Sweet potato root rot resistant gene IbPXC3 and application thereof

Abstract

The invention relates to the technical field of gene engineering, and provides a sweet potato root rot resistant gene IbPXC3 and application thereof, and the nucleotide sequence of the sweet potato root rot resistant gene IbPXC3 is as shown in SEQ ID NO: 1. By means of the technical scheme, the problem that sweet potatoes are poor in root rot resistance in the prior art is solved.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a sweet potato root rot resistance gene IbPXC3 and an application thereof. Background Art

[0002] Sweet potato is an important food, feed and industrial raw material crop in the world, and occupies a prominent position in global agricultural production. It has the advantages of strong adaptability, high yield and rich nutrition, and is widely planted in tropical, subtropical and temperate regions. However, sweet potato is susceptible to a variety of diseases and pests during its growth. Among them, root rot caused by the sweet potato-specific type of Fusarium oxysporum is one of the devastating diseases that seriously restricts sweet potato production. Root rot can cause sweet potato root rot, growth and development stunting, yellowing and withering of leaves, a sharp decrease in tuber yield, and deterioration of quality. This has a very adverse impact on the economic benefits of sweet potato growers and also threatens the stable development of the sweet potato industry.

[0003] At present, the prevention and control of sweet potato root rot mainly relies on agricultural prevention and control measures and chemical control. Although it can reduce the occurrence of root rot to a certain extent, there are many limitations. For example, the rotation cycle is long, which is difficult to implement effectively in areas with limited land resources; the selection and breeding of disease-resistant varieties is slow, and traditional breeding methods have problems such as long cycles, low efficiency, and limited available disease-resistant gene resources. Although chemical control can control the spread of diseases in the short term, long-term use will not only increase production costs, but also cause a series of problems such as increased pathogen resistance, environmental pollution, and excessive pesticide residues in agricultural products, which does not meet the requirements of sustainable agricultural development.

[0004] With the rapid development of modern biotechnology, genetic engineering technology has provided new approaches and strategies for crop disease-resistant breeding. By identifying and cloning genes related to disease resistance and introducing them into target crops, new varieties with long-lasting and efficient disease resistance can be bred. However, the genes for sweet potato resistance to root rot still need further development and application. Summary of the invention

[0005] The present invention provides a sweet potato root rot resistance gene IbPXC3 and application thereof, which solves the problem that the sweet potato root rot resistance in the related art is poor.

[0006] The technical solution of the present invention is as follows:

[0007] The invention provides a sweet potato root rot resistance gene IbPXC3, and the nucleotide sequence of the sweet potato root rot resistance gene IbPXC3 is shown in SEQ ID NO:1.

[0008] The invention also provides a protein encoded by the sweet potato root rot resistance gene IBPXC3, and the amino acid sequence of the protein is shown in SEQ ID NO:2.

[0009] The present invention also provides a recombinant overexpression vector pCAMBIA1301S-IbPXC3 comprising the gene IbPXC3 of claim 1.

[0010] As a further technical solution, the overexpression vector of the gene IbPXC3 is constructed by the gene IbPXC3 described in claim 1.

[0011] As a further technical solution, the overexpression vector of the gene IbPXC3 comprises the following construction steps:

[0012] S1. Amplify the target gene IbPXC3 containing restriction sites XbaⅠ and KpnⅠ at both ends of the ORF shown in SEQ ID NO.1 by PCR;

[0013] S2, linearize the pCAMBIA1301SS plasmid using XbaI and KpnI;

[0014] S3. The target gene IbPXC3 containing restriction sites of XbaⅠ and KpnⅠ was connected to the linearized pCAMBIA1301S plasmid to obtain the recombinant product, and then transformed and sequenced in Escherichia coli competent cells to obtain the overexpression vector pCAMBIA1301S-IbPXC3 of the gene IbPXC3.

[0015] As a further technical solution, the competent E. coli cells in S3 are DH5α.

[0016] The present invention also proposes an application of the gene IbPXC3, the protein, the recombinant expression vector or the transformant in resisting sweet potato root rot.

[0017] As a further technical solution, the application is to cultivate sweet potatoes resistant to root rot or to prepare products of cultivating sweet potatoes resistant to root rot.

[0018] The invention also proposes a method for cultivating root rot resistant sweet potatoes, comprising the steps of introducing the sweet potato root rot resistant gene IbPXC3 into a receptor sweet potato to obtain the root rot resistant sweet potatoes.

[0019] The working principle and beneficial effects of the present invention are:

[0020] In the present invention, the highly resistant root rot variety Ji Zishu No. 1 is used as the female parent, and the highly susceptible sweet potato root rot variety Longshu No. 9 is used as the male parent. In the hybrid offspring, the highly resistant root rot strain Ji Shuzi 203 and the highly susceptible root rot strain Ji Shuzi 563 are screened out. The RNA of 0h, 36h, 72h, 5d and 10d after natural disease nursery treatment is used to construct a cDNA library, and transcriptome sequencing is performed using the Illumina Hiseq 2500 platform. Through differential gene analysis, 137 differential genes are screened out, and the IbPXC3 gene is cloned and analyzed, and the expression analysis of the IbPXC3 gene shows that the expression of the IbPXC3 gene is the highest in tuberous roots, followed by fibrous roots, leaves and stems, and the protein encoded by the IbPXC3 gene is distributed in the cell membrane, nucleus and cytoplasm of tobacco cells. Finally, it is verified by gene function that IbPXC3 has the function of improving the resistance to sweet potato root rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0022] Figure 1 This is a diagram of the root rot infection process of Jishuzi 203 and Jishuzi 536 in Example 1 of the present invention;

[0023] Figure 2 The differentially expressed genes of Jishuzi 203 in Example 1 of the present invention;

[0024] Among them: A is an up-regulated gene; B is a down-regulated gene;

[0025] Figure 3 The differentially expressed genes of Jishuzi 563 in Example 1 of the present invention;

[0026] Among them: A is an up-regulated gene; B is a down-regulated gene;

[0027] Figure 4 The differentially expressed genes of Jishuzi 203 and Jishuzi 563 of the present invention;

[0028] Among them: A is the gene that was up-regulated in Jishuzi 203 and down-regulated in Jishuzi 563 at each time point; B is the gene that was down-regulated in Jishuzi 203 and up-regulated in Jishuzi 563 at each time point; C is the gene that was up-regulated in Jishuzi 203 at 36h, 72h, 120h, and 240h compared with 0h, and that was also up-regulated in Jishuzi 203 compared with Jishuzi 563;

[0029] Figure 5 The cDNA and DNA product of IbPXC3 in Example 3 of the present invention;

[0030] Where C is the cDNA product and D is the DNA product;

[0031] Figure 6 This is an analysis diagram of IbPXC3 exons and introns in Example 3 of the present invention;

[0032] Figure 7 The transmembrane domain of the IbPXC3 protein in Example 3 of the present invention;

[0033] Figure 8 The homology tree diagram constructed by using MAGE7.0 software in Example 3 of the present invention;

