Construction method and application of Mid1 gene editing mouse and cell model

Abstract

The invention discloses a construction method of a mouse model with liver specificity Mid1 gene knockout, a construction method of a mouse model with Mid1 gene knockout, a construction method of a Mid1 gene editing cell model, and applications thereof. Mid1 knock-down mice and cell strains are constructed, it is found for the first time that a knock-down hepatocyte line Mid1 can relieve damage after cell infection and promote bacterial death, then mass spectrum is used for identifying interaction protein of WT mouse cecum ligation perforation model hepatocyte Mid1, it is found that HRG and Mid1 interact, and it is proved through further experiments that HRG is a substrate for degradation of Mid1. The invention provides an effective animal model and cell model for studying sepsis hepatocyte response and hepatocyte infection response mechanisms and studying the degradation effect of the ubiquitin ligase Mid1 on the hepatocyte secreted protein HRG.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a method for constructing a Mid1 gene-edited mouse and cell model and uses thereof. Background Art

[0002] Sepsis is defined as a disordered host response to infection, which leads to life-threatening organ dysfunction. The disease is severe, and the incidence and mortality rates remain high. In my country, the incidence of ICU sepsis is as high as 20.6%, and the 90-day mortality rate of patients is as high as 35.5%. Due to the lack of specific treatment methods, sepsis has become the main bottleneck hindering the successful treatment of critically ill patients. Although the international guidelines for the treatment of sepsis and septic shock were revised three times in 2008, 2012 and 2016, the recommended treatment measures are still resuscitation and organ support, early application of antibiotics, and control of infection foci as the main means. The strategy of antagonizing inflammatory mediators that began in the 1990s cannot effectively treat sepsis. The measures to enhance the body's immune response reported in recent years have not been included in the sepsis treatment guidelines due to the lack of large-scale RCT research evidence. The once popular anticoagulant drug, activated protein C, was forced to withdraw from the market because it increased the risk of bleeding in patients with sepsis. Faced with the severe situation of lack of specific drugs for the treatment of sepsis in clinical practice, many scholars are actively committed to developing new treatment strategies.

[0003] The liver is known as the human body's factory, providing the body with a large number of proteins that ensure normal physiological activities. Histidine-rich glycoprotein (HRG) is a serum protein secreted by liver cells. Its content in human serum is quite high (100-150μg / mL). It is known as the "Swiss Army Knife" of serum proteins. Its functions are reflected in anti-cancer, regulating angiogenesis, anti-thrombosis and many other aspects. In recent years, its role in anti-infection response and homeostasis maintenance in sepsis has attracted much attention. It is reported that in sepsis, HRG can act as a pattern recognition molecule to promote the phagocytic function of macrophages; it can maintain the quiescent state of neutrophils, inhibit the activation of IL8-MAPK and NF-κB pathways and the production of ROS, reduce neutrophil infiltration and the formation of NETs, ​​and thus avoid the inflammatory factor storm; HRG can competitively inhibit the formation of insoluble immune complexes (IICs), avoiding tissue damage and inflammation caused by IIC deposition; it can interact with a variety of coagulation factors and heparin to reduce microvascular immune thrombosis and reduce the risk of DIC; in addition, HRG can neutralize bacterial lipopolysaccharide (LPS), block the inflammatory cascade, and inhibit LPS- and TNF-α-induced endothelial cell death; in-depth studies have found that HRG can also directly destroy bacterial cell walls to exert antibacterial activity. In short, the comprehensive performance of HRG makes it possible to open the door to specific treatment of sepsis.

[0004] However, precisely because HRG is rich in functions, it will face a large amount of consumption during sepsis. In addition to transcriptional downregulation, ubiquitination degradation, etc., the serum HRG content will drop sharply (10-20μg / mL). Although animal experiments have confirmed that exogenous supplementation of HRG (20mg / kg) can effectively cope with HRG consumption during sepsis and significantly improve the survival rate of model mice. However, the current methods for obtaining HRG protein are either purification from human or animal serum (raw materials are difficult to obtain) or production of recombinant HRG protein (low yield, high cost, tens of thousands of yuan per microgram), both of which are difficult to apply in clinical practice.

