Method for improving agar diffusion detection sensitivity of porcine circovirus type 2 Cap protein antigen

Abstract

The invention discloses a method for improving agar diffusion detection sensitivity of a porcine circovirus type 2 Cap protein antigen, and belongs to the technical field of veterinary products. The method comprises the following steps: (1) inoculating a piglet with a porcine circovirus 2a, 2b and 2d type trivalent virus-like particle vaccine, and separating serum to obtain porcine circovirus 2a, 2b and 2d type trivalent hyperimmune serum; (2) preparing a high-salt agar plate; and (3) respectively diluting the trivalent hyper-immune serum and the porcine circovirus type 2 Cap protein antigen by using a high-salt diluent, then adding the diluted trivalent hyper-immune serum and the porcine circovirus type 2 Cap protein antigen into holes of an agar plate, and incubating for 20-24 hours at 35-37 DEG C to complete detection. According to the method, the PCV2 Cap protein content is quantified by using hyper-immune serum and an improved agar diffusion method, so that the defects that a common BCA or Bradford protein content detection method is low in buffer reagent tolerance, poor in detection specificity and the like are overcome.

Description

Technical Field

[0001] The invention belongs to the technical field of veterinary products, and particularly relates to a method for improving the sensitivity of agar amplification detection of porcine circovirus type 2 Cap protein antigen. Background Art

[0002] Porcine circovirus (PCV) is a type of immunosuppressive disease that is widely prevalent in farms. PCV is divided into PCV1, PCV2, PCV3 and PCV4, among which PCV2 causes the most serious impact and loss, and PCV2 has multiple subtypes such as PCV2a~PCV2h. The genotype of the main prevalent strain of PCV2 has undergone a transition from PCV2a to PCV2b and then to PCV2d, but PCV2a and PCV2b still account for a high proportion of current PCV2 infections.

[0003] The whole virus inactivated vaccine has made an important contribution to the prevention and control of PCV2. However, due to the risk of incomplete inactivation of the whole virus inactivated vaccine, low virus titer in culture, and poor immunogenicity, PCV2 vaccines are gradually shifting to subunit vaccines. Cap protein is the only structural protein and immunogenic protein of PCV2. In PCV2 subunit vaccines, there are two main ways to express Cap protein: Escherichia coli and baculovirus culture.

[0004] The two commonly used protein content detection methods, BCA method and Bradford method, are often not very accurate for detecting the content of purified Cap protein due to the interference of buffer in the purification process. For example, the invention patent CN114805501A discloses a competitive ELISA method that solves the sensitivity and specificity of antigen quantitative detection, but the ELISA test has problems such as short shelf life of the kit, easy oxidation of the substrate, and high price. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a method for improving the sensitivity of agar amplification detection of porcine circovirus type 2 Cap protein antigen. The present invention utilizes high immune serum and an improved high-salt agar plate to perform agar amplification titer detection on PCV2 Cap protein antigen, which has the advantages of high sensitivity, strong specificity, simple operation, effective avoidance of buffer interference, low cost, etc.

[0006] To achieve the above purpose, the technical solution adopted by the present invention to solve the technical problem is: The object of the present invention is to provide a method for improving the sensitivity of porcine circovirus type 2 Cap protein antigen agar amplification detection, which comprises the following steps: (1) Inoculate piglets with a trivalent virus-like particle vaccine of porcine circovirus 2a, 2b, and 2d, and then separate the serum to obtain a trivalent high-immunity serum of porcine circovirus 2a, 2b, and 2d; (2) Preparation of high salt agar plates; (3) Dilute the trivalent high immune serum and porcine circovirus type 2 Cap protein antigen with high salt diluent, then add the diluted trivalent high immune serum and porcine circovirus type 2 Cap protein antigen to the holes of the agar plate and incubate at 35-37°C for 20-24 hours to complete the test.

