Use of a kdm5b inhibitor in the manufacture of a medicament for treating an ebv-associated epithelial tumor

Abstract

The application provides application of a KDM5B inhibitor in preparation of a drug for treating an EBV-related epithelial tumor. The application can be used for prognosis monitoring and precise treatment of an EBV-related epithelial tumor patient in clinic.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and particularly relates to application of KDM5B inhibitors in preparation of drugs for treating EBV-related epithelial tumors. BACKGROUND

[0002] Epstein-Barr virus (EBV) is a ubiquitous herpes virus that plays a key role in the progression of a variety of human tumors, especially EBV-related epithelial tumors, which account for about 80% of all EBV-related malignancies. EBV-related epithelial tumors mainly include nasopharyngeal carcinoma and EBV-positive gastric cancer. The incidence of nasopharyngeal carcinoma has a significant geographical specificity, mainly occurring in southern China and Southeast Asia. Studies have shown that about 98% of nasopharyngeal carcinoma is associated with EBV infection, and EBV infection is an early event in the development of nasopharyngeal carcinoma. The incidence of EBV-positive gastric cancer accounts for about 10% of all gastric cancers. Compared with EBV-negative gastric cancer, EBV-positive gastric cancer has unique pro-oncogenic molecular features, including high-frequency mutation of PIK3CA, high genomic methylation, etc.; and EBV-positive gastric cancer is relatively poorly differentiated histologically compared with EBV-negative gastric cancer, indicating that EBV plays an important role in the malignant progression of EBV-positive gastric cancer.

[0003] Although the relationship between EBV and these tumors has been confirmed, especially through detection of EBV molecular expression in tumors and increase in plasma EBV DNA levels of patients during disease progression; however, the specific molecular mechanisms of EBV driving the development of these tumors and their clinical translation prospects still need to be explored.

[0004] Currently, radiotherapy combined with chemotherapy and surgery is still the first-line treatment strategy for patients with EBV-related epithelial tumors. With the progress of magnetic resonance imaging (MRI), intensity-modulated radiation therapy (IMRT), concurrent chemoradiotherapy, immunotherapy and other diagnostic and treatment technologies, the overall prognosis of EBV-related epithelial tumors has been significantly improved. However, disease recurrence, metastasis and treatment resistance are still key factors limiting the improvement of prognosis, especially for advanced patients, whose survival rate and quality of life are still low. Therefore, it is urgent to discover new markers of EBV-related epithelial tumors, so as to achieve more accurate prognosis evaluation and use them as potential therapeutic targets for patients with EBV-related epithelial tumors. The key role of EBV in the malignant progression of epithelial tumors makes it an ideal therapeutic target. Blocking the molecular mechanisms by which EBV promotes the progression of epithelial tumors is expected to provide a new direction for the treatment of EBV-related epithelial tumors, thereby further improving the prognosis of patients. SUMMARY

[0005] In view of the defects of the prior art, the purpose of the present application is to provide a new tumor marker for EBV-related epithelial tumor and application thereof, so as to solve the problems raised in the above background.

[0006] To achieve the above technical purpose, the present application provides an application of KDM5B inhibitor in the preparation of a drug for treating EBV-related epithelial tumor.

[0007] In a preferred embodiment, the EBV-related epithelial tumor is nasopharyngeal carcinoma or EBV-positive gastric cancer.

[0008] In a preferred embodiment, the KDM5B inhibitor specifically targets KDM5B and inhibits KDM5B by chelating iron.

[0009] In a preferred embodiment, the KDM5B inhibitor is selected from any one or more of AS-8351 (CAS No.: 796-42-9), KDM5B-IN-4 (CAS No.: HY-149091), GSK467 (CAS No.: 1628332-52-4), PBIT (CAS No.: 2514-30-9), CPI-455 (CAS No.: 1628208-23-0), but not limited thereto. Any agent, especially a small molecule compound, that can specifically inhibit KDM5B belongs to the "KDM5B inhibitor" referred to herein.

