Rice protein osfbx388 related to plant disease resistance and its coding gene and application

By reducing the expression or activity of the rice OsFBX388 protein through gene editing technology, and utilizing the OsFBX388 protein to regulate plant disease resistance, the problem of the unclear mechanism of action of F-box protein in plant immune pathways has been solved, thus improving disease resistance.

CN119799719BActive Publication Date: 2026-05-15CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2023-10-09
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

There is limited research on the role of F-box proteins in plant immune pathways in current technologies, and there is an urgent need to clarify their molecular functions through genetic and biochemical methods in order to improve plant disease resistance.

Method used

We provide rice protein OsFBX388 and its encoding gene, and use gene editing technologies such as CRISPR/Cas9 system to reduce or inhibit the expression or activity of OsFBX388 protein. We can then use OsFBX388 protein or related biological materials to regulate plant disease resistance and combine it with specific promoters and expression vectors for genetic engineering breeding.

Benefits of technology

It improved the plant's resistance to rice blast and bacterial blight, manifested by reduced lesion length and enhanced expression of defense genes, thus enhancing the plant's disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004483626430000011
    Figure HDA0004483626430000011
  • Figure HDA0004483626430000012
    Figure HDA0004483626430000012
  • Figure HDA0004483626430000013
    Figure HDA0004483626430000013
Patent Text Reader

Abstract

The present application discloses a rice protein OsFBX388 related to plant disease resistance, and an encoding gene and application thereof. The present application provides application of the OsFBX388 protein or biological material related thereto in regulating plant disease resistance, and also provides application of a substance for reducing content or activity of the OsFBX388 protein, or a substance for reducing or inhibiting expression of an encoding nucleic acid molecule of the OsFBX388 protein in any one of the following: 1) improving plant disease resistance; 2) cultivating plants with improved disease resistance; and 3) plant breeding. The present application proves that down-regulation of expression of the OsFBX388 gene can spontaneously generate a disease-like spot in rice, and enhance the resistance of the rice to rice blast and bacterial leaf blight, which implies that the OsFBX388 gene has good application potential and application value in improving crop disease resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically involving rice protein OsFBX388 and its encoding gene related to plant disease resistance and its applications. Background Technology

[0002] The ubiquitin / 26S proteasome pathway regulates eukaryotic cellular processes through post-translational protein modification, including plant growth and development (Hu et al. 2014, Vierstra 2009) and the influence of biotic and abiotic factors (Kurepa et al. 2009, Zeng et al. 2004). Ubiquitin / 26S proteasome protein degradation involves three processes: target protein recognition by ubiquitin molecules, modification, and degradation. The modification of target proteins by the ubiquitin / 26S proteasome is catalyzed by a cascade reaction mediated by three enzymes: ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin-ligating enzyme (E3). E3 ubiquitin ligase is primarily responsible for the specific recognition of target proteins, followed by ubiquitination. Based on their constituent subunits, E3 ubiquitin ligases can be classified into various types, with the SCF (SKP1-Cullin1-F-box) complex being one such type. It is composed of SKP1, Cullin1, and F-box proteins (Sadanandom et al. 2012). The F-box protein typically possesses a conserved F-box motif, a highly conserved motif usually composed of a leucine-proline dipeptide and other hydrophobic amino acids such as valine, isoleucine, and methionine. This motif consists of approximately 40-60 amino acid residues (Abd-Hamid et al. 2020). The F-box protein structure comprises 3-4 α-helical structures. The N-terminus of the F-box protein domain binds to SKP1, while the C-terminus specifically binds to the target substrate. The diversity of F-box proteins determines the diversity of the SCF complex, which in turn determines the diversity of E3 ubiquitin ligases. Existing reports indicate that F-box proteins are involved in various aspects of plant growth and development, including seed germination (Majee et al. 2018), root development (Manzano et al. 2012), leaf development (Cui et al. 2016), flowering (Gonzalez-Carranza et al. 2017), pollen recognition (Matsumoto and Tao 2019), light signaling, and photoperiod (Song et al. 2014).F-box proteins also participate in regulating plant hormone synthesis and responses to external biotic and abiotic stresses, including the phenylpropane biosynthesis pathway (Yu et al. 2019), abiotic stress (Kepinski and Leyser 2005; Yan et al. 2011; Xu et al. 2014; Li et al. 2016), and biotic stress (Devoto et al. 2002; Cao et al. 2008; Gou et al. 2009; Gou et al. 2012). Although many F-box proteins have been discovered in plants and exhibit diverse functions, research on their involvement in plant immune pathways via the ubiquitin / 26S proteasome pathway is relatively limited. There is an urgent need to analyze F-box genes using genetic and biochemical methods to clarify their molecular functions and determine how they participate in plant defense response pathways, providing a basis for elucidating the mechanisms by which F-box genes play a role in plant disease resistance. Summary of the Invention

[0003] To address the aforementioned technical problems, the purpose of this invention is to provide rice protein OsFBX388 related to plant disease resistance, its encoding gene, and its applications.