[0005] Fortunately, the "exogenous supplementation program" is not the only way to increase the serum content of HRG. The production, protein modification and secretion regulation of HRG in hepatocytes also have a huge impact on its serum content. Among them, ubiquitination modification will cause HRG to be degraded in hepatocytes and cannot be secreted into the serum. Therefore, studying the ubiquitination degradation mechanism of HRG is of great significance to achieve the clinical application of HRG and then achieve specific treatment of sepsis. However, no one has reported a ubiquitin ligase that can specifically degrade HRG.

[0006] Mid1, also known as Trim18, belongs to the TRIM family and is an E3 ubiquitin ligase. Studies have found that Mid1 can aggravate infection and inflammation by promoting the degradation of its substrate protein phosphatase 2Ac (PP2Ac) in asthma (bronchial epithelial cells), esophagitis (esophageal epithelium), and septic lung injury (post-capillary venule endothelial cells); Mid1 also mediates the ubiquitination degradation of interferon regulatory factor 3 (IRF3), limiting the production of IFN-I and cellular antiviral response; in the multiple sclerosis model, Mid1 promotes the migration of effector T cells to the central nervous system by upregulating the mTOR / microtubule pathway, aggravating severe damage. In short, Mid1 is upregulated in a variety of inflammatory processes and plays a negative role. It is significantly upregulated in septic hepatocytes, but it is not yet known what effect it plays, and an animal model that can be used for this study is urgently needed. Summary of the invention

[0007] The purpose of the present invention is to address the above-mentioned problems and provide a method for constructing a Mid1 gene-edited mouse and cell model and uses thereof.

[0008] In order to achieve its purpose, the present invention adopts the following technical solution:

[0009] The first aspect of the present invention provides a method for constructing a liver-specific Mid1 gene knockdown mouse model, comprising the following steps:

[0010] S1. Construction of adeno-associated virus AAV-shMid1:

[0011] The sequence of the shRNA that specifically knocks down the Mid1 gene is:

[0012] GACCGATGACCAGTTAATCTGTGTTTTTT;

[0013] Inserting the shRNA into a backbone plasmid adeno-associated virus vector cut with NheI and HindIII to obtain a recombinant plasmid;

[0014] The recombinant plasmid and the adeno-associated virus packaging plasmid are co-transfected into embryonic kidney cells transformed with adenovirus, and the cells are lysed to release AAV particles, thereby obtaining the recombinant adeno-associated virus AAV-shMid1;

[0015] S2. Construction of liver-specific Mid1 knockout mice

[0016] AAV-shMid1 was diluted to the injection titer, and mice were injected intravenously and fed normally to obtain Mid1. hep-KD Liver-specific knockout mice.

[0017] The embryonic kidney cells transformed by the adenovirus are AAV-293 cells;

[0018] The backbone plasmid is pAAV-ApoE / hAATp-EGFP-MCS-SV40 PolyA;

[0019] The adeno-associated virus packaging plasmids are the plasmid pHelper carrying adenovirus-derived genes and pAAV-RC carrying AAV replication and capsid genes;

[0020] The AAV is AAV8.

[0021] The second aspect of the present invention provides a method for constructing a Mid1 gene knockout mouse model, comprising the following steps:

[0022] (1) Using the CRISPR-Cas9 gene editing method to obtain F0 generation mice: preparing a gene editing solution, the gene editing solution containing Cas9 and two gRNAs targeting the mouse Mid1 gene: gRNA-A1 and gRNA-A2; electro-transfecting the gene editing solution into mouse fertilized eggs, and transplanting the surviving fertilized eggs after electro-transfection into pseudo-pregnant female mice to produce F0 generation mice; the gRNA sequence is as follows:

[0023] gRNA-A1: CATTTCAGACACCAGAGCCGCGG;

[0024] gRNA-A2: CTTATCATAGCTAAGGCTGAAGG;

[0025] (2) The chimeric male mice in the F0 generation were mated with wild-type mice to obtain F1 generation Mid1(+ / -) heterozygous offspring;

[0026] (3) F1 generation Mid1(+ / -) heterozygous mice were mated with each other to produce F2 generation Mid1(- / -) homozygous mice, which is the Mid1 gene knockout mouse model.

[0027] In the above-mentioned method for constructing a Mid1 gene knockout mouse model, the molar ratio of Cas9 to the gRNA mixture in the gene editing solution is 3:2, and the gRNA mixture is obtained by mixing gRNA-A1 and gRNA-A2 in a molar ratio of 1:1.