[0034] Fig. 9 This is a diagram of tissue expression analysis of IbPXC3 in Example 3 of the present invention;

[0035] Fig.10 This is a diagram showing the expression of the IbPXC3 protein in tobacco cells in Example 3 of the present invention;

[0036] Fig.11 is the expression level of the IbPXC3 gene in sweet potato underground stems at different stages in Example 3 of this Example;

[0037] Fig.12 The results of the overexpression positive plant detection in Example 3 of the present invention;

[0038] Among them: 1-9 are the results of Hpt-F and Hpt-R primer detection, 10-18 are the results of IbPCK3-OF and JD-13sFlag-R detection;

[0039] Fig.13 The results of the interference expression positive plant detection in Example 3 of the present invention;

[0040] Among them: the upper row is the detection results of pCRD-infu-F and pFGC5941-M1R primers for structural primers, and the lower row 10-18 is the detection results of pFGC5941-M2F and pCRD-infu-R;

[0041] Fig.14 This is the identification of overexpression and interference in sweet potato plant root rot resistance in Example 4 of the present invention. DETAILED DESCRIPTION

[0042] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] Example 1 Determination of differentially expressed genes

[0044] (1) The highly resistant root rot variety Ji Zishu No. 1 was used as the female parent and the highly susceptible sweet potato root rot variety Longshu No. 9 was used as the male parent for hybridization. The highly resistant root rot strain Ji Shuzi 203 and the highly susceptible root rot strain Ji Shuzi 563 were selected from the hybrid offspring. RNA was extracted at 0 h, 36 h, 72 h, 5 d and 10 d after treatment in the natural disease nursery and clean soil, respectively, to construct a cDNA library, and transcriptome sequencing was performed using the Illumina HiSeq 2500 platform. Figure 1 The root rot infection status of Jishuzi 203 and Jishuzi 536 at 5d, 10d, 15d, 20d, 40d and 120d respectively.

[0045] A high-throughput method was used to screen the differentially expressed genes of sweet potato resistance to root rot at 0h, 36h, 72h, 5d and 10d, and functional annotation and enrichment analysis of the differential genes were performed to clarify the possible biological functions of the differential genes and the main biological metabolic pathways and signal transduction pathways they were involved in. The genome of the cultivated sweet potato Taizhong No. 6 was used as a reference for sequence alignment and subsequent analysis.

[0046] The difference and gene analysis strategy is: after root rot induction, the differentially expressed genes of Jishuzi 203 at 36h, 72h, 120h, 240h were compared with 0h, and the differentially expressed genes of Jishuzi 563 at 36h, 72h, 120h, 240h were compared with 0h. The statistical results showed that under the induction of root rot, 34603 and 30011 differentially expressed genes were obtained in Jishuzi 203 and Jishuzi 563, respectively (Table 1), of which 3072, 4379, 5160 and 5087 genes were up-regulated at 36h, 72h, 120h, 240h compared with 0h, respectively, and 1082 up-regulated genes were found in total ( Figure 2 A), there were 2763, 4782, 5429 and 3931 down-regulated genes, and a total of 1209 down-regulated genes ( Figure 2 B); the number of up-regulated genes in Jishuzi 563 at 36h, 72h, 120h, and 240h compared with 0h was 3632, 3965, 3822, and 4683, respectively, and a total of 1380 up-regulated genes ( Figure 3 A), there are 3548, 3877, 2940 and 3544 down-regulated genes, and a total of 1018 down-regulated genes ( Figure 3 B).

[0047] Table 1 Statistics of differentially expressed genes between Jishuzi 203 and Jishuzi 563

[0048]

[0049] The differentially expressed genes with opposite expression patterns were screened in the differentially expressed genes of Jishuzi 203 and Jishuzi 563. The results showed that the number of differentially expressed genes that were up-regulated at each time point in Jishuzi 203 and down-regulated at each time point in Jishuzi 563 was 0 ( Figure 4 A), there are 7 differentially expressed genes that were down-regulated at each time point in Jishuzi 203 and up-regulated at each time point in Jishuzi 563 ( Figure 4 B), and there were 137 genes up-regulated at 36h, 72h, 120h, 240h compared with 0h in Jishuzi 203 and at 36h, 72h, 120h, 240h in Jishuzi 563 ( Figure 4 C).

[0050] Example 2 Screening of root rot resistance-related gene IbPXC3

[0051] Jishuzi 203 and Jishuzi 563 were planted in diseased plots with uniform sweet potato root rot, and samples were taken at 0h, 36h, 72h, 120h and 240h, respectively. The gene expression differences and gene annotations of the 137 differentially expressed genes in Jishuzi 203 and Jishuzi 563 at different time points were determined.

[0052] The results showed that among the 137 differentially expressed genes, the expression levels of IbPXC3 gene at 36h, 72h, 120h and 240h in Jishuzi 203 were higher than those at 0h, and higher than those at the corresponding time points in Jishuzi 563, and the expression level of IbPXC3 gene reached a peak at 120h. Therefore, the gene IbPXC3 related to root rot resistance was selected for cloning and analysis. Table 2 shows the expression level statistics in Jishuzi 203 and Jishuzi 563 after root rot induction.

[0053] Table 2 Statistics of expression levels in Jishuzi 203 and Jishuzi 563 after root rot induction

[0054]

[0055] (1) Analysis of IbPXC3 gene characteristics

[0056] Leucine-rich repeat receptor-like protein kinase (LRR-RLK) is the largest known subfamily of transmembrane receptor kinases in plant genomes. It consists of three parts: an extracellular LRR domain, a single transmembrane domain, and an intracellular kinase domain. The LRR domain contains 1 to 32 LRR tandem repeats, each of which is composed of 20 to 24 conserved amino acid residue sequences LxxLxLxxNxLt / sGxIPxxLGxLxx (L is a hydrophobic amino acid such as leucine, isoleucine, oxadiazine or phenylalanine, and X represents any amino acid). Recent studies have shown that LRR-RLK plays an important role in regulating plant growth and development, plant-microorganism immune defense response, hormone signaling pathway regulation, and stress resistance response.

[0057] PXC (PXY / TDR-correlated genes) genes are also a typical class of LRR-RLK genes. In Arabidopsis, TDIF (tracheary element differentiation inhibitory factor) and TDIF receptor PXY / TDR (phloemintercalated with xylem) can regulate the growth of vascular cells. The TDIF-PXY / TDR signal transduction pathway is believed to be required to locate the polarity of the vascular bundle early in vascular development and to continuously regulate this process throughout development. In vascular tissue, the TDIF-PXY / TDR signal transduction pathway plays a variety of roles in xylem development, such as promoting cambium cell division and inhibiting xylem formation. The loss of PXC1 may delay the formation of secondary cell wall deposition, and whether PXC is involved in resistance to root rot needs further study.