[0004] In a first aspect, the present invention provides the application of OsFBX388 protein or related biological materials in regulating plant disease resistance;

[0005] The OsFBX388 protein is any one of the proteins shown in A1)-A4) below:

[0006] A1) A protein consisting of the amino acid sequence shown in Sequence 2 of the sequence listing;

[0007] A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 2 of the sequence listing;

[0008] A3) Proteins whose amino acid sequence shown in Sequence 2 of the sequence listing has been modified by substitution and / or deletion and / or addition of one or more amino acid residues and are associated with plant disease resistance;

[0009] Proteins that have 99%, 95%, 90%, 85%, or 80% homology to any of the amino acid sequences defined in A4 and A1-A3) and are associated with plant disease resistance;

[0010] Sequence 2 consists of 679 amino acid residues.

[0011] To facilitate the purification of the protein in a), a tag as shown in Table 1 can be attached to the amino or carboxyl terminus of the protein shown in Sequence 2 of the sequence listing.

[0012] Table 1 shows the sequence of labels.

[0013] Label residues sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0014] The protein OsFBX388 in c) above, wherein the substitution and / or deletion and / or addition of one or more amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0015] The protein OsFBX388 in c) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0016] The gene encoding the protein OsFBX388 in c) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in Sequence 1, and / or by performing a missense mutation on one or more base pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0017] The biomaterial associated with the OsFBX388 protein is any one of the following B1) to B8):

[0018] B1) The nucleic acid molecule encoding the OsFBX388 protein;

[0019] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0020] B3) A recombinant vector containing the nucleic acid molecules described in B1);

[0021] B4) A recombinant vector containing the expression cassette described in B2);

[0022] B5) Recombinant microorganisms containing the nucleic acid molecules described in B1);

[0023] B6) Recombinant microorganisms containing the expression cassette described in B2);

[0024] B7) Recombinant microorganisms containing the recombinant vector described in B3);

[0025] B8) Recombinant microorganisms containing the recombinant vector described in B4).

[0026] In the above text, the nucleic acid molecule described in B1) is a gene as shown in 1), 2), 3), or 4) below:

[0027] 1) Its coding sequence is the DNA molecule shown in Sequence 1;

[0028] 2) DNA molecules derived from rice that have more than 98% homology with the DNA sequence defined in 1) and encode plant disease resistance-related proteins;

[0029] 3) DNA molecules that hybridize with the DNA sequence defined in 1) or 2) under strict conditions and encode plant disease resistance-related proteins;

[0030] 4) DNA molecules that have more than 90% homology with the DNA sequence defined in 1) or 2) and encode plant disease resistance-related proteins.

[0031] In the above applications, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA. Sequence 1 consists of 2040 nucleotides, and the entire sequence 1 is the coding sequence (ORF) of the OsFBX388 gene, encoding the protein shown in Sequence 2 of the sequence listing.

[0032] Those skilled in the art can readily mutate the nucleotide sequence encoding OsFBX388 of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity with the nucleotide sequence of OsFBX388 isolated in this invention, as long as they encode OsFBX388 and have the same function, are derived from and are equivalent to the nucleotide sequence of this invention.

[0033] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein composed of the amino acid sequence shown in Sequence 2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0034] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0035] In the above application, the expression cassette (OsFBX388 gene expression cassette) containing a nucleic acid molecule encoding OsFBX388 described in B2) refers to DNA capable of expressing OsFBX388 in host cells. This DNA may include not only promoters that initiate OsFBX388 transcription but also terminators that terminate OsFBX388 transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator.

[0036] The plant recombinant expression vector can be constructed using existing plant expression vectors. These vectors include binary Agrobacterium vectors and vectors suitable for microbombardment, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pCAMBIA1301, pBI121, pBin19, pCAMBIA2301, pCG1301, or other derived plant expression vectors. The plant expression vector may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylated nucleotide signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated nucleotide signal can guide the addition of polyadenylated nucleotides to the 3' end of the mRNA precursor. When constructing a recombinant expression vector using the gene described above, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CaMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress-inducible promoter Rd29A, etc., which can be used alone or in combination with other plant promoters. Furthermore, when constructing a recombinant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG initiation or adjacent start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons are widely available and can be natural or synthetically produced. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selection marker genes, plants can be directly selected and transformed using stress screening.

[0037] In the above applications, the vector can be a plasmid, granule, bacteriophage, or viral vector. In this invention, the recombinant vector is specifically the pCas9-OsFBX388 vector obtained by inserting the OsFBX388 gene fragment into the pCas9 vector.

[0038] In the above applications, the microorganisms can be yeast, bacteria, algae, or fungi, such as Agrobacterium. In this invention, the Agrobacterium used is specifically EHA105.

[0039] In a second aspect, the present invention provides substances that reduce the content or activity of the OsFBX388 protein described in the first aspect, or substances that reduce or inhibit the expression of nucleic acid molecules encoding the OsFBX388 protein described in the first aspect, in any of the following applications:

[0040] 1) Improve plant disease resistance;

[0041] 2) Cultivate plants with enhanced disease resistance;

[0042] 3) Plant breeding.

[0043] The purpose of the breeding is to cultivate disease-resistant plant varieties.

