A biocontrol bacterium for Acanthus corylifolia and its application

Abstract

The present invention belongs to the technical field of plant pest biocontrol, and discloses a biocontrol bacterium for Paraboeremia selaginellae and its application. The biocontrol bacterium is classified and named Paraboeremia selaginellae, and its strain number is JSAFC 2053. It has been deposited in the General Microbiology Center of the China National Committee for the Collection of Microorganisms on September 23, 2024, and the deposit number is CGMCC 41561. The immersion method and the soil mixing method show that the spores of the biocontrol bacterium JSAFC 2053 for Paraboeremia selaginellae are highly pathogenic to Paraboeremia selaginellae larvae, are environmentally friendly and pollution-free, and are not prone to drug resistance. Therefore, the strain can be used to control Paraboeremia selaginellae larvae during the unearthed stage, can reduce the damage caused by Paraboeremia selaginellae adults at the source, and has good development potential and application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a biocontrol bacterium of Aequorea corydalis and an application thereof. Background Art

[0002] The copper beetle (Anomala corpulenta) is a major underground pest in my country's agricultural areas. From the 1970s to the early 1980s, widespread control efforts were focused on underground pests. However, this effort subsequently became neglected or even abandoned, leading to a continuous accumulation of underground pest populations. With recent adjustments to agricultural cropping structures, shifts in farming systems and crop variety distribution, and particularly the significant increase in the variety and area of ​​cash crops such as peanuts, soybeans, tubers, and fruit trees, the severity of the pest has gradually increased, now a disaster in many areas. Long-term reliance on highly toxic, extremely toxic, and high-residue chemical pesticides has led to increasing resistance among beetles, a sharp decline in natural enemy populations, and increasingly severe environmental pollution. With the development of pollution-free ecological and organic agriculture, the focus of pest management has shifted to its ecological relationship. Control of underground pests like the copper beetle is challenging, and biocontrol agents with relatively good environmental safety and compatibility are undoubtedly the primary means of prevention and control.

[0003] The A. coronata beetle infects both adults and larvae. Adults feed on the leaves of trees and crops, causing notches. Larvae feed on newly germinated seeds at the base of crops or sever the base of plant stems and roots, causing plant death. These wounds are susceptible to pathogens and can lead to other diseases. Larvae and pupae live in the soil, overwintering as larvae. Before pupation and emergence, larvae migrate to the soil surface. If this characteristic can be exploited to control A. coronata beetles at the larval stage, the damage caused by A. coronata beetles can be mitigated at the source and the many drawbacks of chemical pesticide control can be avoided. Biocontrol fungi are characterized by their diverse parasitic species, strong adaptability, short pathogenicity, high specificity, non-toxicity to humans and livestock, and environmental friendliness. Summary of the Invention

[0004] The purpose of the present invention is to provide a biocontrol bacterium for A. coparis and its application in inhibiting the growth of A. coparis.

[0005] Technical solution: In order to enrich the resource library of biocontrol agents for Paraboeremia selaginella, the present invention provides a biocontrol bacterium for Paraboeremia selaginella. The strain number of the biocontrol bacterium for Paraboeremia selaginella is JSAFC 2053, which is deposited in the General Microbiology Center of China Culture Collection Administration on September 23, 2024. The deposit number is CGMCC41561, and the microbial classification is named Paraboeremia selaginellae.

[0006] Furthermore, the nucleotide sequence of the rpb2 gene of the A. corydalis biocontrol bacterium is shown in SEQ ID NO.1.

[0007] The present invention also provides a biocontrol agent for A. corydalis. The active ingredients of the biocontrol agent for A. corydalis are the above-mentioned biocontrol bacteria, hyphae or conidia thereof.

[0008] The present invention also provides the use of the above-mentioned A. coparis beetle biocontrol bacteria and A. coparis beetle biocontrol bacteria agent in inhibiting the growth of A. coparis beetle.

[0009] Furthermore, the application is specifically to spray the spore suspension of the above-mentioned copper beetle biocontrol bacteria on the copper beetle larvae, or to add the spore suspension of the copper beetle biocontrol bacteria into the soil containing the copper beetle larvae.

[0010] Furthermore, the spore suspension is prepared by: (1) inoculating the copper green beetle biocontrol bacterium Paraboeremiaselaginellae JSAFC 2053 on a PDA culture medium to prepare a culture; (2) placing the culture prepared in step (1) in a Tween-80 solution (0.1%), filtering out the spores, and preparing a copper green beetle biocontrol agent.

[0011] Furthermore, the culture condition in step (1) is culture at 25° C. in the dark for 5-7 days.

[0012] Furthermore, the spore concentration of the biocontrol agent for A. corydalis is 10 6 pieces / mL.

