Cell capable of recoding early termination codon and application thereof

Abstract

The invention belongs to the technical field of biology, and provides a cell capable of recoding an early termination codon and application of the cell, and the preservation number of the cell is CGMCC NO.46057. The cell provided by the invention can provide a new screening mode for screening drugs for treating diseases caused by nonsense mutation, and is faster and more effective.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the recoding of premature termination codons. Background Art

[0002] A premature termination codon (hereinafter referred to as "PTC") refers to a termination codon located upstream of a normal termination codon in a gene coding sequence. It is a mutation within the reading frame, which is caused by a mutation of a sense codon in messenger RNA (also called a nonsense mutation). Generally speaking, a normal termination codon terminates the translation of a gene and synthesizes a full-length protein, while the appearance of a PTC prevents protein synthesis, causing protein defects and leading to gene silencing. Protein defects (partial or complete) form lesions. For example, PTC in the gene encoding dystrophin causes nonsense mutation-mediated Duchenne muscular dystrophy in boys, PTC in the JAK1, SYNJ2 or CLPTM1 genes causes nonsense mutation-mediated prostate cancer, and PTC in the GABAA receptor subunit gene causes nonsense mutation-mediated epilepsy.

[0003] For this type of disease, there are currently small molecule therapies or preventive methods that inhibit premature translation termination. However, the process of screening these drugs is relatively complicated, and a more efficient mechanism is needed to quickly and massively screen effective molecules to provide more drugs for the treatment of diseases caused by nonsense gene mutations. Summary of the invention

[0004] The purpose of the present invention is to provide an engineered cell capable of screening molecules effective against nonsense mutations, thereby screening drugs for treating diseases caused by nonsense mutations.

[0005] The objects of the present invention are achieved in the following ways.

[0006] In a first aspect, the present invention provides a cell, which is an endogenous codon re-encoding monoclonal cell, and its deposit number is CGMCC NO.46057.

[0007] In a preferred embodiment, the cell of the present invention further expresses a marker protein for determining the complete expression of the target protein or further comprises a gene encoding a marker protein for determining the complete expression of the target protein.

[0008] In a preferred embodiment, the marker protein includes but is not limited to: HA (human albumin).

[0009] In a second aspect, the present invention provides the use of the cell for screening active molecules, wherein the active molecules can suppress nonsense mutations or recode premature stop codons, or inhibit GSPT1 (G1 to S phase transition protein 1) expression.

[0010] In a preferred embodiment, the nonsense mutation is a TAG nonsense mutation.

[0011] In a third aspect, a method for screening active molecules is provided, comprising using the cells of the present invention as screening cells, wherein the active molecules are capable of suppressing nonsense mutations or recoding premature stop codons, or inhibiting GSPT1 expression.

[0012] In a fourth aspect, provided is the use of lycorine, cephalotaxine, DP-219 or dBET57 in suppressing nonsense mutation or recoding premature stop codon, or suppressing GSPT1 expression.

[0013] In a fifth aspect, provided is the use of lycorine, cephalotaxine, DP-219 or dBET57 in the preparation of a drug for treating a disease caused by a nonsense mutation or abnormal expression of GSPT1.

[0014] In a preferred embodiment, the disease is Alzheimer's disease, cystic fibrosis, Duchenne muscular dystrophy, mucopolysaccharidosis, AML (acute myeloid leukemia) or NHL (non-Hodgkin's lymphoma).

[0015] In the present invention, the structure of DP-219 is as follows:

[0016]

[0017] The cell M6-12 of the present invention is deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration, with the address being No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number being CGMCC No.46057, the deposit date being October 18, 2024, and being classified as an endogenous codon-recoded monoclonal cell line, Homo sapiens.