[0058] Example 3 Cloning and functional identification of sweet potato IbPXC3 gene

[0059] 3.1 Materials and methods

[0060] 3.1.1 Sweet potato materials, strains and plasmid vectors

[0061] Plant materials: Sweet potato material Jishuzi 203 (root rot resistance) was used for total RNA extraction and cloning of IbPXC3 gene. Jiyuan 2 (medium root rot resistance) was used for sweet potato genetic transformation by rooting method.

[0062] Strains: Escherichia coli DH5α (Shanghai Weidi Biotechnology Co., Ltd.), Agrobacterium K599 and EHA105 (Shanghai Weidi Biotechnology Co., Ltd.).

[0063] Vector plasmids: pCAMBIA1301S and pFGC5941 vectors, which have the hygromycin resistance selection marker gene (HygR), were used for the construction of sweet potato overexpression vector and interference expression vector, respectively, and are now stored in this laboratory.

[0064] Both the pCAMBIA1301S vector and the pFGC5941 vector are described in the following literature: You C, Li C, Ma M, Tang W, Kou M, Yan H, Song W, Gao R, Wang X, Zhang Y, Li Q. AC2-Domain Abscisic Acid-Related Gene, IbCAR1, Positively Enhances Salt Tolerance in Sweet Potato (Ipomoea batatas (L.) Lam.). Int. J. Mol. Sci. 2022, 23(17): 9680. doi: 10.3390 / ijms23179680.

[0065] 3.1.2 Obtaining the CDS sequence of IbPXC3 gene

[0066] 3.1.2.1 Extraction of total RNA from sweet potato

[0067] The leaves of Jishuzi 203 were frozen in liquid nitrogen and then ground. The total RNA of Jishuzi 203 was extracted using EasyPure Universal Plant Total RNA Kit (ER302) from TRANS.

[0068] The specific extraction method is:

[0069] Refer to TRANS EasyPure Universal Plant Total RNA Kit (ER302), the specific steps are as follows:

[0070] 1. Weigh about 100 mg of fresh plant tissue ground with liquid nitrogen into a 1.5 mL sterile centrifuge tube.

[0071] 2. Add 700 μL of lysis buffer LB52 to the ground sample and mix thoroughly. Incubate at 65°C for 5 min.

[0072] 3. Add 175 μL of PB52 solution, mix thoroughly, centrifuge at 13,500×g for 3 min, transfer all the supernatant to the Filtration Columns with Collection Tubes (there may be a small amount of precipitate or impurities in the supernatant, which will not affect the downstream extraction), and then centrifuge at 13,500×g for 2 min. If the solution is viscous after lysis, add PB52 and ice bath for 5 min before centrifuging again.

[0073] 4. Add 350 μL of isopropanol to the above collection tube and mix by inverting. Flocculent precipitate may appear at this time.

[0074] 5. Pipette all the mixed solution and add it to the adsorption column RNA Spin Columns with Collection Tubes II twice. Centrifuge at 13,500×g for 30 seconds and discard the effluent.

[0075] 6. Add 80 μL of DNase I working solution to the center of the adsorption column filter membrane and let it stand at room temperature for 10 minutes.

[0076] Preparation of DNaseⅠ working solution: Take 70ul DNaseⅠReaction Buffer and add it to an RNase-free centrifuge tube, then add 10μL DNaseⅠ and mix well.

[0077] 7. Add 500 μL of solution CB52, centrifuge at 13,500 × g for 30 seconds, and discard the flow-through (please check whether anhydrous ethanol has been added before using CB).

[0078] 8. Add 500 μL of solution WB52, centrifuge at 13,500×g for 30 seconds, and discard the flow-through (please check whether anhydrous ethanol has been added before using WB).

[0079] 9. Repeat step 8 once.

[0080] 10.13, Centrifuge at 500×g for 2 min to completely remove the residual WB52 and place the adsorption column in a clean centrifuge tube.

[0081] 11. Add 50-100 μL RNase-free water to the center of the adsorption column and let it stand at room temperature for 2 minutes. Centrifuge at 13,500×g for 1 minute to elute the RNA.

[0082] 12. To obtain more RNA, repeat step 10 and perform a second elution. Please store the RNA solution at -80℃ for later use.

[0083] 3.1.2.2 First-strand cDNA synthesis

[0084] The extracted total RNA was used as a template and reverse transcription was performed using Reverse Transcriptase M-MLV (RNase H-) (TaKaRa) to synthesize the first-strand cDNA.

[0085] The specific method for first-strand cDNA synthesis is as follows:

[0086] Reverse transcription was performed using Reverse Transcriptase M-MLV (RNase H-) (TaKaRa Company), and the specific steps are as follows:

[0087] 1. Add the following ingredients to a 200 μL PCR tube:

[0088] Table 3

[0089]

[0090] 2. Mix the above ingredients and centrifuge instantly;

[0091] 3.70℃, 10min; 2min on ice, instant centrifugation;

[0092] 4. Add the following ingredients to the centrifuge tube (already contains 6 μL):

[0093] Table 4

[0094]

[0095] 5.42℃, 1h; 70℃, 15min;

[0096] 6. Store at -20℃ for later use.

[0097] 3.1.2.3 IbPXC3 gene cDNA amplification

[0098] The partial IbPXC3 sequence obtained from the transcriptome was compared with the reference genome website of the wild species Ipomoea triloba (http: / / sweepotato.uga.edu / ), a close relative of sweet potato, to obtain the CDS sequence of the IbPXC3 gene. Primers IbPXC3-F: GATCAGAAAAACATCATGGGTAGAC and IbPXC3-R: TTCTCTTTTGGTAATTTGGTGTAAG were designed from two segments of the CDS sequence of the IbPXC3 gene using the Primer3.0 online tool. The cDNA of Jishuzi 203 was used as a template for amplification using KOD FX high-fidelity enzyme. The amplification system (Table 5) and procedure are as follows:

[0099] Table 5 Amplification system

[0100]

[0101] Amplification Procedure:

[0102]

[0103] The PCR products were detected by 1.0% agarose gel electrophoresis.

[0104] 3.1.2.4 Purification and recovery of target fragment

[0105] Add electrophoresis loading buffer to the amplified product, perform agarose gel electrophoresis, use fresh electrophoresis buffer to separate it, use UV gel imager to image the electrophoresis result, select the target band for gel extraction and recovery. Gel recovery is performed using TRANS's EasyPure Quick Gel Extraction Kit (EG101).

[0106] 3.1.2.5 Target fragment ligation and transformation

[0107] The target fragments were linked using the TRANS pEASY-Blunt Zero Cloning Kit (CB501). The reaction system is as follows:

[0108] Table 6

[0109]

[0110] The DNA concentration in the gel recovery product is preferably 50-150 ng / μL. The ligation reaction is carried out at 25°C for 30 minutes. The ligation product is then transformed into E. coli competent DH5α. The E. coli transformation method is as follows:

[0111] 1. Take out the DH5α competent cells from -80℃ and quickly put them in ice. After 5 minutes, wait for the bacterial block to melt, add the target DNA (plasmid or ligation product), and gently mix it by hand at the bottom of the EP tube (avoid using a gun to suck it), and let it stand in ice for 25 minutes.