[0010] The expression level of KDM5B in EBV-related epithelial tumor tissues and cells was detected by single-cell transcriptome sequencing and whole transcriptome sequencing, and it was found that KDM5B was significantly highly expressed in EBV-positive tumor tissues and cells.

[0011] The expression of KDM5B in EBV-related epithelial tumor can be detected by immunohistochemical staining method on paraffin-embedded tumor tissue wax block sections, and it is found that KDM5B is widely and abundantly expressed in tumor cells, and the copy number of EBV DNA in the plasma of patients is significantly related to the high expression of KDM5B, and the high expression of KDM5B is significantly related to the poor prognosis of patients.

[0012] KDM5B in EBV-positive tumor cells can promote the proliferation ability of tumor cells, and this proliferative effect can be inhibited by KDM5B inhibitors, so KDM5B can be used as an important target for the treatment of EBV-related epithelial tumor, and KDM5B inhibitors can be used to treat EBV-related epithelial tumor.

[0013] It can be seen that the expression level of KDM5B is related to the tumor proliferation of EBV-related epithelial tumor, and further significantly related to the clinical prognosis of patients with EBV-related epithelial tumor, and can be used for the prognosis monitoring and precise treatment of patients with EBV-related epithelial tumor in clinic, and has high clinical transformation value. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 It is shown that: (A) the expression level of KDM5B in the EBV high expression and EBV low expression tumor cell population in the single cell transcriptome sequencing data of nasopharyngeal carcinoma; (B) the expression level of KDM5B in the cells not infected (NC) and infected with EBV (EBV-P) in the whole transcriptome sequencing data of nasopharyngeal carcinoma and gastric cancer cells.

[0015] Figure 2 It is shown that: (A) the expression of KDM5B in the paraffin-embedded wax block section of nasopharyngeal carcinoma tumor tissue is detected by immunohistochemical staining experiment; (B) the KDM5B immunohistochemical staining results of 120 nasopharyngeal carcinoma patients and the patient's plasma EBV copy number are analyzed, and it is found that the number of patients with high expression of KDM5B is more in the EBV DNA copy number positive patient group; (C) the survival analysis of the KDM5B immunohistochemical staining results of 120 nasopharyngeal carcinoma patients and the patient's prognosis information, the higher the expression of KDM5B in the patient's tumor tissue, the worse the patient's prognosis.

[0016] Figure 3 It is shown that: (A) the KDM5B is stably knocked down in EBV positive epithelial tumor cells using shRNA lentivirus packaging system targeting KDM5B; (B) the effect of KDM5B on the proliferation ability of tumor cells is detected by plate colony formation experiment, and the knockdown of KDM5B significantly inhibits the proliferation of tumor cells.

[0017] Figure 4 It is shown that the KDM5B is stably knocked down in EBV positive epithelial tumor cells using shRNA lentivirus packaging system targeting KDM5B, and the effect of KDM5B on the tumorigenicity of tumor cells is detected by in vivo tumorigenicity experiment. (A) The tumor volume obtained by measuring the control group and the KDM5B knockdown group in the mouse experiment; (B) the transplanted tumor obtained by sampling the control group and the KDM5B knockdown group in the mouse experiment and the final statistical tumor weight.

[0018] Figure 5(A) plate clone experiment to detect the proliferation ability of EBV-positive epithelial tumor cells treated with control solvent and KDM5B inhibitor, the colony formation ability of cells in KDM5B inhibitor treatment group is significantly lower than that in control group; (B) the tumor volume measured in the control group and KDM5B inhibitor group in the subcutaneous tumor experiment of EBV-positive nasopharyngeal carcinoma PDX mice (NPC PDX #1, NPC PDX #2) and AGS-EBV cells treated with control solvent and KDM5B inhibitor by intraperitoneal injection; (C) the transplanted tumors obtained by sampling in the control group and KDM5B inhibitor group in the mouse experiment and the final statistical tumor weight.