[0018] The cell M6-12 of the present invention can specifically read through the premature termination codon TAG endogenously, inhibit nonsense mutations caused by TAG, and provide a new screening mode for screening drugs for treating such diseases, which is faster and more effective. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 :M6-12 cells spontaneously achieve protein read-through expression results;

[0020] Figure 2 :The results of M6-12 cell-specific read-through of TAG codons;

[0021] Figure 3 :The expression results of factors related to translation in M6-12 cell proteins;

[0022] Figure 4 : The results of dual luciferase reporter system detection of read-through efficiency of new small molecule drugs screened by M6-12 cells;

[0023] Figure 5 :The results of dual luciferase reporter system detection of read-through efficiency of dBET57 molecules at different concentrations in M6-12 cells;

[0024] Figure 6 :The results of protein electrophoresis verification of the read-through efficiency of dBET57 molecules at different concentrations in M6-12 cells;

[0025] Figure 7 :The protein electrophoresis verification results of the novel small molecule drugs screened in M6-12 cells to read through the AQP4X gene;

[0026] Figure 8 : The results of the small molecule DP-219 molecule screened by M6-12 cells inhibited the expression of GSPT1 at the MOLM-13 cell level;

[0027] Fig. 9 : The results of DP-219's inhibitory effect on AML and NHL cells;

[0028] Fig.10 :The results of the inhibitory effect of dBET57 on AML and NHL cells. DETAILED DESCRIPTION

[0029] The present invention will be described in detail below with reference to the accompanying drawings, but the present invention is not limited thereto.

[0030] In the following examples, unless otherwise specified, the reagents and instruments used are conventional reagents and instruments in the art and can be obtained commercially; the experimental methods described are commonly used experimental methods in the art, and those skilled in the art can confirm without any objection that the experimental steps can be completed and the expected effects can be obtained based on the description of the examples.

[0031] Example 1: Plasmid construction

[0032] 1) Construction of plasmid PCDH-BSD-M6

[0033] In this example, the 120th codon of the puromycin resistance gene (PuroR) on the plasmid pCDH-CMV-MCS-EF1-Puro (V006738, NovoPro) was mutated to TAG by overlapping PCR point mutation. The specific process is as follows: two fragments of the PuroR open reading frame (ORF) were amplified using specific primers designed to introduce the E120X mutation. The upper half of the ORF was amplified using the primer pair Puro-F (5'-TTTGTCTAGAGCCACCATGACCGAGTACAAGCCCAC-3', SEQ ID NO: 1) and M6-1R (5'-CGCGGGCTaCTTGGGCC-3', the pre-designed 358G>T is represented by lowercase letters, SEQ ID NO: 2); the upper half of the ORF was amplified using the primer pair M6-2F (5'-GGCCCAAG TAG The lower half of the PuroR ORF fragment was amplified by primers Puro-F and Puro-R (5'-aaaaCTCGAGttaAGCGTAGTCTGGGACGTCGTATGGGTAGCCCTCCCACACATAAC-3', SEQ ID NO: 4) with HA tag protein primers. Subsequently, the two fragments were gel purified and combined as templates for the second round of PCR amplification. A second round of PCR was performed using primers Puro-F and Puro-R to obtain the full-length mPuroR gene containing the amber mutation E120X. The obtained amplicon was then double-digested with XbaⅠ and XhoⅠ and subcloned into the XbaⅠ / XhoⅠ site of the mammalian expression vector pCDH-CMV-MCS-EF1-Blast vector (V013292, NovoPro) to obtain the constructed plasmid PCDH-BSD-M6. After sequencing, the plasmid carried a puromycin resistance gene with an amber mutation (358G>T), and the gene was followed by an HA tag protein, which was in line with the expected design.