[0028] In the method for constructing the mouse model of Mid1 gene knockout, the identification of F0 and F1 generation mice is performed by genotype PCR, and the primer pair F1 / R1 is used for PCR identification. If the PCR band is a 554 bp fragment, it means that the targeting is successful; the F1 / R1 primer sequence is as follows:

[0029] F1:5'-AGACAGATTAACCAGGCATCCTC-3';

[0030] R1:5'-TCCTGTCACCAGTTAGTTTTACTTG-3'.

[0031] In the method for constructing the mouse model of Mid1 gene knockout, the identification of F2 generation mice is performed by genotype PCR identification, and the primer pairs F1 / R1 and F2 / R1 are used for PCR identification. A 554 bp PCR amplification product band is detected for Mid1 (- / -) homozygotes, a 554 bp band, a 679 bp band and a 1800 bp band are detected for Mid1 (+ / -) heterozygotes, and a 679 bp band is detected for negative mice in which the target gene is not knocked out. The sequence of the primer pair is as follows:

[0032] F1:5'-AGACAGATTAACCAGGCATCCTC-3';

[0033] R1:5'-TCCTGTCACCAGTTAGTTTTACTTG-3';

[0034] F2: 5'-CAAACTGTAAACAGTGCCTTGAGAG-3'.

[0035] The third aspect of the present invention provides a method for constructing a Mid1 gene-edited cell model, wherein the Mid1 gene-edited cell model is a Mid1 gene-knockdown liver cell model or a Mid1 gene-overexpressing liver cell model.

[0036] The method for constructing the Mid1 gene overexpression hepatocyte model comprises the following steps: performing double restriction digestion on the DNA sequence of the Mid1 gene and the blank expression plasmid respectively, and then connecting them to obtain a Mid1 overexpression recombinant lentiviral vector, and then transforming Escherichia coli competent cells, extracting plasmids from positive clones, and obtaining a large number of Mid1 overexpression recombinant lentiviral vectors; mixing the Mid1 overexpression recombinant lentiviral vector and the virus packaging plasmid to co-transfect competent cells, culturing, and centrifuging the cell culture fluid to obtain the overexpression recombinant lentivirus; transfecting the overexpression recombinant lentivirus into a hepatocyte cell line, screening and identifying to obtain a Mid1 overexpression cell strain, and thus obtaining a Mid1 gene overexpression hepatocyte model;

[0037] The method for constructing the Mid1 gene knockdown hepatocyte model comprises the following steps: inserting the shRNA sequence of the Mid1 gene into a double-enzyme-cut backbone plasmid to obtain a recombinant plasmid; taking the recombinant plasmid and the virus packaging plasmid to co-transfect competent cells, culturing, and centrifuging the cell culture fluid to obtain a knockdown recombinant lentivirus; transfecting the knockdown recombinant lentivirus into a hepatocyte cell line, screening and identifying to obtain a Mid1 knockdown cell line, and thus obtaining a Mid1 gene knockdown hepatocyte model; the sequence of the shRNA is: GACCGATGACCAGTTAATCTGTGTTTTTT.

[0038] The method for constructing the above-mentioned Mid1 gene-edited cell model, wherein the Mid1 gene DNA sequence is shown in SEQ ID NO.9;

[0039] The co-transfected competent cells are 293T cells; the hepatocyte cell line is AML12 cell line.

[0040] The packaging plasmids are psPAX2 and pMD2G;

[0041] The blank expression plasmid is pIRES2-EF1a-EGFP-P3-Puro-CMV-MCS-WPRE, and the restriction endonucleases used for double enzyme digestion are NotI and BamHI;

[0042] The backbone plasmid is pLV3-LTR-eCMV-ZsGreen1-PGK-Puro-U6, and the restriction endonucleases used for double enzyme digestion are Bam HI and EcoR I.

[0043] The fourth aspect of the present invention provides a Mid1 gene-edited cell model, which is constructed by the above-mentioned method for constructing a Mid1 gene-edited cell model.