[0112] 2. Heat shock in a 42℃ water bath for 45 seconds, quickly put back on ice and let stand for 2 minutes. Shaking will reduce the transformation efficiency.

[0113] 3. Add 700 μL of sterile LB liquid culture medium without antibiotics into the centrifuge tube, mix well and resuscitate at 37°C, 200 rpm for 60 min.

[0114] 4. Centrifuge at 5000 rpm for 1 min to collect the bacteria, retain about 100 μL of the supernatant, gently resuspend the bacteria by pipetting and spread on the solid LB medium containing the corresponding antibiotics.

[0115] 5. Place the plate upside down in a 37°C incubator overnight for 16 hours.

[0116] LB medium: 10g NaCl, 10g tryptone, 5g yeast powder, adjust the pH to 7.0, make up to 1L, add 15g agar to solid medium, but not to liquid medium.

[0117] 3.1.2.6 Target fragment detection and sequencing

[0118] Use a white pipette tip to pick up colonies in LB / Amp (100 mg / mL) liquid culture medium, culture overnight at 37°C, 200 rpm, then detect positive clones by PCR (amplification system procedure is the same as 3.1.2.3) and send to Tianjin Qingke Biotechnology Co., Ltd. for sequencing analysis.

[0119] 3.1.2.7 Bacterial liquid storage and plasmid extraction

[0120] After sequencing, a single clone with 100% sequence similarity was selected for activation. A portion of the activated bacterial solution was added with 50% glycerol to preserve the bacteria and cryopreserved. The remaining bacterial solution was used to extract plasmids using the EasyPure Plasmid MiniPrepKit (EM101) from TRANS. The extracted plasmids were stored at -20°C for future use.

[0121] The specific method of plasmid extraction is:

[0122] Use TRANS's EasyPure Plasmid MiniPrep Kit (EM101) for plasmid extraction. The specific steps are as follows:

[0123] 1. Take the overnight cultured bacterial solution, centrifuge at 10,000xg for 1 minute, remove the supernatant, and aspirate as much as possible. If the amount of bacterial solution is too large, it can be collected by centrifugation several times.

[0124] 2. According to the table above, add colorless solution RB (containing RNaseA) and oscillate to suspend the bacterial precipitate. No small bacterial clumps should be left.

[0125] 3. According to the table above, add blue solution LB and gently mix by inverting up and down 4-6 times to fully lyse the bacteria and form a blue transparent solution. The color changes from semi-transparent to transparent blue, indicating complete lysis. The time should not exceed 5 minutes.

[0126] 4. According to the table above, add yellow solution NB and mix gently for 5-6 times. The color will change from blue to yellow, indicating that the mixture is evenly mixed and neutralized completely. Then, a compact yellow agglomerate is formed and allowed to stand at room temperature for 2 minutes.

[0127] 5. Centrifuge at 12,000x g for 5 minutes, carefully pipette the supernatant and add it to the centrifuge column. Centrifuge at 12,000x g for 1 minute, and discard the flow-through. If the supernatant volume is larger than 800μL, add it to the column in multiple portions and centrifuge as above, and discard the flow-through.

[0128] 6. Add 650 μL of WB solution, centrifuge at 12,000 x g for 1 min, and discard the flow-through.

[0129] 7. Centrifuge at 12,000 x g for 2 min to completely remove residual WB.

[0130] 8. Place the centrifuge column in a clean centrifuge tube, add 30-50 μL EB or deionized water (pH>7.0) in the center of the column and let stand at room temperature for 1 minute (preheat EB or deionized water in a 60-70°C water bath for better results).

[0131] 9. Centrifuge at 10,000 x g for 1 min to elute the DNA, and store the eluted DNA at -20°C.

[0132] 3.1.3 Obtaining the IbPXC3 genomic DNA sequence

[0133] 3.1.3.1 Extraction of sweet potato genomic DNA

[0134] The genomic DNA of Jishuzi 203 leaves was extracted using the CTAB method. The specific steps are as follows:

[0135] 1) Grind the sweet potato leaves with liquid nitrogen, and quickly add 800 μL of CTAB extraction solution preheated to 65°C and 80 μL of CTAB / NaCl preheated to 65°C;

[0136] 2) Incubate at 65°C for 30 min, inverting the sample occasionally to mix;

[0137] 3) Add an equal volume of chloroform:isoamyl alcohol (V:V = 24:1), gently invert and mix for 15 min, and then centrifuge at 12000 rpm for 10 min;

[0138] 4) Take the supernatant, transfer it to another new tube, add 1 / 10 volume of CTAB / NaCl at 65°C and mix well;

[0139] 5) Extract with an equal volume of chloroform: isoamyl alcohol (V:V = 24:1), gently mix for 15 minutes, then centrifuge at 12000 rpm for 10 minutes, recover the upper phase, and repeat until no white color is left;

[0140] 6) Add 16 μL of 10 mg / mL RNase A and incubate at 37°C for 1 h;

[0141] 7) Add an equal volume of chloroform:isoamyl alcohol (V:V = 24:1), mix gently for 15 min, and then centrifuge at 12000 rpm for 10 min;

[0142] 8) Take the supernatant and transfer it to another new centrifuge tube, add 2 volumes of chilled anhydrous ethanol, and precipitate the DNA at -20℃;

[0143] 9) Wash with 75% ethanol 2-3 times, dry until the DNA becomes transparent, and dissolve the DNA with 40 μL TE;

[0144] 10) Store at 4℃, long term storage at -20℃.

[0145] 3.1.3.2 Amplification of the full length of the IbPXC3 gene

[0146] The genomic DNA of Jishuzi 203 leaves was used as a template and amplified using KOD FX enzyme from TOYOBO. The amplification primers, system and procedure refer to 3.1.2.3.

[0147] 3.1.3.3 PCR product recovery and purification

[0148] Detect the PCR product using agarose gel electrophoresis and recover and purify the target fragment. For specific steps, refer to 3.1.2.4.

[0149] 3.1.3.4 Target fragment ligation and transformation

[0150] The target fragment was connected to the pEASY-Blunt Zero Cloning Vector of TRANS and transformed into E. coli DH5α. For specific steps, refer to 3.1.2.5.

[0151] 3.1.3.5 PCR detection and sequencing of target fragments

[0152] Pick a single clone and perform bacterial liquid PCR and sequencing. For specific steps, refer to 3.1.2.6.

[0153] 3.1.3.6 Bacterial liquid storage and plasmid extraction

[0154] After sequencing is completed, select 3 to 5 monoclonal bacterial cultures with 100% sequence similarity for bacterial culture preservation and plasmid extraction. For specific steps, refer to 3.1.2.7.

[0155] The DNA length of IbPXC3 is 2879 bp, and the cDNA length is 2792 bp ( Figure 5); the 2792 bp sequencing sequence was input into the ORF Finder in NCBI to search for possible open reading frames in the gene sequence (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html), and the full-length ORF sequence of the gene was obtained, which was 2736 bp and encoded 911AA. The nucleotide sequence of the cDNA was shown in SEQ ID NO: 3; the nucleotide sequences of ORF and CDS were the same, as shown in SEQ ID NO: 4.