[0007] Furthermore, the porcine circovirus 2a, 2b, 2d trivalent high-immune serum, whose indirect immunofluorescent antibody titer is not less than 1:6400, is obtained by isolating serum from piglets after inoculating them with the porcine circovirus 2a, 2b, 2d trivalent virus-like particle vaccine. The porcine circovirus 2a, 2b, 2d trivalent virus-like particle vaccine is preferably administered to piglets using 21-day-old healthy piglets for intramuscular injection of 2 mL / head / time, and two booster immunizations are performed 14 days and 28 days after the first immunization, respectively. Aseptic blood is collected 42 days after the first immunization, and serum is separated by conventional methods.

[0008] The trivalent virus-like particle vaccine of porcine circovirus types 2a, 2b, and 2d is prepared by mixing porcine circovirus types 2a, 2b, and 2d Cap proteins (all at a concentration of 0.15 mg / mL) in a ratio of 1:1:1, and then mixing with equal volumes of ISA206 adjuvant and emulsifying.

[0009] Porcine circovirus 2a, 2b and 2d virus-like particles are prepared by the method disclosed in CN117143888A, that is, the optimized gene nucleotide sequence is constructed into the pFastBac1 vector, the recombinant Bacmid is obtained by transformation of DH10Bac competent cells, and then Sf9 cells are transfected to obtain recombinant baculovirus, and then High Five cells are inoculated to harvest the culture and purify to obtain PCV2aCap protein virus-like particles or PCV2b Cap protein virus-like particles or PCV2d Cap protein virus-like particles.

[0010] Furthermore, a gp64 signal peptide fragment was added to the N-terminus of the amino acid sequence of PCV2a, 2b and 2d Cap proteins to improve the secretory expression of the protein. The nucleotide sequence of the gp64 signal peptide is as follows: atggtgtccgccatcgtgctgtacgttcttctggctgccgcagctcactctgcatttgcc. (SEQ IDNO.1) The PCV2a Cap protein was truncated with 41 amino acids at the N-terminus, and the optimized nucleotide sequence is as follows: aacggtatctttaatgcaagactgtcgcgcaccttcggctacacagtaaaggctactaccgttagtacccctagttggtcagtcgatatgctgaggttcaacttggacgacttcgtccccccaggtggtggaactaacaagatcagcatcccgtttgaatactacaggatcagaaaggtcaaggttgagttctggccgtgttcacctattactcagggagacaggggaatcggctctagcgctataattctcgacgacaacttcgtaatgaaggtgcccgcacaaacctacgacccttatgtgaactattcttccagacacaccatcccacaacctttctcctatcactccagatacttcacacctaaaccggtcttggattcaaccattgactacttccagcccaataacaagagaaaccagttgtggatgaggctgcaaacgtcaagaaatgtcgaccacgttggcttgggaacagctttcgaaaactccaagtatgaccaggactacaacatccgtgtaaccatgtacgttcagtttcgcgaattcaacctcaaggatccaccactgaagccg. (SEQ ID NO.2) Among them, the PCV2b Cap protein, the optimized nucleotide sequence is as follows: atgacataccccagaagacgtttccgccgcagaagacacaggccaagatctcaccttggccaaattttgcgccgcaggccttggttggttcaccccagacaccgttatcgctggcgtcgcaaaaacggtattttcaacaccaggctcagccgcaccatcggatacactgtcaagaagaccactgtacgcactccaagctggaacgtggatatgatgaggtttaacatcaatgacttccttccacccggaggtggatcaaacccgttgacggttcctttcgagtactaccgcatacgcaaggtcaaagttgagttttggccctgttctccaatcacccaaggagacaggggcgtgggttccacagctgtaatcctggacgacaatttcgtgactaaggccaacgctcttacatacgacccatacgtgaactattcttcacgccacaccataactcagcctttctcctaccactctcgctacttcacccctaagcccgtgttggacaggacaattgactatttccagcctaacaacaagcgtaatcagctctggttgcgtttgcagacaacaggcaacgtcgatcatgtgggcctgggaactgctttcgagaactcaatctacgaccaagactacaacatccgtatcaccatgtatgtgcagttcagagagttcaatctgaaggatccccccctgaacccgaag. (SEQ ID NO.3) Among them, for the PCV2d Cap protein, the optimized nucleotide sequence is as follows: (SEQ ID NO.4) Furthermore, 6×His tags were added to the C-terminal end of the amino acid sequences of PCV2a, 2b and 2d Cap proteins to facilitate protein purification.