[0044] The fifth aspect of the present invention provides the use of the liver-specific Mid1 gene knockdown mouse model constructed by the above method, the Mid1 gene knockout mouse model constructed by the above method, or the above cell model in any of the following:

[0045] (1) Application in studying the interaction between liver ubiquitin ligase and liver secretory protein, preferably in studying the effect of ubiquitin ligase Mid1 on the degradation of liver cell secretory protein HRG;

[0046] (2) Application in studying hepatocyte responses to sepsis;

[0047] (3) Application of Mid1 in studying the mechanism of action of other infectious problems besides sepsis.

[0048] The beneficial effects of the present invention are:

[0049] Based on the urgent problems to be solved in the treatment of sepsis, the present invention constructed Mid1 knockout mice and cell lines, and found for the first time that knocking down Mid1 in the liver cell line can reduce damage after cell infection and promote bacterial death. Then, mass spectrometry was used to identify the interacting proteins of Mid1 in the liver cells of the WT mouse cecal ligation and puncture model, and it was found that HRG interacted with Mid1, and further experiments proved that HRG is a substrate for Mid1 degradation (currently, there has been no report on ubiquitination regulation of HRG). The expression of Mid1 in the obtained mouse model was downregulated, while the expression of HRG was increased. The Mid1 gene knockout cell model obtained showed downregulated Mid1 expression and increased HRG expression; the Mid1 gene overexpression cell model showed upregulated Mid1 expression and decreased HRG expression.

[0050] The present invention discovered for the first time that the Mid-HRG signaling axis mediates hepatocyte and systemic infection responses. Knockdown of Mid1 effectively increased the HRG content in the serum of septic mice, and improved organ function, reduced organ bacterial load, and increased survival rate. This suggests that "inhibiting the ubiquitination degradation of hepatocyte HRG by Mid1" is a scheme to increase serum HRG that can replace "exogenous HRG supplementation", providing a potential measure for the specific treatment of sepsis.

[0051] The model of the present invention is mainly used to study the response of hepatocytes (parenchymal cells) to sepsis. Hepatocytes are an important cell type involved in innate immunity. The latest view is that the host's anti-infection response to pathogens, in addition to "resistance" (driven by the immune response, with the purpose of killing and removing pathogens), can also maintain the body's homeostasis through a "tolerance" mechanism (with the purpose of slowing down the pathological damage to the host caused by pathogens and / or immune responses). Among them, metabolic adaptation dominated by hepatocytes plays an important role and is closely related to the prognosis of sepsis. However, compared with the depth and breadth of research on the infection response mechanism of immune cells, the understanding of the infection response mechanism of hepatocytes is far from enough. The present invention helps to fill the research gap in related fields and provide corresponding animal and cell research models. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 This is the plasmid map of the vector pIRES2-EF1a-EGFP-P3-Puro-CMV-MCS-WPRE.

[0053] Figure 2 Fluorescence imaging shows the infection efficiency of Mid1 liver-specific knockdown adeno-associated virus in different organs of mice.

[0054] Figure 3 This is the result of PCR amplification and identification of the Mid1 knockout mouse genotype.

[0055] Figure 4 Shown are: Fluorescence imaging showing the efficiency of lentiviral transfection (A) and qPCR showing successful knockdown and overexpression of Mid1 in AML12 cells (B).

[0056] Figure 5 Escherichia coli (E.coli) and methicillin-resistant Staphylococcus aureus (MRSA) infection AML12 shMID1 and AML12 MID1 The cell supernatant was plated 12 hours later.

[0057] Figure 6 It is the observation of bacteria and infected liver cells under a microscope.

[0058] Figure 7 Mid1 was shown after cecal ligation and puncture hep-KD Survival of mice.

[0059] Figure 8 It is Mid1 hep-KD HE staining of liver tissue sections of mice 12 hours after intraperitoneal infection with Escherichia coli.

[0060] Fig. 9 Showing Mid1 hep-KD Changes in liver function after infection in mice.

[0061] Fig.10 Shown are: A. CHX and MG132 experiments: intracellular content of HRG after treatment for 0, 2, 4, 8, and 12 hours; B. immunoprecipitation of toxin molecules and HRG under MG132 intervention.