[0034] 2) Construction of dual luciferase reporter assay plasmid pIERS-GFluc

[0035] This plasmid contains Gaussia princeps luciferase with an amber mutation (Gluc) and an internal control wild-type firefly luciferase (Fluc). The Fluc-Myc fragment was amplified using the primer pair Fluc-F (5'-GATCTCTAGAATGGAAGATGCCAAAAAC-3', SEQ ID NO: 5) and Fluc-R (5'-TGAAGCGGCCGCTTACAGATCCTCTTCAGAGATGAGTTTCTGCTCCACGGCGATCTTG CCGCC-3', SEQ ID NO: 6) using the pGL4.10 plasmid (Promega, USA) as a template. The amplicon was then purified and ligated into the XbaⅠ / NotⅠ sites of the pIRES vector (Clontech, USA) to obtain the intermediate plasmid pIRES-Fluc. The overlapping PCR method was used to construct a Gluc gene fragment with a successful amber mutation at codon 160. The specific process was as follows: specific primers designed to introduce the codon mutation of the 160th amino acid position to TAG were used to amplify two fragments of the Gluc open reading frame (ORF), and primers Gluc-F (5'-TACACTCGAGCCACCATGGGAGTCAAAGTTCTG-3', SEQ ID NO: 7) and Gluc-1R (5'-GCGGCAGCtACTTCTTG-3', SEQ ID NO: 8) were used to amplify the upper half of the Gluc gene ORF (open reading frame), and primers Gluc-2F (5'-CAAGAAGTaGCTGCCGC-3', pre-designed 479G>A is represented by lowercase letters, SEQ ID NO: 9) and Gluc-R (5'-CTCGACGCGTTTAATGGTGATGGTGATGGTCACCACCGGCCCCCTT-3', SEQ ID NO: 10) were used to amplify the lower half of the gene. Subsequently, the two fragments were gel purified and combined as templates for the second round of PCR amplification. The products were amplified in the second round using primers Gluc-F and Gluc-R, and the obtained amplicon was inserted into the XhoⅠ / MluⅠ site of the intermediate plasmid pIRES-Fluc. The resulting plasmid was named pIRES-GFluc for quantitative read-through efficiency. After sequencing, the plasmid met the expected design.

[0036] 3) PCDNA3.1-GFP 39TAG / GFP 39TGA / GFP 39TAA Plasmid construction

[0037] Based on the plasmid of PCDNA3.1-GFP (addgene, #51406), a point mutagenesis kit (TIANGEN, KM101) and specific primers GFP were used. 39TAG -F(5'-GATGCCACCTAGGGCAAGC-3',SEQ ID NO:11),GFP 39TAG -R(5'-GCTTGCCCTAGGTGGCATC-3',SEQ ID NO:12),GFP 39TGA -F(5'-GATGCCACCTGAGGCAAGC-3',SEQ ID NO:13),GFP 39TGA -R (5'-GCTTGCCTCAGGTGGCATC-3',SEQ ID NO:14),GFP 39TAA -F(5'-GATGCCACCTAAGGCAAGC-3',SEQ ID NO:15),GFP 39TAA -R (5'-GATGCCACTTAAGGCAAGC-3', SEQ ID NO: 16) to construct GFP 39TAG , GFP 39TGA , GFP 39TAA Point mutation to obtain PCDNA3.1-GFP 39TAG / GFP 39TGA / GFP 39TAA The plasmid was successfully constructed by sequencing.

[0038] 4) In order to verify whether the small molecule read-through drugs obtained by screening can be used to treat nonsense mutation diseases, according to the gene sequence of the water channel protein AQP4X and its C-terminal extension variant obtained by searching NCBI (Gene ID: 361), we commissioned Qingke Biotechnology Co., Ltd. to fully synthesize the gene AQP4X-6HIS tag using a nucleic acid synthesizer, and connected it to PCDNA3.1 to construct the plasmid PCDNA3.1-AQP4X-6HIS tag for subsequent disease treatment effect verification.

[0039] Example 2: Stable transfection of exogenous plasmids with lentiviral vectors and single clone screening

[0040] 1) Packaging and preparation of lentiviral particles. The successfully constructed PCDH-BSD-M6 and lentiviral packaging system plasmids psPAX2 and pMD2.G were transfected into 293T cells (ATCC) using Lipofectamine 2000 transfection reagent (Invitrogen, catalog number: 11668019) at a ratio of 1.8 μg: 1.35 μg: 0.9 μg plasmid transfection amount / six-well plate. Three days later, the supernatant was collected and concentrated and purified to obtain a virus solution, which was aliquoted and frozen in a -80°C refrigerator.

[0041] 2) Hela cells (CL-0101, Punosai) were infected with the lentivirus obtained in step 1) at an MOI of 1 and 5 for 24 hours. After infection, the cells were cultured in a selective medium containing 2μg / ml blasticidin and 1μg / ml puromycin (the medium formula is DMEM+10% FBS+1% PS, the DMEM medium and FBS serum brands are gibco, the item numbers are C11995500BT and 2064652 respectively, and PS is a penicillin-streptomycin double antibody mixture, the brand is gibco, and the item number is 15140-122) for 7 days. Dissociate and select drug-resistant cells, pick them into 96-well plates, and ensure that only one cell is placed in each well under microscopic examination. Single cell culture until individual clones are established, transfect plasmid pIERS-GFluc, and screen single cell clones that show the strongest Gluc luminescence activity. The selected single clones are then amplified to obtain the cell line M6-12. The cell line was identified and preserved.