[0011] Furthermore, the preparation method of the high salt agar plate in step (2) is as follows: (1) Use a 10-15 g / L sodium hydrogen phosphate dodecahydrate solution as liquid A and a 1-3 g / L potassium dihydrogen phosphate solution as liquid B; (2) Mix liquid A and liquid B in a ratio of 1:2-5, add agarose and sodium chloride, and adjust the pH value of the system to neutral. Heat until the agarose is completely melted, then add an antibacterial agent, and then make up to 100 mL with purified water. Pour the mixture into a plate at a rate of 25 mL / plate. After cooling and solidifying, punch holes with a plum blossom hole puncher and pick out the agarose gel in the holes. Heat the bottom of the plate with an alcohol lamp flame to seal the bottom, and the high-salt agar plate is obtained.

[0012] Furthermore, the volume ratio of liquid A to liquid B is 1:3, the concentration of disodium hydrogen phosphate dodecahydrate in liquid A is 10-11 g / L, and the concentration of potassium dihydrogen phosphate in liquid B is 1-1.5 g / L.

[0013] Furthermore, in the mixed solution of step (2), the concentration of sodium chloride is 70-80 g / L.

[0014] Furthermore, the antibacterial agent added in step (2) is sodium azide.

[0015] Furthermore, the preparation method of the high-salt dilution in step (3) is as follows: (1) Use a 10-15 g / L sodium hydrogen phosphate dodecahydrate solution as liquid A and a 1-3 g / L potassium dihydrogen phosphate solution as liquid B; (2) After mixing liquid A and liquid B in a ratio of 1:2-5, sodium chloride is added and the pH value of the system is adjusted to be neutral. The method according to claim 1 is characterized in that: Furthermore, the concentration of sodium chloride in the high-salt dilution solution is 70-80 g / L.

[0016] Furthermore, the dilution multiple of the high immune serum is 8 times.

[0017] Another object of the present invention is to provide a high-salt agar plate, which is prepared by the above method.

[0018] Another object of the present invention is to provide a high-salt diluent having a neutral pH value, which comprises a disodium hydrogen phosphate dodecahydrate solution, a potassium dihydrogen phosphate solution and sodium chloride; The concentration of disodium hydrogen phosphate dodecahydrate solution is 10~15g / L, the concentration of potassium dihydrogen phosphate solution is 1~3g / L, and the volume ratio of the two is 1:2~5; The concentration of sodium chloride in the high salt dilution solution is 70~80g / L.

[0019] Beneficial effects of the present invention: 1. The present invention provides a trivalent highly immune serum of porcine circovirus types 2a, 2b and 2d. The highly immune serum is obtained by isolating serum after inoculating piglets with the trivalent virus-like particle vaccine of porcine circovirus types 2a, 2b and 2d. Compared with the traditional method of inoculating piglets with the whole virus inactivated vaccine, the highly immune serum does not involve viruses and does not have the biosafety risk of incomplete inactivation. The antigen has high purity after purification, and the formed virus-like particles have the shell structure of the virus, so it also has the advantages of good specificity and high immunogenicity.

[0020] 2. The conventional method for preparing agar plates is mainly to add NaCl and agarose to PBS, punch holes and seal the bottom before testing. However, since the solubility of the antigen to be tested is not taken into consideration, the test results are not sensitive, or the bacterial growth on the agar plate affects the observation results. The present invention also provides an improved method for preparing agar plates, which prepares high-salt agar plates. By adjusting the composition of the buffer solution, the migration of antigens and antibodies in agarose gel is facilitated; by using a higher concentration of salt and controlling the pH value of the buffer solution, the solubility of the Cap protein is increased, which is beneficial to the diffusion of antigens and antibodies and the combination to form a precipitate, thereby improving the sensitivity of the test; by adding a certain concentration of preservatives, the bacterial growth on the agar plate is inhibited, which is beneficial to the observation of the precipitation line.