[0062] Fig.11 Displayed: A.Mid1 hep-KD Serum HRG levels in mice after infection; B.Mid1 hep-KD Immunofluorescence colocalization of Mid1 and HRG in mouse liver. DETAILED DESCRIPTION

[0063] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0064] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0065] Example 1

[0066] 1. Materials and methods

[0067] 1.1 Materials

[0068] 1.1.1 Animals and cells

[0069] The Mid1+ / - mice used in this experiment were constructed by Cyagen. The background of all mice used was C57BL / 6J. After the mice were constructed, they were bred and tested in the SPF animal room of the Army Specialty Medical Center. AML12 cells were provided by Prosai.

[0070] 1.1.2 Reagents

[0071] 4% paraformaldehyde, antigen retrieval solution; RNA reverse transcription kit (Takara, Japan); qPCR reaction kit (Takara, Japan); PCR primers (Qingke, China); trypsin, CCK-8 kit (Biyuntian, China); DMEM culture medium, FBS fetal bovine serum (Hyclone, China), AML12 special culture medium (Punosai); streptomycin / penicillin (Bopei, China); ProteasePlus, 2XM-PCROPTITmMix (Bimake, USA); Mid1 primary antibody (rabbit source, Thermofisher, USA); HRG primary antibody (rabbit source, Abclonal, China); Ubiquitin primary antibody (rabbit source, Santa Cruz, USA), GAPDH primary antibody (rabbit source, CST, USA); immunofluorescence staining finished blocking solution (Biyuntian, China); ECL luminescent solution (Thermofisher, USA), Western Blot anti-mouse secondary antibody (CST, USA), Western Blot anti-rabbit secondary antibody (CST, USA); DyLight488 fluorescent secondary antibody, DyLight647 fluorescent secondary antibody (goat anti-rabbit, Thermofisher, USA); DAPI nuclear staining reagent, anti-fluorescence quencher (Biyuntian, China); peptone (Oxiod, UK), yeast extract (Oxiod, UK), sodium chloride (Sanggong, China), agar powder (Sanggong, China), trypan blue (Biyuntian, China).

[0072] 1.2 Experimental methods

[0073] 1.2.1 Construction of liver-specific Mid1 gene knockdown model

[0074] 1.2.1.1 Construction of AAV8-shMid1 adeno-associated virus vector

[0075] According to the mRNA sequence of mouse Mid1 gene in NCBI GenBank (NM_001290506.2) and the vector information used, a shRNA sequence specific to Mid1 gene (SEQ ID NO.1) was designed:

[0076] GACCGATGACCAGTTAATCTGTGTTTTTT.

[0077] The blank vector pAAV-ApoE / hAATp-EGFP-MCS-SV40 PolyA was digested with NheI and HindⅢ and then the shRNA target sequence was inserted. The synthesis of shRNA sequence, annealing of shRNA template, preparation of linearized expression vector, ligation of interference fragment into expression vector, preparation of competent cells for transformation and sequencing of ligation products, and plasmid extraction were all done by conventional methods and were entrusted to Shanghai Jima Biotechnology Co., Ltd.

[0078] 1.2.1.2 Virus packaging, purification and titer determination

[0079] AAV-293 cells were cultured using conventional methods. When the cells reached 80-90% fusion, virus transfection was performed. The recombinant expression plasmid was co-transfected into AAV-293 cells with pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes) (providing trans-acting factors required for AAV replication and packaging). After 2 to 3 days of transfection, the recombinant AAV was assembled in the packaging cells. AAV8-shMid1 expressing EGFP and Mid1-shRNA was obtained. The cells were collected and then lysed to release AAV particles into the supernatant. The viral supernatant was concentrated and purified. The virus titer was determined by quantitative PCR. The number of rAAV virus particles was determined by detecting the genome copy number of the rAAV vector in the viral genome, and the titer unit was expressed in vg / ml. The virus sample and the standard were diluted to different concentrations and quantitative PCR was performed. After the PCR was completed, a standard curve was drawn according to the standard to calculate the virus sample titer.

[0080] 1.2.1.3 Construction of liver-specific Mid1 knockout mice

[0081] AAV8-shMid1 was diluted to an appropriate titer (2E^11 v.g / mouse) with physiological saline, 100-200 μl of injection solution was drawn with a 1 ml syringe, and injected into the tail vein. After hemostasis, the mice were returned to the cage. The control group was injected with AAV8-NC. After normal feeding for 3 weeks, the target Mid1 was obtained. hep-KD Mouse.