[0042] The cell M6-12 is classified as an endogenous codon-recoded monoclonal cell line and is deposited in the General Microbiology Center of the China Culture Collection Administration, located at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No. 46057 and the deposit time is October 18, 2024.

[0043] Example 3: SDS-PAGE protein electrophoresis method verifies that the M6-12 cell line can spontaneously read through puro 120TAG -HA

[0044] According to the steps of SDS-PAGE protein electrophoresis, HeLa cells and M6-12 cells were cultured, and cells were collected, total cell protein was extracted and quantified. 20 μg of each was loaded for electrophoresis, followed by overnight incubation with primary antibody HA (Proteintech, Catalog No.: 66006-1-Ig) and one hour incubation with secondary antibody (Bio-Rad, Catalog No.: 1706516). The membrane was washed three times with TBST and exposed to chemiluminescent solution. The expression level of HA was used to determine whether M6-12 could achieve endogenous read-through. The HA tag protein is located at puro120 on the plasmid. TAGAfter the gene, only puro120 TAG The HA-tagged protein can only be expressed after the gene is fully translated, so detecting the expression of the tagged protein can verify puro120 TAG Whether the premature stop codon is read through.

[0045] The results are as follows Figure 1 As shown, compared with ordinary HeLa cells, the M6-12 cell line itself can undergo endogenous read-through, that is, the HA tag protein after the PTC site can be spontaneously expressed.

[0046] Example 4: SDS-PAGE protein electrophoresis method verifies that the M6-12 cell line can specifically achieve endogenous read-through of TAG

[0047] Add 1 mL of 0.25% Trypsin-EDTA digestion solution to M6-12 and HeLa cells, digest them into single cells and resuspend them, then count the cells using a cell counter. The cell density of the six-well plate is 3 × 10 cells per well. 5 After the cells are plated and mixed, they are transferred to a 37°C incubator and cultured overnight. When the number of cells grows to about 70%, 1.5 μg of the following corresponding plasmids are added to the wells for transfection: PCDNA3.1-GFP 39TAG or PCDNA3.1-GFP 39TGA or PCDNA3.1-GFP 39TAA Plasmid. After 48 hours, cells from each well were collected. HeLa cells and M6-12 cells were collected, total cell protein was extracted and quantified, and 20 μg was taken for electrophoresis, followed by overnight incubation with primary antibody GFP (Proteintech, Catalog No.: PABG1) and one hour incubation with secondary antibody (Bio-Rad, Catalog No.: 1706516), washing the membrane three times with TBST, and exposing to chemiluminescent solution. The results of protein electrophoresis were used to compare the read-through of three different premature termination codons of TAG / TGA / TAA in M6-12 and HeLa cells.

[0048] The results are as follows Figure 2 As shown: Compared with ordinary HeLa cells, the M6-12 cell line itself can specifically read through the premature stop codon TAG, but not the other two premature stop codons.

[0049] Example 5: SDS-PAGE protein electrophoresis method verifies that there is no significant change in the expression of protein translation-related factors in the M6-12 cell line

[0050] Add 1 mL of 0.25% Trypsin-EDTA digestion solution to M6-12 and HeLa cells, digest them into single cells and resuspend them, then count the cells using a cell counter. The cell density of the six-well plate is 3 × 10 cells per well. 5 After the cells are plated and mixed, they are transferred to a 37°C incubator and cultured overnight. When the number of cells grows to about 70%, 1.5 μg of the corresponding plasmids are added to the wells for transfection of PCDNA3.1-GFP. 39TAG or PCDNA3.1-GFP 39TGA or PCDNA3.1-GFP 39TAA Plasmid. After 48 hours, cells from each well were collected. HeLa cells and M6-12 cells were collected, proteins were extracted and quantified, and 20 μg was taken for electrophoresis, followed by overnight incubation with primary antibodies eRF1 (Proteintech, Catalog No.: 10884-1-AP), GSPT1 (Proteintech, Catalog No.: 10763-1-AP), and UPF1 (Proteintech, Catalog No.: 23379-1-AP) and one hour with secondary antibodies (Bio-Rad, Catalog No.: 1706515, 1706516), respectively. The membranes were washed three times with TBST and exposed to chemiluminescent solution. The protein electrophoresis results were used to compare the changes in the expression of protein translation-related factors in M6-12 and HeLa cells.