[0156] 3.1.4 Bioinformatics analysis of IbPXC3 gene

[0157] 3.1.4.1 Compare and analyze the cDNA and gDNA sequences of the gene through the online software https: / / gsds.gao-lab.org / , and draw a schematic diagram of the gene structure ( Figure 6 ), the results showed that the IbPXC3 gene contained 1 intron and 2 exons.

[0158] 3.1.4.2 Prediction and analysis of amino acid composition and physicochemical properties

[0159] The primary structure of amino acids (such as isoelectric point, molecular weight, etc.) is predicted by the ProtParam website (http: / / www.expasy.ch / tools / protparam.html).

[0160] The ProtParam program predicts the following:

[0161] Molecular weight: 99080.01Da

[0162] Isoelectric point (Theoretical pI): 6.16

[0163] Number of amino acids: 911

[0164] Amino acid composition: see Table 7

[0165] Negatively charged residues (Asp+Glu): 69

[0166] Positively charged residues (Arg+Lys): 61

[0167] Molecular formula: C4429H7082N1176O1326S33

[0168] Total number of atoms: 14046

[0169] Extinction coefficients / M-1cm-1: 71445 (70820)

[0170] Half-life (N-terminal residue M is assumed to be Met): mammalian reticulocytes (in vitro) 30h; yeast (in vivo) >20h; Escherichia coli (in vivo) >10h.

[0171] Instability index: 37.28, indicating that the protein is stable.

[0172] Aliphatic index: 106.49

[0173] Grand average of hydropathicity (Grand average of hydropathicity, average hydrophilicity coefficient, if this value is negative, it means that the protein is a hydrophilic protein, otherwise it is a hydrophobic protein): 0.081, indicating that the protein is a hydrophobic protein.

[0174] Table 7 Amino acid composition of the protein encoded by IbPXC3 gene

[0175]

[0176] 3.1.4.3 Protein transmembrane domain prediction and analysis

[0177] The peptide transmembrane region was completed by TMpred (http: / / www.ch.embnet.org / software / TMPRED_form.html) or TMHMM (http: / / www.cbs.dtu.dk / services / TMHMM / ) programs.

[0178] The results are as follows Figure 7 As shown, there are typical transmembrane helical structures at amino acids 577-599 and 687-709, indicating that the protein has a transmembrane domain.

[0179] 3.1.4.4 Multiple comparisons of amino acid sequences and phylogenetic analysis

[0180] Combined with the BLASTx results, amino acid sequences with high homology to the target gene were selected using the maximum parsimony method using Clustal X, BioEdit and MAGE4 software.

[0181] Ten species with high homology in the comparison results were selected for analysis, namely Ipomoea nil (XP_019177675.1), Ipomoea batatas (GMD70699.1), Ipomoea triloba (XP_031113650.1), Capsicum annuum (XP_016569740.1), Solanum verrucosum (XP_049344919.1), Solanumtuberosum (KAH0777753.1), Capsicum chinense (PHU19945.1), Solanum bulbocastanum (KAK6775579.1), Solanum pennellii (XP_015056547.1), and Solanum dulcamara (XP_055833739.1). The homology phylogenetic tree was constructed using MAGE7.0 software. Figure 8 As shown, IbPXC3 is most closely related to the wild sweet potato species Ipomoeanil, followed by the hexaploid sweet potato Ipomoea batatas and the diploid Ipomoea triloba, and is more distantly related to the potato Solanum tuberosum.

[0182] 3.1.5 Analysis of IbPXC3 gene expression in different tissues

[0183] Using Jishuzi 203 with a growth period of 40 days as the material, leaves, stems, fibrous roots and tuberous roots were selected to extract RNA, and the first-strand cDNA synthesis was performed with reference to the TRANS Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR reverse transcription kit (AU341). The specific method is as follows: the relative expression of the IbPXC3 gene in different tissues was determined using the reverse transcribed cDNA RT-qPCR template. The results are shown in Figure 2. Fig. 9 As shown, the results showed that the expression level of IbPXC3 gene was highest in tuberous roots.

[0184] Table 8 IbPXC3 real-time quantitative primers

[0185]

[0186] The specific method for synthesizing the first strand of cDNA is as follows: refer to the Uni All-in-One First-StrandcDNA Synthesis SuperMix for qPCR reverse transcription kit (AU341) of TRANS Company to synthesize the first strand of cDNA. The specific steps are as follows:

[0187] 1. Reverse transcription reaction system

[0188] Table 9

[0189]

[0190] 2. Mix gently and incubate at 50℃ for 5 min. For RNA templates with high GC content or complex secondary structure, the reaction temperature can be appropriately increased (≤65℃).

[0191] Inactivate by heating at 3.85°C for 2 min.

[0192] 4. Store at -20℃ for future use.

[0193] qPCR system:

[0194] Table 10

[0195]

[0196] qPCR procedure:

[0197]

[0198] 3.1.6 Analysis of IbPXC3 subcellular localization

[0199] 3.1.6.1 Construction of vector for subcellular localization of IbPXC3

[0200] Remove the terminator from the ORF sequence of the IbPXC3 gene and design specific primers containing KpnⅠ and BamHⅠ restriction sites: IbPCK3-kpn1-F: ACGGGGGACGAGCTCGGTACCATGGGTAGACTCTATGATAT and IbPCK3-BamH1-R: CATGTCGACTCTAGAGGATCCCTTAGCCAAATCAAGCAGCA. Use the plasmid saved in 3.1.2.7 as a template and high-fidelity enzyme KOD for amplification. The amplification system and procedure refer to 3.1.2.3. PCR products were detected by 1.0% agarose gel electrophoresis, and then the recovery and purification of the target fragment was the same as 3.1.2.4.

[0201] The subcellular localization pCAMBIA1301S-GFP vector (plasmid concentration 73 ng / μL) was linearized with KpnⅠ and BamHI. The restriction enzyme system is as follows:

[0202] Table 11

[0203]

[0204] React at 37°C for 2h.

[0205] After the enzyme digestion reaction is completed, the fragments are detected by 1.0% agarose gel electrophoresis and the large fragments are recovered by gel electrophoresis in the same way as in 3.1.2.4.

[0206] By using the homologous recombination method, the CDS sequence of the IbPXC3 gene without the terminator was connected with the linear fragment of pCAMBIA1301S-GFP digested with KpnⅠ and BamHⅠ restriction enzymes using the EZ-HiFi Seamless Cloning Kit of GenStar Company to construct the subcellular localization vector pCAMBIA1301S-IbPXC3-GFP containing the IbPXC3 gene. The homologous recombination system is as follows:

[0207] Table 12

[0208]

[0209] Mix gently, react at 50℃ for 60min, and place on ice after the reaction. The reaction product can be directly converted for sequencing and the plasmid can be extracted and stored. The method steps are the same as 3.1.2.5 to 3.1.2.7.