[0021] The present invention also provides a method for detecting the agar titer of porcine circovirus type 2 Cap protein antigen using high immune serum and improved agar plates, which solves the problems of buffer interference in BCA method and Bradford method and short shelf life of ELISA kit, easy oxidation of substrate and high price. The method of detecting the agar titer of porcine circovirus type 2 Cap protein antigen using high immune serum and improved agar plates has high sensitivity, strong specificity, simple operation, can effectively avoid buffer interference and has low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is an indirect immunofluorescence image of high immune serum; Figure 2 The test results of different dilution multiples of high immune serum; Figure 3 Comparative test results of high-salt dilution and other dilutions; Figure 4 The test results of different pH buffers are shown; Figure 5 This is the comparative test result of adding sodium azide; Figure 6 This is the comparison test result with the addition of interfering agents. DETAILED DESCRIPTION

[0023] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0024] Example 1 Preparation of trivalent high immune serum against porcine circovirus 2a, 2b, 2d 1. Preparation of trivalent virus-like particle vaccines of porcine circovirus types 2a, 2b, and 2d (1) Porcine circovirus 2a, 2b, 2d virus-like particles are prepared according to the method disclosed in the invention patent application number CN117143888A.

[0025] (2) Porcine circovirus 2a, 2b, and 2d virus-like particles were diluted to 0.15 mg / mL with PBS, then mixed in a 1:1:1 ratio, and then mixed with an equal volume of ISA206 adjuvant and emulsified at around 30°C to form a water-in-oil-in-water vaccine.

[0026] 2. Screening of Porcine Circovirus Type 2 Negative Pigs The porcine circovirus type 2 antibody detection kit of Guangzhou Yueyang Biotechnology Co., Ltd. was used to detect serum antibodies of healthy piglets at 21 days of age, and those with negative results were selected for immunization.

[0027] 3. Immunization Piglets were vaccinated intramuscularly with 2 mL / head / time, and two booster immunizations were performed on the 14th and 28th days after the first immunization. Blood was collected aseptically 42 days after the first immunization, and the serum was separated by centrifugation at 3000 rpm after being placed at 2-8°C for 2 hours and stored below -20°C. Serum antibodies were tested with porcine circovirus type 2 antibody detection kit, OD 450nm If the value is higher than 1.5, it is a high-immune serum, and negative serum is isolated from non-immunized pigs.

[0028] 4. Indirect immunofluorescence antibody level detection Porcine circovirus type 2 ZJ / C strain was diluted to 2000 TCID 50 / mL, inoculate 96-well plates at 50μL / well, then add 100μL of PK15 cell suspension to each well, fix the cells after culturing at 37℃ for 72 hours, discard the fixative and block with 5% skim milk, wash the plate, dilute the high-immune serum obtained in the previous step by different multiples and add it to the 96-well plate at 100μL / well, set up a negative control well, incubate at 37℃ for 2 hours, wash the plate, add FITC-labeled sheep anti-pig IgG at 100μL / well, incubate at 37℃ for 1 hour, and observe fluorescence under a microscope after washing the plate. The results showed that there was no specific fluorescence in the negative control wells, and the high-immune serum could still be observed to have specific fluorescence when diluted 6400 times, indicating that the indirect immunofluorescence antibody titer of the high-immune serum reached more than 1:6400. The fluorescence graph of the high-immune serum is shown in the figure below. Figure 1 shown.

[0029] Example 2 Establishment of improved agar expansion method 1. Determination of dilution multiple of high immune serum (1) Add 1 g of agarose to 100 mL of PBS and heat until the agarose is completely melted. Add purified water to make up to 100 mL and pour into a plate at 25 mL / plate. After cooling and solidification, punch holes with a 7-hole plum blossom puncher, pick out the agarose gel in the holes, and heat the bottom of the plate with an alcohol lamp to seal it.

[0030] (2) Add PCV2 Cap protein antigen to the middle well, and add high immune serum to the surrounding wells 1 to 5 in order of original, 2-fold, 4-fold, 8-fold, and 16-fold dilutions. Add negative serum to well 6. Add 30 to 50 μL to each well. Cover the plate with the lid and place it upside down in a humidified chamber. Incubate at 37°C for 24 hours and observe the results.