[0051] The results are as follows Figure 3 As shown, compared with ordinary HeLa cells, there was no significant difference in the expression levels of major translation-related protein factors in M6-12 cells, laying the foundation for the establishment of the subsequent small molecule read-through drug screening platform (eRF1, GSPT1 protein inhibitors).

[0052] Example 6: Screening of small molecule read-through drugs using M6-12 cells

[0053] Add 1 mL of 0.25% Trypsin-EDTA digestion solution to M6-12 cells, digest them into single cells and resuspend them, then count the cells using a cell counter. The cell density of the six-well plate is 3 × 10 cells per well. 5Cells were plated and mixed, then transferred to a 37°C incubator and cultured overnight. When the number of cells grew to about 70%, 1.5 μg of the dual luciferase reporter detection system plasmid pIERS-GFluc was added to the well for transfection. After 6 hours, specific concentrations of small molecule drugs lycorine (source leaf, item number 476-28-8) 20 μM, cephalotaxine (HHT, source leaf, item number 24316-19-6) 160 nM, DP-219 (structure shown below) 5 nM and dBET57 (InvivoChem, item number: V19243) 25 μM were added to the corresponding wells and placed in a cell culture incubator. After incubation for 48 hours, the cells in each well were collected, and the Fluc and Gluc of the cells in each well were detected according to the specific steps of the dual luciferase reporter system detection kit (E1910, Promega), and the Gluc / Fluc ratio was calculated. A ratio greater than 1 indicates that the small molecule has read-through activity, and a larger ratio indicates a stronger read-through ability of the small molecule.

[0054]

[0055] The results are as follows Figure 4 As shown in the figure, the Gluc / Fluc ratios of the four novel small molecules are all greater than 1, indicating that the four small molecules all have read-through activity and are novel read-through small molecule drugs. Among them, the Gluc / Fluc ratio of dBET57 molecule is the largest, much higher than the other three small molecules.

[0056] Example 7: Dual luciferase reporter assay system verifies that M6-12 cells have the ability to efficiently screen read-through small molecule drugs

[0057] Add 1 mL of 0.25% Trypsin-EDTA digestion solution to M6-12 cells and HeLa cells respectively, digest them into single cells and resuspend them, and then use a cell counter to count the number of cells. The cell plating density of the six-well plate is 3×10 per well. 5 Cells. After the cells were plated and mixed, they were transferred to a 37°C incubator and cultured overnight. When the number of cells grew to about 70%, the above-mentioned successfully constructed dual luciferase reporter detection system plasmid pIERS-GFluc plasmid was transfected in the wells respectively. The solution was changed every 6 hours and different concentrations of dBET57 molecules (InvivoChem, catalog number: V19243) were added. The specific concentrations were 0μM, 1μM, 5μM, and 25μM. After 48 hours, the cells in each well were collected, and the Fluc and Gluc of each well were detected according to the specific steps of the dual luciferase reporter system detection kit (E1910, Promega), and the ratio of Gluc / Fluc was calculated. A ratio greater than 1 indicates that it has read-through activity, and the larger the ratio, the stronger the read-through ability of the small molecule.

[0058] The results are as follows Figure 5 As shown, the Gluc / Fluc ratios of different concentrations of dBET57 molecules in M6-12 cells are greater than those of the corresponding Hela cell groups, and the Gluc / Fluc ratios of low concentrations of 1μM and 5μM dBET57 molecules are also much higher than those of the Hela cell group, with significant read-through signals, which indicates that M6-12 cells have a more efficient ability to screen read-through small molecule drugs than Hela cells.