[0210] 3.1.6.2 Subcellular localization of IbPXC3 in tobacco

[0211] The pCAMBIA1301S-IbPXC3-GFP plasmid was transformed into Agrobacterium GV3101 using the heat shock method. The transformation method is as follows. Then, leaves of Nicotiana benthamiana about 1 month old were used for infection. The infection method is as follows. The tobacco was observed under a laser confocal microscope within 2-3 days after infection. The GFP field is 488nm, and the DAPI field is 358nm.

[0212] The specific conversion method is:

[0213] 1. Take the competent Agrobacterium stored at -80℃ and place it at room temperature or in the palm of your hand for a while until it partially melts. When it is in a state of ice-water mixing, insert it into ice.

[0214] 2. Add 0.01-1 μg plasmid DNA for every 100 μL of receptor (the transformation efficiency is relatively high, so it is best to do a preliminary experiment to determine the amount of plasmid to be added before the first use), stir the bottom of the tube by hand to mix, and place it on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0215] 3. Add 700 μL of LB liquid culture medium without antibiotics and culture at 28°C with shaking for 2 to 3 hours.

[0216] 4. Centrifuge at 6000rpm for 1min to collect the bacteria, take about 100μL of supernatant, gently blow and resuspend the bacteria, apply it on LB or YEB plates containing corresponding antibiotics, and invert it in a 28℃ incubator for 2-3 days. (When the plate contains only 50μg / mL kan, 48h of 28℃ culture is sufficient; when 50μg / mL kan and 20μg / mL rif are added to the plate at the same time, 60h of 28℃ culture is required; if the plate used contains 50μg / mL rif, 72-90h of 28℃ culture is required).

[0217] The specific methods of infection are:

[0218] 1. Pick a single clone and place it in 3 ml of liquid LB (with the corresponding antibiotic) at 28°C, 200 rpm, and culture for about 2 days.

[0219] 2. Collect bacterial liquid, centrifuge, resuspend, and inject tobacco

[0220] (1) Take 2 mL of bacterial solution, spin at 4000 rpm for 5 min, remove the supernatant, add 1 mL of resuspension solution (MgCl2.6H2O, 2.033 g / L; MES, 2.132 g / L), and vortex;

[0221] (2) Measure OD600 and adjust the bacterial solution OD600 to 0.4 (0.1-0.8 as needed, not more than 1) with resuspension solution, and let stand at room temperature for 1 to 3 hours;

[0222] (3) Mark the leaves with numbers and use a 1 ml syringe to inject the bacterial solution into the tobacco leaves from the back of the leaves using pressure. Then spray the leaves with water, put them in a fresh-keeping bag, and leave them in the dark overnight.

[0223] (4) The fresh-keeping bag was opened the next day. The expression level was highest 3 days after injection.

[0224] (5) Observation under laser confocal microscope.

[0225] The results are as follows Fig.10 As shown, the IbPXC3 fusion protein was expressed in the nucleus, cytoplasm and cell membrane without specific localization.

[0226] 3.1.7. Expression analysis of IbPXC3 gene in sweet potato underground stems at different stages after root rot induction

[0227] Plant Jishuzi 203 and Jishuzi 563 in the root rot disease nursery, take underground stems at 0h, 36h, 72h, 120h and 240h, take 3 plants from each part at each time point, extract RNA respectively, and synthesize the first strand of cDNA with reference to the Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR reverse transcription kit (AU341) of TRANS company. The specific method is the same as 3.1.6. The reverse transcribed cDNA is used as the template of qPCR to analyze the expression of IbPXC3 gene at different stages after root rot induction in different materials. The system and procedure of qPCR are the same as 3.1.6.

[0228] The results are as follows Fig.11 As shown, the expression level of IbPXC3 gene in the root rot-resistant variety Jishuzi 203 was higher than that in the root rot-susceptible variety Jishuzi 563. The expression of IbPXC3 in Jishuzi 203 showed a trend of first increasing and then decreasing, reaching a peak expression level (19.42 times) at 72h.

[0229] 3.1.8 Obtaining transgenic sweet potato plants overexpressing the IbPXC3 gene

[0230] 3.1.8.1 Construction of pCAMBIA1301S-IbPXC3 overexpression vector

[0231] Specific primers IbPCK3-Xba1-F: GAGAACACGGGGGACTCTAGAATGGGTAGACTCTATGATATGATTCACA and IbPCK3-Kpn1-R: CGATTTCGAACCCGGGGTACCTTACTTAGCCAAATCAAGCAGCA containing XbaⅠ and KpnⅠ restriction sites were designed at both ends of the CDS sequence of the IbPXC3 gene. The plasmid saved in 3.1.2.7 was used as a template for amplification. The amplification system is as follows:

[0232] Table 13

[0233]

[0234] Amplification Procedure:

[0235]

[0236] The PCR product was detected by 1.0% agarose gel electrophoresis, and then the target fragment was recovered and purified as in 3.1.2.4.

[0237] Extract the plasmid of the overexpression vector pCAMBIA1301S in the same way as in 3.1.2.7. The plasmid concentration reaches above 200 ng / μL. Linearize the pCAMBIA1301S plasmid with XbaI and KpnI. The enzyme digestion system is as follows:

[0238] Table 14

[0239]

[0240] React at 37°C for 2h.

[0241] After the restriction digestion reaction is completed, the linearized vector is purified using Vazyme's VAHTSDNAClean Beads kit. The specific steps are as follows:

[0242] 1. Take out the magnetic bead solution from 2-8℃ 30min in advance and let it stand to balance to room temperature.

[0243] 2. Invert or vortex to mix the magnetic bead solution thoroughly, pipette half the volume of the sample magnetic bead solution and add it to the DNA sample, use a pipette to gently pipette 10 times to mix thoroughly.

[0244] 3. Incubate at room temperature for 10 minutes to allow the DNA to bind to the magnetic beads.

[0245] 4. Place the sample on a magnetic rack, wait for the solution to become clear (approximately 5 minutes), and carefully remove the supernatant.

[0246] 5. Keep the sample on the magnetic stand, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant.

[0247] 6. Repeat step 5 once, rinsing twice in total.

[0248] 7. Keep the sample on the magnetic rack at all times and open the lid to dry the magnetic beads at room temperature for about 5-10 minutes.

[0249] 8. Remove the sample from the magnetic rack, add an appropriate amount of nuclease-free water, vortex or use a pipette to mix thoroughly, and let it stand at room temperature for 2 minutes. Let it stand on the magnetic rack for 5 minutes until the solution is clear, and carefully pipette the supernatant into a new nuclease-free centrifuge tube.