[0044] In the foregoing, the substance that reduces or inhibits the expression of the nucleic acid molecule encoding the OsFBX388 protein in the first aspect is a substance that causes deletion mutations, insertion mutations, or base substitutions in the OsFBX388 protein encoding gene, or a CRISPR / Cas9 system that inhibits the translation of the nucleic acid encoded by the OsFBX388 protein.

[0045] Furthermore, the CRISPR / Cas9 system includes an sgRNA targeting OsFBX388 and a cas9 enzyme. In an embodiment of the present invention, the CRISPR / Cas9 system is a plasmid pCas9-OsFBX388 containing an sgRNA targeting OsFBX388 and a cas9 enzyme encoding gene.

[0046] The regulation of plant disease resistance described above is reflected in the following ways: when the content and / or activity of OsFBX388 protein in a plant increases or the expression level of the OsFBX388 gene increases, the plant's disease resistance decreases; when the content and / or activity of OsFBX388 protein in a plant decreases or the expression level of the OsFBX388 gene decreases, the plant's disease resistance increases.

[0047] The improvement in disease resistance of a plant when the content and / or activity of OsFBX388 protein or the expression level of the OsFBX388 gene decreases is specifically reflected in any one of the following m1)-m4):

[0048] m1) This plant spontaneously produces lesion-like spots;

[0049] m2) Reactive oxygen species and cell necrosis can be detected in the lesion-like areas of this plant;

[0050] After inoculation with the pathogen, the length of the lesions on the plant decreased; the pathogen was rice blast fungus (such as rice blast fungus race P007) or bacterial blight fungus (such as rice bacterial blight strain PXO99).

[0051] m4) The expression levels of defense-related genes in this plant are increased; the defense-related genes are specifically genes PR1 and / or PR2 and / or PR3 and / or PR4 and / or PR5 and / or PR8 and / or PR10 and / or WRKY45.

[0052] Thirdly, the present invention provides a method for cultivating transgenic plants with enhanced disease resistance, comprising the following steps: reducing the content and / or activity of the OsFBX388 protein described in the first aspect in a recipient plant to obtain a transgenic plant; wherein the transgenic plant exhibits higher disease resistance than the recipient plant.

[0053] Fourthly, the present invention provides a method for cultivating transgenic plants with enhanced disease resistance, comprising the following steps: reducing or inhibiting the expression of the nucleic acid molecule encoding the OsFBX388 protein described in the first aspect in a recipient plant to obtain a transgenic plant; wherein the transgenic plant exhibits higher disease resistance than the recipient plant.

[0054] In the above text, reducing or inhibiting the expression of the OsFBX388 protein-coding gene in the recipient plant means reducing the expression level of the OsFBX388 protein-coding gene in the recipient plant or causing deletion mutations, insertion mutations, or base substitutions in the OsFBX388 protein-coding gene in the recipient plant.

[0055] The method for inducing deletion, insertion, or base substitution mutations in the OsFBX388 protein-coding gene in the recipient plant involves inserting T-DNA into the recipient plant genome. In a specific embodiment of the present invention, the T-DNA insertion site is located 1509 bp upstream of the OsFBX388 gene start codon ATG.

[0056] Fifthly, the present invention provides a method for cultivating transgenic plants with enhanced disease resistance, comprising the following steps: gene editing of the nucleic acid encoding the OsFBX388 protein described in the first aspect in the recipient plant, thereby stopping the translation of the OsFBX388 protein encoding gene, to obtain a gene-edited plant; the disease resistance of the gene-edited plant is higher than that of the recipient plant.

[0057] In the method described above, the gene editing is performed using the CRISPR / Cas9 system, where the target site of the sgRNA is positions 39-58 of sequence 1.

[0058] In an embodiment of the present invention, the gene editing of the OsFBX388 protein-coding gene in the recipient plant is achieved by introducing a plasmid expressing the sgRNA into the recipient plant.

[0059] In the above-mentioned aspects, the disease resistance refers to resistance to rice blast and / or resistance to rice bacterial blight.

[0060] In the above method, the disease resistance refers to resistance to rice blast and / or resistance to rice bacterial blight.

[0061] The disease resistance of the transgenic plant is higher than that of the recipient plant, as demonstrated by any one of the following n1)-n4):

[0062] n1) The recipient plant does not produce lesion-like spots, while the transgenic plant can spontaneously produce lesion-like spots;

[0063] n2) The recipient plant does not produce lesion-like spots, while the transgenic plant can spontaneously produce lesion-like spots and reactive oxygen species can be detected at the sites where lesion-like spots are produced;

[0064] n3) After inoculation with the pathogen, the length of the lesions in the transgenic plant is smaller than that in the recipient plant;

[0065] n4) The expression levels of defense-related genes in the transgenic plant are higher than those in the recipient plant.

[0066] Furthermore, the pathogen is rice blast fungus (such as rice blast fungus race P007) or bacterial blight fungus (such as rice bacterial blight strain PXO99).

[0067] The defense-related genes are genes PR1 and / or PR2 and / or PR3 and / or PR4 and / or PR5 and / or PR8 and / or PR10 and / or WRKY45.

