The present invention relates to the technical field of canine parvovirus detection, and specifically to a fluorescent PCR amplification primer probe group and a kit capable of detecting canine parvovirus, wherein the primer probe group comprises an upstream primer as shown in SEQ ID NO.1, a downstream primer as shown in SEQ ID NO.2, and a probe as shown in SEQ ID NO.3. The primer probe group of the present invention can effectively detect canine parvovirus, and comprises a pair of primer combinations with the strongest specificity and the highest sensitivity and a probe. The kit of the present invention is sensitive, convenient, highly specific, highly sensitive, and reliable, and only requires one test to determine whether a sample contains canine parvovirus, and a large number of sample analyses can be performed simultaneously, providing powerful technical support for the monitoring and prevention and control of canine parvovirus, and has important clinical practical value and good application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of canine parvovirus detection, and in particular to a fluorescent PCR amplification primer probe set and a kit for detecting canine parvovirus. Background Art

[0002] With the rapid development of my country's economy, people's demand for companion animals has increased, and the number of pet dogs has also increased. This has greatly increased the probability of canine parvovirus transmission between pet dogs and their living environment. Canine parvovirus (CPV) is a representative of the Parvovirus genus of the Parvoviridae family. It mainly causes canine hemorrhagic enteritis and myocarditis, resulting in high morbidity and mortality. The disease became widespread around the world within just one year after its outbreak, causing huge economic losses to the dog breeding industry. At the same time, due to the rapid mutation of CPV genes / antigens, the characteristics of CPV itself have also changed, and the host spectrum of animal infection has also begun to expand, which has brought great difficulties to the prevention and control of CPV. Rapid and accurate pathogen diagnosis is one of the main means of preventing and controlling the disease. At present, the fluorescent PCR method (qPCR) for diagnosing canine parvovirus is mainly aimed at the conserved region of the virus VP2 protein-related gene. qPCR can simultaneously detect canine parvovirus of multiple antigen types. Its specificity, sensitivity and repeatability are significantly better than traditional PCR, saving a lot of time and cost.

[0003] The canine parvovirus genome is 5.2kb in length and contains two major open reading frames (ORFs). One ORF encodes two nonstructural proteins (NS1 and NS2), and the other encodes two capsid proteins (VP1 and VP2). The VP2 protein affects the antigenic properties and plays an important role in controlling the host range and tissue tropism of the virus. If a diagnostic method for canine parvovirus can be designed in the conserved region of VP2, it will effectively improve the prevention and control of canine parvovirus. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a fluorescent PCR amplification primer probe set and a kit for detecting canine parvovirus, so as to effectively identify canine parvovirus with high sensitivity and good specificity.

[0005] Based on the above purpose, the present invention provides a fluorescent PCR amplification primer probe set for detecting canine parvovirus, wherein the primer probe set comprises an upstream primer as shown in SEQ ID NO.1, a downstream primer as shown in SEQ ID NO.2, and a probe as shown in SEQ ID NO.3.

[0006] The present invention also provides a fluorescent PCR kit capable of detecting canine parvovirus, wherein the kit comprises the fluorescent PCR amplification primer probe set capable of detecting canine parvovirus.

[0007] The kit also includes a canine parvovirus fluorescent PCR amplification solution, which is configured by a PCR amplification premix and a PCR amplification primer probe set. The PCR amplification premix is ​​2×Probe qPCRMasterMix. The present invention establishes a multi-component micro-combination process technology, and the original multiple chemical reagent components of the kit, including the PCR amplification premix and the primer probe, are prepared into a fluorescent PCR amplification solution, and the template DNA can be directly added to perform PCR amplification.

[0008] Preferably, the canine parvovirus fluorescent PCR amplification solution is 13 μl, the PCR amplification premix solution is 10 μl, and the mixed solution formed by the PCR amplification primer probe set is 3 μl.

[0009] The PCR reaction system used in the kit is 20 μl, consisting of 13 μl of PCR amplification solution and 7 μl of the DNA template to be tested.

[0010] Preferably, the canine parvovirus fluorescent PCR amplification solution contains 15 mmol of Mg 2+ The present invention found that adding Mg to the PCR amplification solution 2+ To 15mmol, which can effectively improve the amplification efficiency of target genes with high AT content.

[0011] Preferably, the amplification reaction program adopted by the kit is 95°C for 10 min; 45 cycles, each cycle is 95°C for 30 sec, 60°C for 30 sec; and the fluorescence signal is collected in the second step of each cycle.

[0012] Preferably, the kit further comprises a positive control and a negative control.