[0031] (3) The results are as follows Figure 2 As shown in the figure, when the high immune serum is diluted 2 and 4 times, the precipitation line is thicker, but blurrier near the center hole of the antigen. When it is diluted 8 times, the precipitation line is clear, bright and straight. When it is diluted 16 times, the precipitation line is very shallow. Therefore, it is determined that the best dilution of high immune serum is 8 times.

[0032] 2. Comparison between high salt diluent and other diluents (1) Agar plate preparation Weigh 3.58 g of disodium hydrogen phosphate dodecahydrate, 0.24 g of potassium dihydrogen phosphate, 0.2 g of potassium chloride and 8 g of sodium chloride and dissolve them in 1 L of purified water to obtain a PBS solution; weigh 10.74 g of disodium hydrogen phosphate dodecahydrate and dissolve them in 1 L of purified water to obtain a liquid A, and weigh 1.36 g of potassium dihydrogen phosphate and dissolve them in 1 L of purified water to obtain a liquid B; take 6 triangular flasks, add 100 mL of a liquid A to the first triangular flask, add 100 mL of a liquid B to the second triangular flask, add 100 mL of PBS to the third triangular flask, add 25 mL of a liquid A and 75 mL of a liquid B to the fourth triangular flask, add 25 mL of a liquid A, 75 mL of a liquid B and 2 g of sodium chloride to the fifth triangular flask, and add 25 mL of a liquid A, 75 mL of a liquid B and 8 g of sodium chloride to the sixth triangular flask; Add 1g of agarose to the 1st to 6th triangular flasks, heat until the agarose is completely melted, and then fill with purified water to 100mL. Pour 25mL / plate into the plates and mark them as 1 to 6. After cooling and solidification, use a plum blossom punch to punch holes and pick out the agarose gel in the holes. Heat the bottom of the plate with an alcohol lamp flame to seal the bottom. The sodium chloride concentration in PBS is 0.8%, and the sodium chloride concentrations in the 5th and 6th plates are 2% and 8%, respectively. The concentrations of disodium hydrogen phosphate dodecahydrate and potassium dihydrogen phosphate are both increased, so the 5th plate is called a low-salt dilution agar plate, and the 6th plate is called a high-salt dilution agar plate.

[0033] (2) Add 8-fold diluted high-immunity serum to the middle well of the 1st to 6th agar plates, and add graded diluted PCV2 Cap protein antigen to the 6 surrounding wells in sequence. The high-immunity serum and antigen added to the 1st agar plate are diluted with liquid A, the high-immunity serum and antigen added to the 2nd agar plate are diluted with liquid B, the high-immunity serum and antigen added to the 3rd agar plate are diluted with PBS, the high-immunity serum and antigen added to the 4th agar plate are diluted with a mixture of 25mL of liquid A + 75mL of liquid B, the high-immunity serum and antigen added to the 5th agar plate are diluted with a low-salt diluent of a mixture of 25mL of liquid A + 75mL of liquid B + 2g of sodium chloride, and the high-immunity serum and antigen added to the 6th agar plate are diluted with a high-salt diluent of a mixture of 25mL of liquid A + 75mL of liquid B + 8g of sodium chloride. Add 30-50μL to each well, cover the plate with a lid, place it upside down in a humidified box, incubate at 37℃ for 24 hours, and observe the results.

[0034] The results are as follows Figure 3As shown, the test results of Liquid A used in the first agar plate and Liquid B used in the second agar plate showed that the agar expansion titer was 1:8, the test results of PBS used in the third agar plate and Liquid A + Liquid B used in the fourth agar plate showed that the agar expansion titer was 1:16, but the precipitation line at the titer of 1:16 on the fourth agar plate was more obvious, the test results of the low-salt dilution of 25mL Liquid A + 75mL Liquid B + 2g of sodium chloride used in the fifth agar plate showed that the agar expansion titer was 1:32, and the test results of the high-salt dilution of 25mL Liquid A + 75mL Liquid B + 8g of sodium chloride used in the sixth agar plate showed that the agar expansion titer was 1:64, indicating that the high-salt agar plate and the high-salt dilution improved the detection sensitivity.