[0068] In a sixth aspect, the present invention provides any of the following substances:

[0069] 1) sgRNA, whose target site is positions 39-58 of sequence 1;

[0070] 2) A plasmid expressing the sgRNA or a plasmid containing the gene encoding the sgRNA.

[0071] In an embodiment of the present invention, the plasmid expressing the sgRNA or the plasmid containing the sgRNA encoding gene is the plasmid pCas9-OsFBX388, which contains the sgRNA targeting OsFBX388 and the Cas9 enzyme encoding gene.

[0072] In the above applications or methods, the recipient plant is a monocotyledonous or dicotyledonous plant; the monocotyledonous plant can be rice, corn, wheat, etc. In this invention, the plant is a monocotyledonous plant, the monocotyledonous plant is rice, and the rice variety can specifically be Aichi Asahi.

[0073] This invention utilizes a recessive lesion-like mutant of rice, spla, to clone the OsFBX388 gene using SiteFinding-PCR technology and perform functional analysis. In the mutant spla, T-DNA is inserted into the promoter region of the OsFBX388 gene, leading to decreased OsFBX388 expression and exhibiting a lesion-like phenotype, thus enhancing resistance to rice blast fungus compared to the wild type. Furthermore, the OsFBX388 gene was knocked out in wild-type rice using a pCas9 vector. Compared to the wild type, the knockout plants exhibited the same phenotype as the mutant spla. Knockout of the OsFBX388 gene increases its resistance to rice blast fungus, showing promise for improving plant yield. This invention provides a foundation for using genetic engineering techniques in molecular breeding to improve crop yield or enhance plant disease resistance, and has potential application value. Attached Figure Description

[0074] Figure 1 The study compared the growth phenotypes of the mutant spla and the wild-type (WT), and detected reactive oxygen species (ROS) and cell necrosis in their leaves. A represents the phenotype under field (Beijing) planting conditions; the white box represents 10 cm. B shows the accumulation of necrotic cells around lesions detected by trypan blue staining. C shows the accumulation of ROS around lesions detected by DAB staining. D shows the accumulation of ROS around lesions detected by NBT staining. WT represents the wild-type, and spla represents the mutant spla.

[0075] Figure 2 Phenotypic results of inoculation of mutant spla and wild-type (WT) with pathogens; A shows the disease outcome of inoculation with blast fungus race P007 via scratch; B shows the lesion length measured after inoculation with blast fungus race P007 via scratch (data is the average of 12 lesion lengths, **: P < 0.01, Student's t-test); C shows the disease outcome of inoculation with rice bacterial blight pathogen PXO99; D shows the lesion length measured after inoculation with rice bacterial blight pathogen PXO99 (data is the average of 10 lesion lengths, **: P < 0.01, Student's t-test).

[0076] Figure 3 The results of the relative expression levels of eight defense genes in mutant spla and wild-type (WT) were obtained by real-time quantitative PCR (**: P<0.01, Student's t-test).

[0077] Figure 4The results of cloning the rice OsFBX388 gene using SiteFinding-PCR are shown in Figure A; A shows the insertion site of T-DNA in the OsFBX388 gene; B shows the results of PCR identification of the T-DNA insertion site; C shows the results of real-time quantitative PCR detection of the relative expression levels of the OsFBX388 gene in mutant spla and wild type (WT) (**: P<0.01, Student t-test).

[0078] Figure 5 Subcellular localization results for OsFBX388; VirD2NLS is the nuclear marker.

[0079] Figure 6 The following sections illustrate the acquisition and phenotypic analysis of OsFBX388 gene knockout (KN) lines; A shows the field phenotypes of wild-type, mutant spla, and OsFBX388-KN transgenic lines; the white box represents 15 cm; B shows the CRISPR target site map of the OsFBX388 gene in the OsFBX388-KN transgenic lines; the boxes indicate the altered bases. A "T" base was inserted in KN-7, while an "A" base was inserted in KN-9. This led to premature termination of frame switching and translation. PAM represents the motif sequence adjacent to the original spacer. C shows the disease outcome after scratch inoculation with blast fungus race P007; D shows the lesion length measured after scratch inoculation with blast fungus race P007 (data is the average length of 12 lesions, **: P < 0.01, Student's t-test). Detailed Implementation

[0080] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0081] The rice blast fungus race P007 described in the following examples is described in the literature "Physiological races of rice blast fungus and their toxicity (Fan Jinghua, Zhou Huiping, Wang Honghai, et al. Physiological races of rice blast fungus and their toxicity [J]. Plant Protection, 2005, 31(6):29-31.)". It is available to the public from China Agricultural University. This biological material is only used to repeat the relevant experiments of this invention and should not be used for other purposes.

[0082] The rice bacterial blight strain PXO99 described in the following examples is described in the literature "Identification and preliminary localization of a new gene for resistance to bacterial blight in small-grain wild rice (Guo Sibin, Zhang Duanpin, Lin Xinghua. Identification and preliminary localization of a new gene for resistance to bacterial blight in small-grain wild rice [J]. Chinese Agricultural Science, 2010, 43(13):2611-2618.)". It is available to the public from China Agricultural University. This biological material is only used to repeat the relevant experiments of this invention and should not be used for other purposes.