[0250] The pCAMBIA1301S vector purified by GenStar's EZ-HiFi Seamless Cloning Kit was ligated to the CDS sequence of the IbPXC3 gene containing XbaⅠ and KpnⅠ restriction sites. The specific steps are shown in 3.1.7.1. 3.1.8.2 Agrobacterium preparation

[0251] First, the pCAMBIA1301S plasmid was transferred into the competent cell of Agrobacterium rhizogenes K599 by freeze-thaw method to obtain Agrobacterium rhizogenes K599 / pCAMBIA1301S. The specific process is as follows:

[0252] (1) Thaw the competent Agrobacterium rhizogenes K599 in ice;

[0253] (2) Add 2 μg of pCAMBIA1301S plasmid to the competent Agrobacterium rhizogenes K599 thawed in step (1), mix gently, and place on ice for 5 min;

[0254] (3) After the standing in step (2), the competent Agrobacterium rhizogenes K599 was placed in liquid nitrogen for quick freezing for 5 minutes;

[0255] (4) placing the competent Agrobacterium rhizogenes K599 after quick freezing in step (3) at 37° C. for 5 min;

[0256] (5) After the standing in step (4), the competent Agrobacterium rhizogenes K599 was placed in ice and allowed to stand for another 5 minutes;

[0257] (6) Add 600 μL of LB liquid medium to the competent Agrobacterium rhizogenes K599 after standing in step (5), and shake the bacteria in a shaker at 28° C. for 2-3 h;

[0258] (7) Collect the cells by centrifugation at 6000 rpm for 1 min, keep about 100 μL of supernatant, gently blow to resuspend the cells, and spread them on the screening medium. The screening medium is LB solid medium containing streptomycin (50 μg / mL) and kanamycin (50 μg / mL).

[0259] (8) The culture medium was inverted and cultured in the dark at 28°C for 2-3 days. The resulting Agrobacterium rhizogenes monoclonal strain was named K599 / pCAMBIA1301S.

[0260] 3.1.8.3 Agrobacterium infection of plants

[0261] (1) A single clone of Agrobacterium rhizogenes K599 / pCAMBIA1301S was selected and placed in LB liquid culture medium containing streptomycin (50 μg / mL) and kanamycin (50 μg / mL), and the culture was shaken at 28°C until the OD value was between 0.8 and 1.0, thereby obtaining a bacterial solution of Agrobacterium rhizogenes K599 / pCAMBIA1301S.

[0262] (2) Select a sweet potato stem segment that is in good condition, fresh and healthy, and contains the stem tip and 5-7 side branches below it. Use a blade to remove the side branches below the stem segment and form a wound, leaving only the top 1-2 side branches and leaves. The wound should not be too large during the operation, and the side branches can be removed;

[0263] (3) Use a 1 mL syringe needle (0.33 mm in diameter) to make holes around the entire node after the side branch is removed in step (2) and within 1 cm above and below the node to create wounds. Make 6 to 8 holes at each node. Too many holes will be detrimental to the subsequent growth of lateral roots from the root primordium.

[0264] (4) Place the treated sweet potato stem segments in the K599 / pCAMBIA1301S obtained in step (1), ensuring that the wound is completely immersed in the bacterial solution, and culture for more than 8 hours, overnight.

[0265] (5) Plant the sweet potato stem segments overnight on the ridges, burying only the stem segments soaked in the bacterial solution in the soil until tubers are formed. The infected stem segments are grown in the field, and transgenic tubers can be harvested after 80 days.

[0266] 3.1.8.4 Positive plant screening

[0267] The transgenic potato seedlings were grown and the DNA of each potato seedling was extracted. PCR amplification was performed using the hygromycin gene primers Hpt-F: GACCTATTGCATCTCCCGCC and Hpt-R: GAATCCCCGAACATCGCCTC on the pCAMBIA1301S plasmid and the specific primers IbPCK3-OF: AGAAATTCTTGACAGCCGAGTG and JD-13sFlag-R: GATAATCATCGCAAGACCGG containing partial sequences and partial vector fragments to screen positive plants.

[0268] The amplification system (Table 15) and amplification procedure are as follows

[0269] Table 15

[0270]

[0271] Amplification Procedure:

[0272]

[0273] The PCR products were detected by 1.0% agarose gel electrophoresis.

[0274] The results of the test are as follows Fig.12 As shown; 1-9 are the detection results of Hpt-F and Hpt-R primers, 10-18 are the detection results of IbPCK3-OF and JD-13sFlag-R, indicating that 4 IbPXC3 gene overexpression plants were obtained.

[0275] 3.1.9 Obtaining transgenic sweet potato plants expressing IbPXC3 gene

[0276] 3.1.9.1 Construction of IbPXC3 interference expression vector

[0277] The FS-intron-RS-pFGC5941 vector was constructed by double restriction enzyme ligation. FS and RS are complementary sequences, forming a neck loop structure, which can block gene expression, thereby achieving the purpose of interfering with gene expression. The specific process is as follows:

[0278] (1) Amplify the target gene FS sequence. Design the forward primer sequence IbPCK3-Ri-1F with BamHI restriction site: TTACAATTACAATTAGGATCCATGGGTAGACTCTATGATATGATTCACAACAA and the reverse primer sequence IbPCK3-Ri-1R connected to the vector: AAATTCTTACACTAAAATTCAACACTTTCAACCCACTCAT to amplify the IbPXC3 gene FS sequence. The amplification system (Table 16) and amplification procedure are as follows:

[0279] Table 16

[0280]

[0281] Amplification Procedure:

[0282]

[0283] The PCR products were detected by 1.0% agarose gel electrophoresis. The FS sequences were recovered, connected, transformed and sequenced in the same manner as 3.1.2.4 to 3.1.2.7.

[0284] (2) Amplify the target gene RS sequence. Design the forward primer sequence IbPCK3-Ri-3F connected to the FS-pFGC5941 vector: CAATTTGCAGACTAAAATTCAACACTTTCAACCCACTCAT and the reverse primer sequence IbPCK3-Ri-3R carrying the KpnI restriction site: AGATCTGGTCGACGGCGCTGGTACCATGGGTAGACTCTATGATATGATTCACAACAA to amplify the RS sequence of the IbPXC3 gene partial sequence. The amplification system, amplification conditions, RS sequence recovery, ligation, transformation and sequencing were the same as (1).

[0285] (3) Amplify the intron sequence connected to FS and RS, use Ri-PRI (Escherichia coli) as template, design primers IbPCK3-Ri-2F: GAATTTTAGTGTAAGAATTTCTTATGTTACATTATTACATTCAACGTTTTATCTTAAT and IbPCK3-Ri-2R: GAAATTTTAGTCTGCAAATTGACCAAAAAAGATGTGAAGAAAAC. The amplification system, amplification conditions, intron sequence recovery, ligation, transformation and sequencing were the same as (1).

[0286] (4) Linearization of pFGC5941 vector:

[0287] Extract the plasmid of pFGC5941 as in 3.1.2.7, and make the concentration reach above 200ng / μL. Linearize the plasmid of pFGC5941 with BamH I and KpnI. The system is as follows:

[0288] Table 17

[0289]

[0290] React at 37°C for 2h.