[0013] Furthermore, the amount of the spore suspension of the A. corydalis biocontrol bacteria added to the soil in step (2) is 1 mL / 10 g soil.

[0014] Beneficial Effects: Compared with existing technologies, the present invention has the following significant advantages: A biocontrol bacterium, Paraboeremiaselaginellae JSAFC 2053, was isolated and purified from soil in Huang Gongwang Forest Park in Hangzhou, Zhejiang Province. This strain can be used as a biocontrol agent, exhibiting a high mortality rate against A. coerulea, while being environmentally friendly and non-toxic. It can significantly inhibit the survival of A. coerulea larvae, and is of great significance for the future development of biocontrol agents for A. coerulea. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Colony morphology of the biocontrol bacterium Paraboeremia selaginellae JSAFC 2053 of the present invention;

[0016] Figure 2 :Phylogenetic tree of Paraboeremia selaginellae JSAFC 2053, a biocontrol bacterium against the copper beetle;

[0017] Figure 3 : The effect of the biocontrol bacterium Paraboeremia selaginellae JSAFC 2053 of the present invention on the growth of the larvae of the copper green beetle. DETAILED DESCRIPTION

[0018] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0019] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can control plant pests, mainly bacteria, fungi, and actinomycetes.

[0020] Example 1: Isolation and Identification of the Biocontrol Bacteria Paraboeremia selaginellae JSAFC 2053

[0021] 1. Isolation of the biocontrol bacterium Paraboeremia selaginellae JSAFC 2053

[0022] JSAFC 2053 was isolated from soil collected from Huang Gongwang Forest Park in Hangzhou, Zhejiang Province. The bacterial colony characteristics are as follows: when cultured on PDA plate, the colony grows rapidly and grows close to the substrate. Its surface color is white and its bottom color is orange-yellow ( Figure 1 ).

[0023] 2. Molecular Biological Identification of Paraboeremia selaginellae JSAFC 2053, a Biocontrol Bacteria against Copper Green Beetles

[0024] (1) The genomic DNA of strain JSAFC 2053 was extracted using a kit from TIANGEN.

[0025] (2) Amplification of the rpb2 gene from genomic DNA. DNA amplification was performed in a 30 μL reaction volume, containing 15 μL 2× EasyTaq PCR SuperMix (+ dye), 1 μL each of the primer pair rpb2-5F (SEQ ID NO. 2: 5'-GAYGAYMGWGATCAYTTYGG-3') and rpb2-7cR (SEQ ID NO. 3: 5'-CCCATRGCTTGYTTRCCCAT-3') (10 μM), 2 μL template DNA, and 11 μL ddH2O. The PCR amplification program was as follows: 94°C denaturation for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 45 s, and extension at 72°C for 60 s; and a final extension at 72°C for 10 min.

[0026] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: the rpb2 gene sequence of strain JSAFC 2053 was SEQ ID NO. 1 (TCGTTTGCCCTGCCGAGACACCTGAAGGACAGGCCTGCGGTCTGGTCAAGAAC TTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGATGCCGGTCCTATCTCCGACTTCATGAGCCAGAGGAACATGCAGCTTCTCGAGGAGTACGACCAGAACCAGAACCCCGACGCCACAAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTGCACTCTAACGCACAGCAGCTCGTTTCGACTGTGCAGGAACTTCGTCGAAACGGAACTCTCTCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCG TGAGTTCAAGATCTTCACAGACGCTGGTCGTGTCATGAGGCCGCTGTTCGTCGTGGAGAGCGACGTTCGCAAGCCGAACCGCAACCACCTCGTCTTCAGCCAGGAACACTACAACAAGCTGGTTGC AGAGCAGCAGGCGATGGCTGCCGCAGGTGTTGGCGAAGAGGAGAAGAACGAGCTCACATATGGCTGGAAGGGGCTGATCCAAGATGGTGTCATCGAGTACCTCGATGCAGAAGAAGAGGAGACT).

[0027] (4) Compare the SEQ ID NO.1 sequence on the NCBI database website and build a phylogenetic tree. Figure 2 The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 2053 of the present invention is Paraboeremia selaginellae, and the strain was deposited in the General Microbiology Center of the China Culture Collection Administration on September 23, 2024, with the deposit number CGMCC41561, and the classification name is Paraboeremia selaginellae JSAFC2053. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1st Courtyard, Chaoyang District, Beijing.