[0083] Example 1: Obtaining the rice OsFBX388 protein and its encoding gene

[0084] I. Obtaining and Phenotypic Identification of Rice Disease-Related Mutant spla

[0085] 1. Obtaining and phenotypic identifying the rice disease mutant spla

[0086] The mutant spla was obtained by screening the offspring of the T-DNA transformed rice variety Aichi Asahi (hereinafter also known as wild-type rice).

[0087] Phenotypic comparison between mutant spla and wild-type Aichi Asahi: Figure 1 As shown in Figure A, it can be seen that in the field, on day 125 after planting, the mutant spla exhibited stunted growth and obvious disease-like symptoms. Different leaves of the mutant spla all showed lesion-like spots.

[0088] 2. Detection of reactive oxygen species and cell necrosis in leaves

[0089] Staining experiments were conducted on leaves of mutant spla and wild-type rice Aichi Asahi using trypan blue, 3'3'-diaminobenzidine (DAB), and nitroblue tetrazolium (NBT), respectively. The specific steps were performed according to the method described in the literature "Qiao Y, Jiang W, Lee JH, et al. SPL28 encodes a clathrin-associated adaptor protein complex 1, medium subunit μ1 (AP1M1) and is responsible for spotted leaf and early senescence in rice (Oryza sativa). New Phytologist, 2010, 185(1):258-274."

[0090] The results are as follows Figure 1 As shown in B-1D, reactive oxygen species bursts and cell necrosis can be clearly detected at the lesion-like sites of the mutant spla, while they are not detected in wild-type rice.

[0091] 3. Inoculation test

[0092] (1) The mutant spla and wild-type rice Aichi Asahi were inoculated in vitro by scratching the leaves of the rice using the rice blast fungus race P007. The specific steps were performed according to the method in the literature "Fang, W., Liu, C., Zhang, H. et al. Selection of differential isolates of Magnaporthe oryzae for postulation of blast resistance genes. Phytopathology, 2018, 108: 878-884."

[0093] The results are as follows Figure 2 As shown in A and 2B, 120 hours after inoculation by scratch, the lesion length of the mutant spla was significantly shorter than that of the wild type, indicating that the mutant spla had significantly enhanced resistance to rice blast fungus.

[0094] (2) The mutant spla and wild-type rice Aichi Asahi were inoculated with rice bacterial blight strain PXO99. The specific steps were performed according to the method in the literature "Zhao, XS; Qiu, TC; Feng, HJ et al. A novel glycine-rich domain protein, GRDP1, functions as a critical feedback regulator for controlling cell death and disease resistance in rice. Journal of Experimental Botany, 2021, 72, 608–622."

[0095] The results are as follows Figure 2 As shown in C and 2D, two weeks after inoculation, the lesion length of the mutant spla was significantly smaller than that of the wild type, indicating that the mutant spla had significantly enhanced resistance to bacterial blight.

[0096] 4. Detection of expression levels of defense genes

[0097] The expression of defense-related genes PR1, PR2, PR3, PR4, PR5, PR8, PR10, and WRKY45 in the mutant spa and wild-type rice Aichi Asahi was analyzed using quantitative real-time PCR, with rice ACTIN1 as an internal control. The specific steps are as follows: Fully expanded leaves from the same part of the mutant spa and wild-type Aichi Asahi were collected. Total RNA was extracted using the Trizol reagent method (Invitrogen). Reverse transcription was performed using MMLV reverse transcriptase (TaKaRa) according to the corresponding usage instructions. Then, using quantitative real-time PCR, SYBR green I fluorescent dye was added to the PCR system according to the manufacturer's (TaKaRa) instructions. The expression of defense-related genes PR1, PR2, PR3, PR4, PR5, PR8, PR10, and WRKY45 was detected using a quantitative real-time PCR instrument (ABI 7500, USA). Primer sequences are shown in Table 2. The experiment was performed in triplicate. Data processing employed the comparative Ct method, where Ct is the number of cycles required for the fluorescence signal in the PCR tube to reach a set threshold. ΔCt = Ct(analyte gene) - Ct(ACTIN1), with a 2:1 ratio. -ΔCt The value measures the level of gene transcription and compares and analyzes the genes measured in the mutant spla and wild-type rice.

[0098] Table 2 shows the primer sequences for ACTIN1 and defense genes.