[0019] Figure 6 The immunohistochemical staining experiment is shown to detect the expression of the proliferation marker Ki-67 in the paraffin-embedded wax block sections of the mouse tumor tissues obtained in Figure 5 The immunohistochemical staining experiment is shown to detect the expression of the proliferation marker Ki-67 in the paraffin-embedded wax block sections of the mouse tumor tissues obtained in DETAILED DESCRIPTION

[0020] In order to enable a clearer understanding of the above-mentioned purposes, features and advantages of the present application, the present application will be further described in detail below in conjunction with the drawings and specific examples. Those skilled in the art should understand that the examples are only to help understand the present application and should not be regarded as a specific limitation on the present application; unless otherwise specified, the sequencing and analysis methods used in the following examples are all conventional methods.

[0021] DEFINITIONS

[0022] As used herein, "EBV-associated epithelial tumor" refers to nasopharyngeal carcinoma and EBV-positive gastric cancer.

[0023] As used herein, "EBV-positive gastric cancer" refers to gastric cancer in which EBV molecules are present in the tumor tissue as confirmed by EBER in situ hybridization.

[0024] As used herein, "KDM5B inhibitor" refers to a small molecule compound that specifically targets KDM5B, which inhibits KDM5B by sequestering iron. The "KDM5B inhibitor" can be selected from any one or more of AS-8351 (CAS No.: 796-42-9), KDM5B-IN-4 (CAS No.: HY-149091), GSK467 (CAS No.: 1628332-52-4), PBIT (CAS No.: 2514-30-9), CPI-455 (CAS No.: 1628208-23-0), but is not limited thereto.

[0025] Example 1: KDM5B is highly expressed in EBV-positive tumor tissues and cells and its high expression is associated with poor prognosis of patients

[0026] A total of 10 nasopharyngeal carcinoma patients from Sun Yat-sen University Cancer Center were collected for single-cell transcriptome sequencing. In short, the nasopharyngeal carcinoma tumor tissue samples were first enzymatically digested into a single-cell suspension. Then, a commercially available single-cell transcriptome library construction kit (10x Genomics) was used to process the live single cells and construct the library. Finally, the resulting cDNA library was subjected to high-throughput sequencing to obtain the sequence files.

[0027] The results are as follows Figure 1 As shown. Analysis of the acquired single-cell transcriptome sequencing data revealed tumor cell subpopulations with high and low EBV expression. Among them, KDM5B was significantly highly expressed in the nasopharyngeal carcinoma tumor cell subpopulation with high EBV expression (…). Figure 1 A).

[0028] On the other hand, an in vitro EBV infection model was used, specifically, an EBV suspension was prepared by inducing intracellular viral lysis and release after expanding the culture of the EBV-transformed lymphocyte line AKATA-EBV-GFP, which integrates the EBV genome. The EBV suspension was then used to infect cells through contact culture. Whole transcriptome sequencing was performed on nasopharyngeal carcinoma cells (S26, HK-1, provided by Sun Yat-sen University Cancer Center) and gastric carcinoma cells (AGS, ATCC NO. CRL-1739) before and after EBV infection. Specifically, total RNA was extracted from the cells and purified using the Ribo-Zero Magnetic Kit (Illumina) to remove ribosomal RNA. Then, a library was constructed using the commercially available TruSeq RNA Library Prep Kit (Illumina), and finally, the obtained library was subjected to high-throughput sequencing to obtain the sequence files.

[0029] Analysis of the obtained whole transcriptome sequencing data showed that KDM5B expression was significantly increased in EBV-infected cells (EBV-P). Figure 1 B).