[0013] Preferably, the positive control is a recombinant plasmid containing a VP2 gene fragment of a canine parvovirus isolate, and the negative control is distilled water. As an optional embodiment, the positive control is a recombinant plasmid containing a VP2 gene fragment of a canine parvovirus Emerald / Queensland / 4720 / 2019 isolate.

[0014] As an optional embodiment, the probe is labeled with a fluorescent marker selected from FAM and BHQ1.

[0015] When the kit is used for detection, when the Ct value is ≤40 and a specific amplification curve appears in the channel corresponding to the probe, it is determined that canine parvovirus is present.

[0016] In the present invention, primers and probes are designed for the virus VP2 gene, the 5' end of the probe is fluorescently labeled with FAM, and the 3' end is labeled with BHQ1 to increase the PCR annealing temperature. The fluorescent PCR method established thereby can detect canine parvovirus.

[0017] Beneficial effects of the present invention: The primer probe set of the present invention can effectively detect canine parvovirus, and includes a pair of primer combinations with the strongest specificity and highest sensitivity and a probe. The kit of the present invention is sensitive, convenient, highly specific, highly sensitive, and reliable. Only one test is required to determine whether a sample contains canine parvovirus, and a large number of sample analyses can be performed simultaneously, providing powerful technical support for the monitoring and prevention and control of canine parvovirus, and having important clinical practical value and good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings in the following description are only for the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 This is a schematic diagram for verifying the amplification effect of the primer pair of the present invention;

[0020] Figure 2 This is a schematic diagram of the specific verification of fluorescent PCR of the present invention;

[0021] Figure 3 It is a schematic diagram of sensitivity verification of the present invention. DETAILED DESCRIPTION

[0022] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments.

[0023] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in the present invention should have the common meanings understood by people with ordinary skills in the field to which the present invention belongs. "Include" or "comprising" and similar words mean that the elements or objects appearing before the word include the elements or objects listed after the word and their equivalents, but do not exclude other elements or objects.

[0024] Design of primer and probe combination for canine parvovirus fluorescence PCR

[0025] 1.1 Primer and probe design

[0026] By comparing the capsid protein VP2 genome sequences of multiple canine parvovirus strains (Appendix 1), the VP2 conserved region was found, which can effectively detect canine parvovirus, as shown in Table 1 (SEQ ID NO.1-3).

[0027] Table 1

[0028]

[0029] Among them: F represents the upstream primer; P represents the probe; R represents the downstream primer.

[0030] 1.2 Optimization of the reaction system of fluorescent PCR method

[0031] The optimization principle is: to obtain the maximum amplification efficiency and the minimum Ct value for the same sample by optimizing the following conditions.

[0032]

[0033] 1.3 Reaction conditions of fluorescent PCR method

[0034]

[0035] 1.4 Results

[0036] Test the canine parvovirus-positive samples. The threshold setting principle is that the threshold line just exceeds the highest point of the normal negative control amplification curve, and the displayed result shall prevail. When the Ct value is ≤40, the FAM channel and a specific amplification curve appear, it indicates that the sample contains canine parvovirus; when there is no Ct value and no specific amplification curve, it indicates that the sample does not contain canine parvovirus nucleic acid.

[0037] 2. Screening and comparative verification of fluorescent PCR primer pairs

[0038] Three sets of primers were designed for the conservative region of the VP2 gene of canine parvovirus. The probe was redesigned for the set with the best effect. The three sets of primers were set 1, set 2 and set 3, respectively. Set 1 used the primer set in Table 1 above (amplification curve is Figure 1 ①), the primer sets of group 2 and group 3 are as follows (amplification curve is Figure 1 ②, ③, where ④ is the NC amplification of the three sets of primers). The results are as follows Figure 1 As shown, it was found that the amplification effect of primer set 1 was the best, the amplification effect of primer set 2 was relatively good, and the sensitivity of primer set 3 was not enough.

[0039] 1 set of primers (shown in SEQ ID NO.1-2), specifically as follows:

[0040] IF:GCATTGGGCTTACCACCATT

[0041] IR:CCAACCTCAGCTGGTCTCAT

[0042] 2 sets of primers (shown in SEQ ID NO.4-5), specifically as follows:

[0043] II-F:GCCTCAAGCTGAAGGAGGTA

[0044] II-R:GTCCTGCTGCAATAGGTGTT

[0045] 3 sets of primers (shown in SEQ ID NO.6-7), specifically as follows:

[0046] III-F: GGGAGCGCAAACAGATGAAA

[0047] Ⅲ-R:GTGTTTCTCCTGTTGTGGTAGT

[0048] 3. Specificity verification of fluorescent PCR method

[0049] The fluorescent probe PCR method established in this patent was used to amplify canine distemper virus (CDV), canine adenovirus (CAV) and canine coronavirus (CCV), and the results were all negative, with no specific amplification curve ( Figure 2 ).