[0099] Gene name Locus ID Primer name Sequence of items ACTIN1 LOC_Os03g50885 qRT-OsRAc1-F ATCACTGCCTTGGCTCCTA qRT-OsRAc1-R CATCTGCTGGAATGTGCTG PR1 LOC_Os07g03710 qRT-PR1b-F TCGTATGCTATGCTACGTGTTT qRT-PR1b-R CACTAAGCAAATACGGCTGACA PR2 LOC_Os01g71340 qRT-PR2-F CTGGCATTGGTCCTTGGAGTT qRT-PR2-R CGATGCCGTTGGACTTGTAG PR3 LOC_Os10g39680 qRT-PR3-F CCTATTGCATGATCGTTCGAT qRT-PR3-R GCCTGTAGCAGTTAAAGCAATTG PR4 LOC_Os11g37970 qRT-PR4-F TTGGCGCCAGAAGTATGGAT qRT-PR4-R TTGGCGCCAGAAGTATGGAT PR5 LOC_Os12g43380 qRT-PR5-F CCACGTGTGCAATTGTTTAATC qRT-PR5-R ACTCGGACGCTTTCATTTGA PR8 LOC_Os10g28080 qRT-PR8-F TTCATCTGGTCAGCGGATAGC qRT-PR8-R TATCACGACCGTTCGATGGA PR10 LOC_Os12g36880 qRT-PR10-F CCTGCCGAATACGCCTAAGA qRT-PR10-R CTCAAACGCCACGAGAATTT WRKY45 LOC_Os05g25770 qRT-WRKY45-F TGAAGGATGGGTACCAATGGA qRT-WRKY45-R CACATCTTTGGAGCTTCTTCTTGA

[0100] The results are as follows Figure 3 As shown, compared with wild-type rice (WT), the defense genes PR1, PR2, PR3, PR4, PR5, PR8, PR10, and WRKY45 in the mutant spla showed significant upregulation.

[0101] II. Cloning the OsFBX388 gene using SiteFinding-PCR technology

[0102] 1. Obtaining the OsFBX388 gene

[0103] Genetic analysis of the mutant spla obtained in step one above showed that the disease-like phenotype of this mutant co-segregated with the T-DNA insertion, indicating it was a single-site insertion recessive mutant. Site-Finding-PCR was used to isolate the flanking sequences of the T-DNA. Analysis revealed that the T-DNA insertion site was on chromosome 10. Figure 4As shown in Figure A). Primers JD-F (5'-AAACTCCGATCCCTCCCTGC-3'), JD-R (5'-TGCGAGAGAGTTCAGTAACGATGAT-3') and T-DNA boundary primers L3 (5'-GATGCCGACCGGATCTGTCGATC-3'), R3 (5'-CTGTTGCCGGTCTTGCGATGAT-3') were designed for PCR amplification. Figure 4 As shown in B), sequencing analysis revealed that T-DNA was inserted into the promoter region of a gene, with the insertion site located 1509 bp upstream of the gene's start codon ATG. Figure 4 A) This gene is named OsFBX388. The open reading frame (ORF) of the OsFBX388 gene is shown in Sequence 1 of the sequence listing, and the amino acid sequence of the protein it encodes (OsFBX388 protein) is shown in Sequence 2 of the sequence listing.

[0104] Compared to wild-type rice Aichi Asahi, the mutant spla is a T-DNA insertion mutation that occurs only in the promoter region of the OsFBX388 gene in the genome of wild-type rice Aichi Asahi. The T-DNA insertion site is located 1509 bp upstream of the start codon ATG of the OsFBX388 gene.

[0105] 2. OsFBX388 gene expression level detection

[0106] The expression of the OsFBX388 gene in the mutant spa and wild-type rice Aichi Asahi was analyzed using real-time PCR, with ACTIN1 as an internal control. Primer sequences are shown in Table 1. The detection method and data processing were the same as in step 4 of section one. The primer sequences are as follows:

[0107] qRT-OsFBX388-F: 5'-CCCCATCATGGACTACCACG-3';

[0108] qRT-OsFBX388-R: 5'-GGCATTGCAGCTTTGTAGCTC-3'.

[0109] The results are as follows Figure 4 As shown in Figure C, the results indicate that T-DNA insertion leads to a significant downregulation of the OsFBX388 gene in the mutant spla.

[0110] Example 2: Subcellular localization of OsFBX388 protein

[0111] 1. Using PCR, FBX388-GFP-F(5'-ata) was used to synthesize the GFP-F(5'-ata) protein. ggtaccATGGAGTCGCTGC-3' (underlined part is the Kpn I site) was used as the forward primer, and FBX388-GFP-R (5'-aat) was used as the reverse primer. tctaga Using TGGCGTTCGCGTC-3' (the underlined part is the Xba I site) as a reverse primer, the open reading frame sequence of the OsFBX388 gene was amplified from the cDNA of the rice variety Aichi Asahi (obtained by reverse transcription of extracted RNA).

[0112] 2. The PCR product obtained in step 1 was recovered and ligated into the pMD-18T vector (TaKaRa). After confirming correct sequencing, it was double-digested with Kpn I and Xba I. The digested product was ligated into the plant subcellular localization expression vector pCG1301 (Purutin Biotechnology (Beijing) Co., Ltd.), thus obtaining the recombinant expression vector pCG1301-OsFBX388-GFP containing the OsFBX388 gene. The structural description of the recombinant expression vector pCG1301-OsFBX388-GFP is as follows: a DNA molecule shown in positions 1-2037 of sequence 1 in the sequence listing was inserted between the multiple cloning site Kpn I and Xba I in the pCG1301 vector. In the recombinant expression vector pCG1301-OsFBX388-GFP, the promoter driving the expression of the OsFBX388 gene is the 35S promoter.