[0059] Example 8: SDS-PAGE protein electrophoresis method verifies that the M6-12 cell line has the ability to efficiently screen small molecule drugs

[0060] Add 1 mL of 0.25% Trypsin-EDTA digestion solution to M6-12 cells and HeLa cells, digest them into single cells and resuspend them, then count the cells using a cell counter. The cell density of the six-well plate is 3 × 10 cells per well. 5 After the cells were plated and mixed, they were transferred to a 37°C incubator and cultured overnight. When the number of cells grew to about 70%, the above-mentioned successfully constructed dual luciferase reporter detection system plasmid pIERS-GFluc plasmid was transfected in the wells respectively. After 6 hours, the solution was changed and different concentrations of dBET57 molecules (InvivoChem, catalog number: V19243) were added. The specific concentrations were 0μM, 1μM, 5μM, and 25μM. After 48 hours, the cells in each well were collected and the expression of gluc and protein translation-related factors was detected by SDS-PAGE protein electrophoresis. The results were used to determine whether M6-12 has the ability to efficiently screen read-through small molecule drugs compared with other Hela cells.

[0061] The results are as follows Figure 6 As shown in the figure. After the anti-tumor drug dBET57 molecule acts, the GSPT1 protein in M6-12 cells is significantly degraded, just like ordinary Hela cells; however, M6-12 cells show significant Gluc signals, and as the concentration of dBET57 molecules increases, the Gluc fluorescence signal also increases, indicating that dBET57 molecules can be used as a new type of safe small molecule read-through drug. This experiment also further verifies that M6-12 cells have a stronger ability to screen small molecule read-through drugs.

[0062] Example 9: SDS-PAGE protein electrophoresis method verifies that the new read-through drug screened can read through the Alzheimer's disease target AQP4X protein

[0063] Add 1 mL of 0.25% Trypsin-EDTA digestion solution to 293T cells (ATCC), digest them into single cells and resuspend them, then count the cells using a cell counter. The cell density in a six-well plate is 3 × 10 cells per well. 5 After the cells were plated and mixed, they were transferred to a 37°C incubator and cultured overnight. When the number of cells grew to about 70%, the AQP4X-HIS plasmid was transfected in each well. After 6 hours, the medium was changed and different concentrations of the screened read-through small molecules (lycorine 20 μM, cephalotaxine 160 nM, DP-219 5 nM and dBET57 25 μM) were added. After 48 hours, the expression of AQP4X protein was detected. The results were used to determine whether the read-through small molecule drugs screened by M6-12 had the potential to treat Alzheimer's disease.

[0064] The results are as follows Figure 7 As shown, the four anti-tumor small molecules, lycorine, cephalosporin (HHT), DP-219, and dBET57, all have the ability to partially read-through and restore the expression of the target AQP4X gene for the treatment of Alzheimer's disease, and the dBET57 molecule has the strongest read-through ability with a read-through efficiency of approximately 20%. It is a new type of highly effective potential read-through drug with the potential to treat Alzheimer's disease. Figure 7 In the figure, WT represents the wild-type full-length AQP4X protein, which was obtained by in vitro transfection of 293T cells and served as the positive control of this experiment.

[0065] Example 10: SDS-PAGE protein electrophoresis verifies that the DP-219 molecule screened by M6-12 cells can inhibit the expression of GSPT1 molecules in MOLM-13 cells

[0066] The number of human acute myeloid leukemia MOLM-13 cells (Punosai, catalog number: CL-0681) was counted using a cell counter. The cell density of the six-well plate was 3×10 per well. 5 cells. After the cells were plated and mixed, they were transferred to a 37°C incubator and cultured overnight. When the number of cells grew to about 70%, the drug was added. 0nM, 0.01nM, 0.1nM, 1nM, 10nM, and 100nM DP-219 molecules were added to the cells, and two groups were set up for incubation for four hours and twenty-four hours. After the experiment, the cells were collected, and the total cell protein was extracted and quantified, and the expression of GSPT1 protein was detected by SDS-PAGE protein electrophoresis.

[0067] The results are as follows Figure 8As shown, after incubation of MOLM-13 cells with 1nM, 10nM, and 100nM DP-219 molecules for 4 hours and 24 hours, GSPT1 molecules were significantly degraded. This result shows that the small molecules screened by M6-12 cells of the present invention, such as DP-219, have the potential to inhibit GSPT1 expression, and further, have the potential to treat diseases related to GSPT1 expression.