[0050] 4. Verification of the sensitivity of the fluorescent PCR method

[0051] The plasmid of known concentration (10,000,000 copies) was diluted 10 times in a row and used as a template for amplification by fluorescent PCR to verify the sensitivity. Figure 3 As shown in Figure 2, the detection limit of canine parvovirus by real-time fluorescence PCR is 10 copies.

[0052] 5. Repeatability verification of fluorescent PCR method

[0053] Plasmids with known concentrations (1,000,000 copies, 10,000 copies, and 100 copies) were used as templates, and one operator was asked to repeat the test 6 times on the same day to verify the intra-group repeatability of the method; two operators were asked to perform the test 3 times at different times to calculate the inter-group repeatability. As shown in Table 2 below, the results show that the intra-group and inter-group repeatability of the method are good, with coefficients of variation ranging from 0.66% to 3.24% and 2.12% to 7.07%, respectively.

[0054] Table 2. Repeatability verification of fluorescence PCR method

[0055]

[0056] 6. Fluorescence PCR detection of different types of samples

[0057] Different types of positive sample DNA were tested and compared with the fluorescent PCR method recommended by OIE. As shown in Table 3 below, the results showed that the detection results of the method recommended by OIE were all positive, and the method of the present invention was also positive, and the Ct value was smaller.

[0058] Table 3. Validation of different types of positive DNA by fluorescence PCR method

[0059]

[0060]

[0061] Appendix 1: VP2 gene sequences of 58 canine parvovirus strains used in the design of PCR primers and probes in this patent

[0062]

[0063]

[0064] Those skilled in the art should understand that the discussion of any of the above embodiments is only exemplary and is not intended to imply that the scope of the present invention is limited to these examples; under the concept of the present invention, the technical features in the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other changes in different aspects of the present invention as described above, which are not provided in detail for the sake of simplicity. Any omissions, modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A fluorescent PCR amplification primer probe set capable of detecting canine parvovirus, characterized in that: The primer-probe set includes an upstream primer as shown in SEQ ID NO.1, a downstream primer as shown in SEQ ID NO.2, and a probe as shown in SEQ ID NO.

3.

2. A fluorescent PCR kit for detecting canine parvovirus, characterized in that: The kit comprises the fluorescent PCR amplification primer probe set capable of detecting canine parvovirus as claimed in claim 1.

3. The fluorescent PCR kit for detecting canine parvovirus according to claim 2, characterized in that: The kit also includes canine parvovirus fluorescent PCR amplification solution, which is prepared by a PCR amplification premix and a PCR amplification primer probe set.

4. The fluorescent PCR kit for detecting canine parvovirus according to claim 3, characterized in that: The canine parvovirus fluorescent PCR amplification solution is 13 μl, the PCR amplification premix solution is 10 μl, and the mixed solution formed by the PCR amplification primer probe set is 3 μl.

5. The fluorescent PCR kit for detecting canine parvovirus according to claim 3, characterized in that: The canine parvovirus fluorescent PCR amplification solution contains 15 mmol of Mg 2+ .

6. The fluorescent PCR kit for detecting canine parvovirus according to claim 2, characterized in that: The amplification reaction program adopted by the kit is 95° C. for 10 min; 45 cycles, each cycle is 95° C. for 30 sec, 60° C. for 30 sec; and the fluorescence signal is collected in the second step of each cycle.

7. The fluorescent PCR kit for detecting canine parvovirus according to claim 2, characterized in that: The kit also includes a positive control and a negative control.

8. The fluorescent PCR kit for detecting canine parvovirus according to claim 7, characterized in that: The positive control is a recombinant plasmid containing the VP2 gene fragment of the canine parvovirus isolate, and the negative control is distilled water.

9. The fluorescent PCR kit for detecting canine parvovirus according to claim 2, characterized in that: The probe is labeled with a fluorescent dye selected from FAM and BHQ1.

10. The fluorescent PCR kit for detecting canine parvovirus according to claim 2, characterized in that: When the kit is used for detection, when the Ct value is ≤40 and a specific amplification curve appears in the channel corresponding to the probe, it is determined that canine parvovirus is present.

Images