[0030] Further, paraffin-embedded sections of tumor tissue from 120 nasopharyngeal carcinoma patients at Sun Yat-sen University Cancer Center were collected and immunohistochemically stained. In short, after dewaxing, hydration, antigen retrieval, and oxidase removal, and followed by blocking, the tumor tissue sections were incubated overnight with KDM5B antibody (Sigma, HPA027179), stained, and mounted. Pathologists reviewed and scored the slides to assess KDM5B expression in the tissue. Figure 2 A) Combining patient plasma EBV DNA copy number levels and patient prognostic information, it was found that patients with positive plasma EBV DNA copy numbers had higher KDM5B expression levels. Figure 2, B), while patients with high KDM5B expression had a worse survival prognosis Figure 2 , C), suggesting that KDM5B expression is associated with the malignant progression of EBV-associated epithelial tumors and affects the survival of patients.

[0031] Example 2: Expression of KDM5B in EBV-associated epithelial tumors promotes the in vitro proliferation and in vivo tumorigenesis of tumor cells

[0032] Stable KDM5B knockdown EBV-positive nasopharyngeal carcinoma cell lines (HONE1-EBV, CNE2-EBV) and gastric cancer (AGS-EBV) cell lines were constructed using a shRNA lentivirus packaging system targeting KDM5B. The corresponding shRNA plasmid (control plasmid, KDM5B knockdown plasmid 1, KDM5B knockdown plasmid 2) and lentivirus packaging plasmid were transfected into 293T cells at a ratio of 1:0.75:0.3 (corresponding shRNA plasmid: psPAX2: pMD2.G), and then the culture supernatant of 293T cells cultured for 48 hours was collected for infection of the target cells (HONE1-EBV, CNE2-EBV, AGS-EBV cells) to obtain stable cell lines.

[0033] Briefly, the corresponding shRNA plasmids were constructed as follows:

[0034] The control sequence (5'-AATTCAAAAATTCCTGGAACAATTGCTTTTACTCGAGTAAAAGCAATTGTTCCAGGAA-3') and the shRNA sequence targeting KDM5B (5'-CCGGAAGCGTATCCGTTTGGA ACAACTCGAGTTGTTCCAAACGGATACGCTTTTTTTG-3'; 5'-AATTCAAAAAAAGCGTAT CCGTTTGGAACAACTCGAGTTGTTCCAAACGGATACGCTT-3') were ligated to the digested PLKO.1 plasmid through the enzyme digestion sites (Age1, EcoR1) to construct the control plasmid, KDM5B knockdown plasmid 1, and KDM5B knockdown plasmid 2.

[0035] WB results showed that the shRNA lentivirus packaging system targeting KDM5B stably knocked down KDM5B in EBV-positive epithelial tumor cells Figure 3 , A). Using stable KDM5B knockdown EBV-positive nasopharyngeal carcinoma (HONE1-EBV, CNE2-EBV) and gastric cancer (AGS-EBV) cell lines, in vitro plate colony formation experiments were performed to detect the effect of KDM5B on the proliferation ability of tumor cells. The results showed that the colony formation ability of tumor cells with KDM5B knockdown was significantly reduced Figure 3, B), indicating that KDM5B knockdown can effectively weaken the in vitro proliferation ability of EBV-positive epithelial tumor cells.

[0036] Male BALB / c nude mice of four-week size were inoculated with CNE2-EBV and AGS-EBV cells with shRNA knockdown of KDM5B or control group mixed with Matrigel (100ul PBS containing 5x 10 6 The purpose of the cell, the volume ratio of cell suspension to Matrigel was 4:1) by subcutaneous injection (100ul / injection point). The tumor size of the mice was measured every three days with a caliper, and the formula V = 0.52*L*W 2 The tumor volume was calculated, and the growth curve of the tumor volume of the mice was drawn, where L is the longest diameter of the tumor, and W is the shortest diameter.

[0037] The results of the in vivo tumor formation experiment showed that the tumor volume formed by KDM5B knockdown CNE2-EBV and AGS-EBV cells was significantly smaller than that of the control group Figure 4 , A), and the statistical results of the transplanted tumors and tumor weights of the control group and KDM5B knockdown group in the mouse experiment showed that the growth rate of the mouse tumor formed by KDM5B knockdown tumor cells was significantly weakened Figure 4 , B). This indicates that KDM5B knockdown can effectively inhibit the in vivo tumor formation ability of EBV-positive epithelial tumor cells.