[0113] 3. Following the methods in the literature “Li,X.,2011,Infiltration of Nicotiana benthamiana Protocol for Transient Expression via Agrobacterium.Bio-protocol Bio101:e95.DOI:10.21769 / BioProtoc.95” and “Wang,K.,Liu,Y.and Li,S.,2013,Bimolecular Fluorescence Complementation (BIFC) Protocol for Rice Protoplast Transformation.Bio-protocol 3(22):e979.DOI:10.21769 / BioProtoc.979”, the recombinant expression vector pCG1301-OsFBX388-GFP (denoted as OsFBX388-GFP in the figure) was transformed into Aichi Asahi rice protoplasts, and the localization of OsFBX388 protein was observed under a laser confocal microscope.

[0114] The results are as follows Figure 5As shown in the figure, the OsFBX388 protein is located in the nucleus and cytoplasm of rice protoplasts.

[0115] Example 3: Obtaining and phenotypic identifying OsFBX388 gene knockout (KN) plants

[0116] The gene involved in this embodiment is the OsFBX388 gene from the rice variety Aichi Asahi obtained in Example 1. Its nucleotide sequence is Sequence 1 in the sequence listing, encoding the protein (OsFBX388) shown in Sequence 2 in the sequence listing. Sequence 1 consists of 2040 nucleotides, and Sequence 2 consists of 679 amino acids.

[0117] I. Obtaining KN plants with the OsFBX388 gene

[0118] 1. Construction of expression vector pCas9-OsFBX388

[0119] (1) Using a PCR instrument, primer 5'- ggca CTCCCGCCTGCCGGCCAGGT-3' (sequence 3, underlined portion is Bsa I site) and 5'- aaac Mix 10 μL of each of ACCTGGCCGGCAGGCGGGAG-3' (sequence 4, the underlined part is the Bsa I site) and incubate at 98°C for 2 minutes on a PCR instrument, then anneal to 25°C at a rate of 0.1°C per second to obtain the sgRNA encoding double-stranded sequence.

[0120] The target site of sgRNA is positions 39-58 of sequence 1.

[0121] (2) The pOs-sgRNA vector was digested with Bsa I, recovered, and ligated with double-stranded sgRNA using T4 ligase overnight at 16°C. The ligation product was heat-shocked and transformed into E. coli DH5α. Single clones were picked and cultured, and clones that tested positive by PCR were sent for sequencing verification. The intermediate vector pOs-sgRNA is detailed in the literature "Miao, J., Guo, D., Zhang, J. et al. Targeted mutationnesis in rice using CRISPR-Cas system. Cell research, 2013, 23(10): 1233-1236.", where it is named pOs-sgRNA. pOs-sgRNA-OsFBX388 was obtained.

[0122] (3) The plasmid pOs-sgRNA-OsFBX388, which was verified by sequencing, was mixed with the pCas9 vector in equal mass. Gateway LR homologous recombination enzyme (Invitrogen) was added, and homologous recombination was performed at room temperature for 4-8 hours. After the recombination reaction was completed, 1 μL of Protein K was added to terminate the reaction. The ligation product was heat-transformed into E. coli DH5α, single clones were picked and cultured on a shaker, and clones that were positive by PCR were sent for sequencing. Sequencing verified the pCas9-OsFBX388 knockout plasmid. For details of the pCas9 vector, please refer to the literature "Miao, J., Guo, D., Zhang, J. et al. Targeted mutagenesis in rice using CRISPR-Cassystem. Cell research, 2013, 23(10): 1233-1236.", in which it is named pH-Ubi-cas9-7.

[0123] The pCas9-OsFBX388 knockout plasmid is a plasmid obtained by inserting the sgRNA coding sequence of the OsFBX388 gene into the pCas9 vector. This plasmid contains a double-stranded sgRNA coding sequence.

[0124] The above OsFBX388 gene sgRNA coding sequence was obtained by annealing with the primers shown in Sequence 3 and Sequence 4.

[0125] 2. Obtaining OsFBX388-KN rice

[0126] The recombinant expression vector pCas9-OsFBX388 constructed in step 1 above was introduced into embryogenic callus of wild-type rice variety Oryza sativa L.cv. Aichiasahi using Agrobacterium EHA105 (Purutin Biotechnology (Beijing) Co., Ltd.) to obtain T0 generation OsFBX388-KN rice. For the preparation of embryogenic callus and specific transformation methods, please refer to the article "Yi Zili, Cao Shouyun, Wang Li, Chu Chengcai, Li Xiang, He Sijie, Tang Zuoshun, Zhou Puhua, Tian Wenzhong, Research on increasing the frequency of Agrobacterium transformation in rice, Acta Genetica Sinica, 2001, 28(4): 352-358".

[0127] 3. Identification of OsFBX388-KN rice

[0128] (1) Preliminary PCR identification

[0129] Genomic DNA was extracted from the T0 generation OsFBX388-KN rice obtained in step 2. The neomycin phosphotransferase gene (HPTII) fragment in the T0 generation OsFBX388-KN rice was detected using primers 5'-GCTGCGCCGATGGTTTCTACAA-3' and 5'-CACGGCCTCCAGAAGAAGATGGTTG-3'. A PCR amplification product of 514 bp was considered a positive plant. Furthermore, the Cas9 gene fragment in the T0 generation OsFBX388-KN rice was detected using primers 5'-CGACCTCGACAATCTCCTCG-3' and 5'-GTAGTACGGGATGCGGAAGG-3'. A PCR amplification product of 535 bp was considered a positive plant.