[0035] 3. Comparison of buffer pH (1) Prepare Solution A and Solution B according to the above method. Take 25 mL of Solution A and 75 mL of Solution B in each of four conical flasks, mix them, then add 1 g of agarose and 8 g of NaCl, adjust the pH to 6.0, 7.0, 8.0 and 9.0 respectively, heat until the agarose is completely melted, add purified water to 100 mL, pour into the plate at 25 mL / plate, cool and solidify, punch holes with a plum blossom punch, and pick out the agarose gel in the holes. Heat the bottom of the plate with an alcohol lamp flame to seal it.

[0036] (2) Add 8-fold diluted high-immunity serum to the middle wells of the agar plates at pH 6.0, 7.0, 8.0 and 9.0, and add graded diluted PCV2 Cap protein antigen to the 6 surrounding wells in sequence. The high-immunity serum and antigen are diluted with the above-mentioned high-salt diluent, and the pH is adjusted to the pH value of the corresponding agar plate. The amount added to each well is 30-50 μL. Cover the plate with a lid and place it upside down in a humidified chamber. Incubate at 37°C for 24 hours and observe the results.

[0037] The results are as follows Figure 4 As shown in the figure, the PCV2 Cap protein antigen agar titer detected on the agar plate with a pH of 7.0 was the highest, at 1:60, while the titers at other pHs were lower, at 1:40 for pH 6.0 and pH 8.0, and the precipitation line at 1:40 for pH 9.0 was extremely weak.

[0038] 4. Comparison of adding preservative sodium azide (1) Prepare Solution A and Solution B according to the above method. Take 25 mL of Solution A and 75 mL of Solution B in two Erlenmeyer flasks, mix them, then add 1 g of agarose and 8 g of NaCl, adjust the pH to 7.0, and heat until the agarose is completely melted. Add 1 mL of 2% sodium azide to the first Erlenmeyer flask and do not add sodium azide to the second one. Then make up to 100 mL with purified water and pour into the plate at a rate of 25 mL / plate. After cooling and solidification, use a plum blossom hole punch to punch holes and pick out the agarose gel in the holes; heat the bottom of the plate with an alcohol lamp to seal the bottom.

[0039] (2) In both agar plates, add 8-fold diluted high-immunity serum to the middle well, and add graded diluted PCV2 Cap protein antigen to the surrounding 6 wells in sequence. The high-immunity serum and antigen are diluted with the above-mentioned high-salt diluent and the pH is adjusted to 7.0. The amount added to each well is 30-50 μL. Cover the plate with a lid and place it upside down in a humidified chamber. Incubate at 37°C for 120 hours and observe the results.

[0040] The results are as follows Figure 5 As shown, when the results were observed for 120 hours, the agar plates without sodium azide had colony growth that affected the results, while the agar plates with sodium azide did not affect the observation.

[0041] 5. Construction of an improved agar amplification detection method According to the above results, the improved agar agar detection method is as follows: on the punched high-salt agar plate, add 30-50 μL of 8-fold diluted high-immunity serum to the middle hole, and add 30-50 μL of diluted porcine circovirus type 2 Cap protein antigen to the surrounding 6 holes in sequence. Both the high-immunity serum and antigen are diluted with a high-salt diluent with a pH of 7.0. After covering the plate with a lid, place it upside down in a wet box and incubate at 37°C for 24 hours to observe the results.

[0042] Example 3 Comparison of adding interfering agents with BCA and Bradford methods Some reagents or impurities seriously interfere with the accuracy of protein content detection results. For example, the eluent commonly used for purification of His-tagged proteins often requires 500 mM imidazole. In addition, impurities may remain in the purification process. Therefore, this example compares the improved agar amplification detection method established in Example 2 with the BCA and Bradford methods. The specific process is as follows: Prepare PCV2 Cap protein standard solution and PCV2 Cap protein solution containing interfering agent. The solution containing interfering agent is prepared by adding 500mM imidazole and 500μg / mL BSA protein to the PCV2 Cap protein standard solution. The improved agar amplification detection method, BCA method and Bradford method are used for detection respectively. The results are shown in Figure 6 and Table 1.