[0291] After the restriction digestion reaction is completed, the linearized vector is purified using the VAHTSDNAClean Beads kit from Vazyme, as in 3.1.8.1. The linearized pFGC5941, FS, RS and intron are connected using 2×Multif Seamless Assembly mix from ABclonal. The specific system is as follows:

[0292] Table 18

[0293]

[0294] Mix gently and react at 50°C for 60 min.

[0295] 3.1.9.2 Preparation of Agrobacterium

[0296] The FS-intron-RS-pFGC5941 vector plasmid was transferred into Agrobacterium rhizogenes K599 by freeze-thaw method to obtain Agrobacterium rhizogenes K599 / FS-intron-RS-pFGC5941. For the specific process, refer to 3.1.8.2.

[0297] Colony PCR detection primers:

[0298] pCRD-infu-F:AGGACACGCTCGAGTATAAGAGC

[0299] pFGC5941-M1R:GTCCTCCCTCTCTTCTACC

[0300] pFGC5941-M2F:TTACTTACACTTGCCTTGGAG

[0301] pCRD-infu-R:GGACTCTAGGGACTAGTCCCG

[0302] The amplification system and procedure are the same as 3.1.9.1.

[0303] 3.1.9.3 Agrobacterium infection of plants

[0304] The specific process is the same as 3.1.8.3.

[0305] 3.1.9.4 Positive plant screening

[0306] The specific process is the same as 3.1.9.2.

[0307] Fig.13 The upper row shows the results of primer testing of pCRD-infu-F and pFGC5941-M1R. Fig.13 The lower row shows the detection results of pFGC5941-M2F and pCRD-infu-R, indicating that 10 plants with interference expression of the IbPXC3 gene were obtained.

[0308] Example 4 Ib Verification of PXC3 gene function

[0309] The positive sweet potato plants with positive overexpression and interference expression of IbPXC3 gene and wild-type plants were propagated in a greenhouse. The transgenic plants were planted in the natural induced disease identification nursery in early June. The ridge width was 90 cm and the plant spacing was 25 cm. Samples were taken at 40 days and 80 days to investigate the incidence of root rot. The specific investigation steps are as follows:

[0310] 40 days after planting, investigate the aboveground disease situation, grade it according to the grading standard, and calculate the aboveground disease index. Harvest in late October and investigate the underground disease situation according to the grading standard. Calculate the underground disease index. Determine the variety resistance based on the average of the aboveground and underground disease indexes.

[0311] Above ground classification standards:

[0312] Level 0: No symptoms can be seen;

[0313] Level 1: The leaves are slightly yellow, and everything else is normal;

[0314] Level 2: Few and short branches, leaves are significantly yellow, and some varieties have buds or flowers;

[0315] Level 3: Plant growth stagnation, significant dwarfing, no branches, and old leaves falling from bottom to top;

[0316] Level 4: The whole plant dies.

[0317] The disease grade of potato tubers is determined according to the following standards:

[0318] Level 0: The tubers are normal and have no symptoms

[0319] Level 1: Some roots turn black (the number of diseased roots accounts for less than 10% of the total number of roots), there are no lesions on the underground stems, and there is no obvious effect on tuber formation.

[0320] Level 2: A small number of roots turn black (the number of diseased roots accounts for 10-25% of the total number of roots), and underground stems and tubers have individual spots, which has a slight impact on tuber formation.

[0321] Level 3: Nearly half of the roots turn black (the number of diseased roots accounts for 25.1-50.0% of the total number of roots), there are many spots on the underground stems and tubers, which has a significant impact on tuber formation, and there are firewood roots.

[0322] Level 4: Most roots turn black (the number of diseased roots accounts for more than 50% of the total number of roots), the underground stems have many large lesions, no tubers are formed, and even death may occur.

[0323] The disease index was calculated according to the following formula.

[0324]

[0325] The unit of disease index is %, determined to 0.1%.

[0326] Determining the resistance of sweet potato root rot germplasm based on the disease index.

[0327] High resistance (disease index ≤ 20)

[0328] Disease resistance (20<disease index≤40)

[0329] Medium resistance (40<disease index≤60)

[0330] Infectious disease (60<sickness index≤80)

[0331] High infection (80<sickness index)

[0332] The results are shown in Table 19 and Fig.14 The disease index of wild-type sweet potato plants was 53.8, which were moderately resistant to root rot; the disease index of positive sweet potato plants overexpressing the IbPXC3 gene was 31.3, which were resistant to root rot, and the resistance of positive sweet potato plants overexpressing the IbPXC3 gene was significantly higher than that of wild-type sweet potato plants; the disease index of positive sweet potato plants with interfered expression of the IbPXC3 gene was 85.0, which were susceptible to root rot, and the resistance of positive sweet potato plants with interfered expression of the IbPXC3 gene was significantly lower than that of wild-type sweet potato plants.

[0333] The results showed that IbPXC3 has the function of improving the resistance of sweet potato to root rot.

[0334] Table 19 Root rot resistance survey

[0335]

[0336] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A sweet potato root rot resistance gene IbPXC3, characterized in that: The nucleotide sequence of the sweet potato root rot resistance gene IbPXC3 is shown in SEQ ID NO:

1.

2. A protein encoded by the sweet potato root rot resistance gene IbPXC3, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO:

2.

3. An overexpression vector pCAMBIA1301S-IbPXC3 comprising the gene IbPXC3 according to claim 1.

4. The overexpression vector of gene IbPXC3 according to claim 3, characterized in that: The overexpression vector of the gene IbPXC3 is constructed by the gene IbPXC3 according to claim 1.

5. The overexpression vector of gene IbPXC3 according to claim 4, characterized in that: The overexpression vector of the gene IbPXC3 comprises the following construction steps: S1. Amplify the target gene IbPXC3 containing restriction sites XbaⅠ and KpnⅠ at both ends of the ORF shown in SEQ ID NO.1 by PCR; S2, linearize the pCAMBIA1301SS plasmid using XbaI and KpnI; S3. The target gene IbPXC3 containing restriction sites of XbaⅠ and KpnⅠ was connected to the linearized pCAMBIA1301S plasmid to obtain the recombinant product, and then transformed and sequenced in Escherichia coli competent cells to obtain the overexpression vector pCAMBIA1301S-IbPXC3 of the gene IbPXC3.

6. The overexpression vector of gene IbPXC3 according to claim 4, characterized in that: The competent E. coli cells in S3 are DH5α.

7. Use of the gene IbPXC3 according to claim 1, the protein according to claim 2, and the overexpression vector of the gene IbPXC3 according to claims 3 to 6 in resistance to sweet potato root rot.

8. The use according to claim 7, characterized in that: The application is to cultivate sweet potatoes resistant to root rot or to prepare products of cultivating sweet potatoes resistant to root rot.

9. A method for cultivating sweet potatoes resistant to root rot, characterized in that: The method comprises the steps of introducing the sweet potato root rot resistance gene IbPXC3 according to claim 1 into a recipient sweet potato to obtain a root rot resistance sweet potato.

Images