[0130] Based on the above PCR identification, the plants that were positive for both the HPTII fragment and the Cas9 gene fragment were positive T0 generation OsFBX388-KN transgenic rice. The two positive T0 generation OsFBX388-KN transgenic rice lines were designated as T0 generation OsFBX388-KN transgenic rice lines KN-7 and KN-9, respectively.

[0131] (2) Sequencing of T0 generation OsFBX388-KN rice lines KN-7 and KN-9

[0132] RNA was extracted from leaves of T0 generation transgenic OsFBX388-KN rice lines KN-7 and KN-9 and reverse transcribed into cDNA. Amplification was performed using primers 5'-ATGGAGTCGCTGCCG-3' and 5'-ATCGGCGAGCATA-3'. Wild-type rice Aichi Asahi (WT) was used as a control. The amplified results were sequenced, and the results are shown below. Figure 6 As shown in Figure B, a "T" base was inserted in KN-7, while an "A" base was inserted in KN-9. This led to premature termination of frame transition and translation in the OsFBX388 gene. PAM stands for Protospacer Adjacent Motif.

[0133] 4. Phenotype of OsFBX388-KN rice

[0134] (1) Field phenotype of OsFBX388-KN rice

[0135] Seeds of T0 generation transgenic OsFBX388-KN rice lines KN-7 and KN-9 were sown in the field, and phenotypes were observed after 120 days of growth. Wild-type rice Aichi Asahi (WT) and the mutant spla were used as controls.

[0136] The results are as follows Figure 6As shown in Figure A, it can be seen that in the field, on the 120th day after planting, the phenotypes of KN-7 and KN-9 are closer to those of wild-type rice, except that the plant height is shorter and no phenotype similar to that of the mutant spla is observed.

[0137] (2) Identification of disease resistance phenotypes in OsFBX388-KN rice

[0138] The leaves of T0 generation transgenic OsFBX388-KN rice lines KN-7 and KN-9, mutant spla, and wild-type rice Aichi Asahi (WT) were inoculated with detached scratching using the rice blast fungus race P007 (method as in Example 1).

[0139] Observe the leaves 96 hours after inoculation via puncture, and the results are as follows: Figure 6 As shown in C and 6D, it can be seen that 96 hours after gravid inoculation, the lesion length of OsFBX388-KN is consistent with that of the mutant spla, and is significantly shorter than that of the wild type, indicating that OsFBX388-KN has significantly enhanced resistance to rice blast fungus.

[0140] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of substances that reduce the content or activity of OsFBX388 protein in any of the following: 1) Improve the disease resistance of rice; 2) Cultivate rice varieties with improved disease resistance; 3) Breeding rice varieties resistant to rice blast and / or rice bacterial blight; The disease resistance is resistance to rice blast and / or resistance to rice bacterial blight; The OsFBX388 protein is any one of the proteins shown in A1)-A2) below: A1) A protein consisting of the amino acid sequence shown in Sequence 2 of the sequence listing; A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 2 of the sequence listing.

2. The application of substances that reduce or inhibit the expression of nucleic acid molecules encoding the OsFBX388 protein in any of the following: 1) Improve the disease resistance of rice; 2) Cultivate rice varieties with improved disease resistance; 3) Breeding rice varieties resistant to rice blast and / or rice bacterial blight; The disease resistance is resistance to rice blast and / or resistance to rice bacterial blight; The OsFBX388 protein is any one of the proteins shown in A1)-A2) below: A1) A protein consisting of the amino acid sequence shown in Sequence 2 of the sequence listing; A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 2 of the sequence listing.

3. A method for cultivating transgenic rice with enhanced disease resistance, comprising the following steps: reducing the content and / or activity of the OsFBX388 protein as described in claim 1 in recipient rice to obtain transgenic rice; wherein the transgenic rice exhibits higher disease resistance than the recipient rice; The disease resistance refers to resistance to rice blast and / or resistance to rice bacterial blight.

4. A method for cultivating transgenic rice with enhanced disease resistance, comprising the following steps: reducing or inhibiting the expression of the nucleic acid molecule encoding the OsFBX388 protein as described in claim 1 in recipient rice, thereby obtaining transgenic rice; wherein the transgenic rice exhibits higher disease resistance than the recipient rice; The disease resistance refers to resistance to rice blast and / or resistance to rice bacterial blight.

5. A method for cultivating transgenic rice with enhanced disease resistance, comprising the following steps: gene editing of the nucleic acid encoding the OsFBX388 protein as described in claim 1 in recipient rice, thereby stopping the translation of the OsFBX388 protein encoding gene, to obtain gene-edited rice; the gene-edited rice exhibits higher disease resistance than the recipient rice; The disease resistance refers to resistance to rice blast and / or resistance to rice bacterial blight.

6. The method according to claim 5, characterized in that: The gene editing was performed using the CRISPR / Cas9 system, with the sgRNA targeting positions 39-58 of sequence 1.