[0043] Table 1 Detection results of three methods

[0044] like Figure 6 As shown in the test results of Table 1, when the method constructed by the present invention is used for detection, the agar-agar test results before and after the addition of the interfering agent are both 1:60, indicating that the addition of 500 mM imidazole and 500 μg / mL BSA protein has no effect on the detection of agar-agar titer.

[0045] The detection results of BCA and Bradford methods for PCV2 Cap protein standard solution and PCV2 Cap protein solution containing interfering agents are shown in Table 1, wherein the BCA detection results show that the protein concentrations before and after the addition of the interfering agent are 1326 μg / mL and 3375 μg / mL, respectively, and the Bradford detection results show that the protein concentrations before and after the addition of the interfering agent are 1357 μg / mL and 2283 μg / mL, respectively; the results indicate that the BCA method and Bradford method will be interfered by imidazole and impurities, but the improved agar amplification detection method constructed by the present invention will not be interfered, which proves that the improved agar amplification detection method constructed by the present invention has strong specificity and can effectively avoid buffer interference.

[0046] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. A method for improving the sensitivity of porcine circovirus type 2 Cap protein antigen agar amplification detection, characterized in that: The following steps are involved: (1) Inoculate piglets with a trivalent virus-like particle vaccine of porcine circovirus 2a, 2b, and 2d, and then separate the serum to obtain a trivalent high-immunity serum of porcine circovirus 2a, 2b, and 2d; (2) Preparation of high salt agar plates; (3) Dilute the trivalent high immune serum and porcine circovirus type 2 Cap protein antigen with high salt diluent, then add the diluted trivalent high immune serum and porcine circovirus type 2 Cap protein antigen to the holes of the agar plate and incubate at 35-37°C for 20-24 hours to complete the test.

2. The method according to claim 1, characterized in that The trivalent virus-like particle vaccine of porcine circovirus types 2a, 2b, and 2d includes porcine circovirus types 2a, 2b, and 2d Cap proteins in a volume ratio of 1:1:1, and an adjuvant.

3. The method according to claim 1, characterized in that The preparation method of the high salt agar plate in step (2) is as follows: (1) Use a 10-15 g / L sodium hydrogen phosphate dodecahydrate solution as liquid A and a 1-3 g / L potassium dihydrogen phosphate solution as liquid B; (2) Mix liquid A and liquid B in a ratio of 1:2-5, add agarose and sodium chloride, and adjust the pH value of the system to neutral. Heat until the agarose is completely melted, then add the antibacterial agent, pour into a plate, and then cool and solidify, punch holes, and then heat to seal the bottom of the holes to prepare a high-salt agar plate.

4. The method according to claim 3, characterized in that The volume ratio of liquid A to liquid B is 1:3, the concentration of disodium hydrogen phosphate dodecahydrate in liquid A is 10-11 g / L, and the concentration of potassium dihydrogen phosphate in liquid B is 1-1.5 g / L.

5. The method according to claim 3, characterized in that: In the mixed solution of step (2), the concentration of sodium chloride is 70-80 g / L.

6. The method according to claim 3, characterized in that The antibacterial agent added in step (2) is sodium azide.

7. The method according to claim 1, characterized in that The preparation method of the high salt dilution in step (3) is as follows: (1) Use a 10-15 g / L sodium hydrogen phosphate dodecahydrate solution as liquid A and a 1-3 g / L potassium dihydrogen phosphate solution as liquid B; (2) Mix Liquid A and Liquid B in a ratio of 1:2~5, add sodium chloride, and adjust the pH value of the system to neutral.

8. The method according to claim 7, characterized in that The concentration of sodium chloride in the high salt dilution solution is 70~80g / L.

9. A high salt agar plate, characterized in that: The method is prepared by any one of claims 3 to 6.

10. A high-salt dilution, characterized in that: The pH value of the high-salt diluent is neutral, and the high-salt diluent includes disodium hydrogen phosphate dodecahydrate solution, potassium dihydrogen phosphate solution and sodium chloride; The concentration of the disodium hydrogen phosphate dodecahydrate solution is 10-15 g / L, the concentration of the potassium dihydrogen phosphate solution is 1-3 g / L, and the volume ratio of the two is 1:2-5; The concentration of sodium chloride in the high-salt dilution solution is 70-80 g / L.

Images