[0028] Table 1 Sequence alignment results of SEQ ID NO.1

[0029]

[0030] Example 2: Inhibitory effect of Paraboeremia selaginellae JSAFC 2053 on the growth of A. selaginella

[0031] 1. Preparation of spore suspension

[0032] (1) JSAFC 2053 was inoculated on PDA medium to prepare a culture. The culture conditions were: 25°C in the dark for 5-7 days;

[0033] (2) Use an inoculation needle to pick up the bacterial mass in the culture and place it in a Tween-80 solution (0.1%) and shake it thoroughly. After shaking, filter out the spores and adjust the concentration to prepare the copper green beetle biocontrol agent. The spore concentration of the copper green beetle biocontrol agent is 10 6 pieces / mL.

[0034] 2. Inoculation of insects

[0035] Dipping method: The copper green beetle was collected from the fields of Sizhuang Village, Houbai Town, Jurong City, and the 3rd-instar copper green beetle larvae (at this time, the larvae are in the insect stage of eating a large amount of food and causing serious damage) were placed in a concentration of 10 6 The cells were immersed in a JSAFC 2053 spore suspension containing 10 spores / mL for 30 seconds and then transferred to a culture box (height and width: 15 cm×8 cm) with a soil depth of 10 cm.

[0036] Soil mixing method: Mix 2mL of 10 6 20 g of soil containing a spore suspension of JSAFC 2053 with a concentration of spores / mL was transferred into a small culture cup, and then healthy mature larvae of the copper beetle were transferred into the culture cup (height and width: 4 cm×4.5 cm).

[0037] Three replicates, with 10 test insects per replicate, were used as a control. The insects were treated with a 0.1% Tween-80 solution and fed fresh potato strips during the experiment. All test insects were incubated in an incubator at 25°C, with an L / D ratio of 16 h / 8 h and a relative humidity of 80%. Starting on the third day after treatment, the insects were observed daily, with mortality recorded and photographs taken to document the stages of infected insects.

[0038] The insect stages of the copper green beetle that died from infection with JSAFC 2053, such as Figure 3 Table 2 shows the statistical results of A. corydalis infection mortality. As shown in Table 2, under incubation conditions at 25°C, the mortality rate of A. corydalis larvae reached 80% after 30 days of inoculation using the immersion method; the mortality rate reached 93% after 30 days of inoculation using the soil-mixing method. Although the mortality rate of A. corydalis larvae in the soil-mixing method was lower than that in the immersion method during the first 14 days, the mortality rate of the soil-mixing method gradually exceeded that of the immersion method after 14 days. No infection was observed in the control group.

[0039] Table 2 Pathogenicity of JSAFC 2053 to A. corylifolia larvae

[0040]

[0041] In summary, the JSAFC 2053 provided by the present invention is a biocontrol fungus that can be used to control A. coparisii. It has the characteristics of strong pathogenicity to A. coparisii larvae, is environmentally friendly and pollution-free, and is not prone to drug resistance. It can be widely used for the control of A. coparisii larvae before they emerge from the ground.

Claims

1. A biocontrol bacterium for A. corydalis, characterized in that: The strain number of the biocontrol bacteria of A. copper green beetle is JSAFC2053, which is deposited in the General Microbiology Center of China Culture Collection Administration Committee on September 23, 2024, with the deposit number CGMCC41561, and the microbial classification is named Paraboeremia selaginellae .

2. A biocontrol agent for Acanthurus corylifolia, characterized in that: The active ingredient of the biocontrol fungus agent for A. corydalis is the biocontrol fungus or conidia of A. corydalis according to claim 1.

3. Use of the biocontrol bacteria of Copper Green Beetle according to claim 1 and the biocontrol bacteria agent of Copper Green Beetle according to claim 2 in inhibiting the growth of Copper Green Beetle larvae.

4. The use according to claim 3, characterized in that The application is specifically to spray the spore suspension of the biocontrol bacteria of copper beetle according to claim 1 on the copper beetle larvae, or to add the spore suspension of the biocontrol bacteria of copper beetle into the soil containing the copper beetle larvae.

5. The use according to claim 4, characterized in that The preparation method of the spore suspension is: (1) Apply the biocontrol bacteria of the copper green beetle Paraboeremia selaginellae JSAFC 2053 was inoculated on PDA medium to prepare the culture; (2) The culture obtained in step (1) is placed in a Tween-80 solution, spores are filtered out, and a biocontrol agent for A. corydalis is prepared.

6. The use according to claim 5, characterized in that: The culture conditions described in step (1) are: culture at 25°C in the dark for 5-7 days.

7. The use according to claim 5, characterized in that: The spore concentration of the biocontrol agent for Copper Green Beetle in step (2) is 10 6 pieces / mL.

8. The use according to claim 5, characterized in that: The amount of the spore suspension of the A. corylifolia biocontrol bacteria added to the soil in step (2) is 1 mL / 10 g soil.

Images