[0068] Example 11: Inhibitory effects of screened small molecules on AML and NHL cells

[0069] Culture MOLM-13 (Punocyt, catalog number: CL-0681), THP-1 (Punocyt, catalog number: CL-0233), NB4 (Punocyt, catalog number: CL-0676), HL-60 (Punocyt, catalog number: CL-0110), U-937 (Punocyt, catalog number: CL-0239), OCI-AML3 (Punocyt, catalog number: CL-0837), SU-DHL-1 (Punocyt, catalog number: CL-0837), Karpas299 (Punocyt, catalog number: CL-0807), Raji (Punocyt, catalog number: CL-0189), Daudi (Punocyt, catalog number: CL-0072) cells and adjust the concentration to 1×10 6 / ml for later use; SU-DHL-1, Karpas299, Raji cells and Daudi cells belong to NHL cell lines, and other cells belong to AML cell lines; dBET57 and DP-219 are prepared with DMSO to 10mM for later use.

[0070] Drug preparation: For each drug, 8 different concentration gradients (200 nM, 50.0 nM, 12.5 nM, 3.13 nM, 0.781 nM, 0.195 nM, 0.0488 nM, 0.0122 nM) need to be set, 1 drug-free control and 1 background without cells and drugs.

[0071] Cell culture: cell density is 1-2*10 6 / ml is optimal, and then the cell density is diluted to 2*10 with complete culture medium (RPMI 1640 (Gibco) + 10% FBS (Gibco) + 1% streptomycin-penicillin mixture (Solarbio, P1400)). 5 / ml (finally 10,000 cells per well). Mix the cells and quickly spread 50 μl of the diluted cells into a 96-well plate per well. Add the drugs diluted according to the concentration gradient to the corresponding wells, and gently blow 5-10 times with a spray gun to mix the drugs and cells. Mark and place in a 37°C incubator for 3 days.

[0072] Cell viability detection: CCK8 was added to detect cell viability on the third day after drug addition: 10 μl of CCK8 detection reagent (Lablead, CK001) was added to 100 μl of culture medium in each well (note that CCK8 should also be added to the control group without drug addition and background wells). The cells were placed in 37°C for further culture, and cell viability was detected with an ELISA instrument (emission wavelength was 450 nm) after 1-2 hours, and the data were exported.

[0073] The results are as follows Fig. 9 and Fig.10 As shown, DP-219 and dBET57 have significant anti-cell proliferation effects in different cell lines of AML and NHL, indicating that these molecules have potential for the treatment of AML and NHL.

Claims

1. A cell, which is an endogenous codon re-encoded monoclonal cell, and its deposit number is CGMCCNO.46057.

2. The cell according to claim 1, wherein The cell further expresses a marker protein for determining the complete expression of the target protein or further comprises a gene encoding a marker protein for determining the complete expression of the target protein.

3. The cell according to claim 2, wherein The marker protein includes but is not limited to: human serum albumin.

4. Use of the cell according to any one of claims 1 to 3 for screening active molecules, wherein: The active molecule can suppress nonsense mutation or recode premature stop codon, or inhibit GSPT1 expression.

5. The use according to claim 4, wherein: The nonsense mutation is a TAG-type nonsense mutation.

6. A method for screening active molecules, comprising using the cell according to any one of claims 1 to 3 as a screening cell, wherein: The active molecule can suppress nonsense mutation or recode premature stop codon, or inhibit GSPT1 expression.

7. The method according to claim 6, wherein: The nonsense mutation is a TAG-type nonsense mutation.

8. Use of lycorine, cephalotaxine, DP-219 or dBET57 in suppressing nonsense mutation or recoding premature stop codon, or inhibiting GSPT1 expression.

9. Use of lycorine, cephalotaxine, DP-219 or dBET57 in the preparation of a drug for treating a disease caused by nonsense mutation or abnormal expression of GSPT1.

10. The use according to claim 9, wherein: The disease is Alzheimer's disease, cystic fibrosis, Duchenne muscular dystrophy, mucopolysaccharidosis, acute myeloid leukemia or non-Hodgkin's lymphoma.

Images