[0038] Example 3: Targeted KDM5B treatment regimen can inhibit the tumor progression of EBV-positive epithelial tumors in mice

[0039] After treating HONE1-EBV, CNE2-EBV, AGS-EBV cells (from Sun Yat-sen University Cancer Center) with a working concentration (10μm) of KDM5B inhibitor AS-8351 (CAS No.: 796-42-9) for 24 hours, cell growth counting experiments were performed, and cells treated with blank solvent (DMSO) were used as controls. Plate colony formation experiments were performed. The experimental results showed that the colony formation ability of cells in the KDM5B inhibitor treatment group was significantly lower than that of the control group, and targeted inhibition of KDM5B significantly inhibited the in vitro proliferation ability of EBV-related epithelial tumor cells Figure 5 , A).

[0040] About 4-5 week old NOD / Scid mice were used for EBV-positive nasopharyngeal carcinoma PDX (human tumor xenograft, NPC PDX#1, NPC PDX#2) inoculation experiments. EBV-positive nasopharyngeal carcinoma tissue blocks were evenly divided into about 10mm 3 / block, and were inoculated into the abdomen of mice according to the experimental plan. When the tumor volume of the tissue reached about 100mm 3 , the mice were randomly divided into experimental and control groups.

[0041] About 4-5 weeks old male BALB / c nude mice were used for EBV-positive gastric cancer cell AGS-EBV subcutaneous tumor formation experiment. AGS-EBV cells were mixed with Matrigel (5x 10 6 The purpose of the cells, the volume ratio of cell suspension to Matrigel was 4:1) was inoculated by subcutaneous injection (100ul / injection point), and when the subcutaneous tumor volume of the cells was about 100mm 3 When the subcutaneous tumor volume of the cells was about 100mm

[0042] Then the control group of mice was injected intraperitoneally with the control solvent (DMSO), and the experimental group of mice was injected intraperitoneally with the KDM5B inhibitor (AS-8351), with an injection dose of 25mg / kg, and injection every other day; continuously observe and record the tumor changes and the growth state of the mice. Every three days, the tumor size of the mice was measured with a vernier caliper, and the formula V=0.52*L*W 2 The tumor volume was calculated to draw the mouse tumor volume growth curve (where L is the longest diameter of the tumor, and W is the shortest diameter), and the mouse tumor volume measurement results are shown in Figure 5 (B). Before the tumor volume of the mice reached the ethical limit volume, the experimental mice were euthanized. The tumor of the mouse after treatment and the corresponding tumor weight are shown in Figure 5 (C), it can be seen that the tumor volume of the mouse after KDM5B inhibitor treatment is significantly reduced.

[0043] The paraffin sections prepared from the tumor tissue were subjected to immunohistochemical staining to detect the proliferation marker Ki-67 and count the positive rate of Ki-67 in each group. The experimental results show that the Ki-67 positive rate of the tumor of the mouse treated with the KDM5B inhibitor is significantly decreased Figure 6 ), further confirming that targeting KDM5B significantly inhibits the growth of the tumor, and KDM5B is expected to become a new epigenetic therapeutic target in EBV-related epithelial tumors in the future.

Claims

1. Use of a KDM5B inhibitor in the manufacture of a medicament for treating an EBV-associated epithelial tumor; the EBV-associated epithelial tumor is EBV-positive gastric cancer; the KDM5B inhibitor is AS-8351 or an shRNA targeting KDM5B, the shRNA targeting KDM5B has the following sequence: 5'- CCGGAAGCGTATCCGTTTGGAACAACTCGAGTTGTTCCAAACGGATACGCTTTTTTTG - 3'; 5'- AATTCAAAAAAAGCGTATCCGTTTGGAACAACTCGAGTTGTTCCAAACGGATACGCTT - 3'.

2. Use according to claim 1, characterized in that, the KDM5B inhibitor specifically targets KDM5B and inhibits KDM5B by sequestering iron.

Images