[0082] 1.2.1.4 Identification of liver-specific Mid1 knockout mice

[0083] Fluorescence imaging: The main organs (heart, liver, spleen, lung, and kidney) of the mice were obtained after being killed, and fluorescence imaging (EGFP) was performed in a small animal in vivo imaging system at the same time as the control group.

[0084] qPCR: General steps.

[0085] Primer sequences:

[0086] Mid1F (SEQ ID NO.2): 5'-CCAGGTCCTAATTCCCGAAATCA-3';

[0087] Mid1R (SEQ ID NO. 3): 5'-GGGTTGGGAGCTGTTAGGTAATC-3'.

[0088] 1.2.2 Construction of Mid1 gene systemic knockout mice

[0089] 1.2.2.1 Construction of F0 and F1 generation mice

[0090] According to the design plan, the gRNA vector was designed and constructed, and the correctness of the vector sequence was verified by sequencing. The gRNA was transcribed in vitro and purified for later use. The CaS9 and gRNA samples were electroporated into the fertilized eggs of C57BL / 6J mice; the fertilized eggs that survived the electroporation were transplanted into pseudo-pregnant female mice to obtain F0 generation mice, and when they became pregnant and gave birth, the chimeric male mice obtained were mated with C57BL / 6J mice to obtain Mid1(+ / -) heterozygous offspring (F1).

[0091] gRNA target sequence:

[0092] gRNA-A1 (SEQ ID NO.4):CATTTCAGACACCAGAGCCGCGG;

[0093] gRNA-A2 (SEQ ID NO. 5): CTTATCATAGCTAAGGCTGAAGG.

[0094] (1) Preparation of gene editing fluid

[0095] Synthesize gRNA-A1 and gRNA-A2, prepare gRNA mixed solution with gRNA-A1 and gRNA-A2 in a molar ratio of 1:1; Spy Cas9NLS (NEB, M0646T) and gRNA mixture were mixed at a molar ratio of 3:2 and opti-MEM culture medium was added according to volume to prepare the gene editing solution.

[0096] (2) Preparation of fertilized eggs

[0097] Preparation of fertilized eggs: 3-4 week old C57BL / 6 female mice were selected and injected with pregnant mare serum (PMSG) and human chorionic gonadotropin (hCG) respectively, with an interval of 46-48 hours between the two. After the injection of HCG, the female mice were mated with adult fertile male mice to fertilize the female mice. The next day, the female mice were euthanized, and the fertilized eggs were collected from the oviducts and placed in a constant temperature of 37°C and 5% CO. 2 Keep in the incubator for later use;

[0098] (3) Electroporation of fertilized eggs

[0099] Turn on the electroporator, connect the positive and negative electrodes, set the electroporation parameters, and set aside; put the prepared fertilized eggs into the acid solution to weaken the zona pellucida for 10-20 seconds; at the same time, add the prepared gene editing solution to the electrode dish; wash the weakened fertilized eggs 3 times and transfer them to the electrode dish for electroporation; after electroporation, transfer the fertilized eggs to M16 culture medium and place them in a constant temperature of 37°C and 5% CO 2 Incubate in the incubator for 0.5-1h before transplanting; or culture until 2 cells and transplant the next day;

[0100] (4) Preparation of surrogate mice and embryo transplantation

[0101] Prepare pseudo-pregnant female mice: select fertile female mice of appropriate age and mate with male mice that have been sterilized after vasectomy to stimulate a series of pregnancy changes in the female mice to obtain pseudo-pregnant female mice, which will serve as surrogate mice after the genetically modified fertilized eggs; transplant the fertilized eggs that have been injected with foreign genes into the fallopian tubes of surrogate female mice on the day of thrombus formation; after the transplantation, place the surrogate female mice in a clean cage and keep them warm until they wake up and then return them to the cage for breeding; after a successful fallopian tube transplantation, the female mice will generally give birth 19-20 days after the operation; one week after the mice are born, their claws can be clipped and numbered, and PCR identification can be performed at the same time; three weeks after the mice are born, they can be raised independently in separate cages.

[0102] 1.2.2.2 Identification of F0 and F1 Generation Mice

[0103] After the mice were born for 5 days, 0.5 cm of the mouse tail was collected for genotyping. The PCR reaction system was: 1 μL of mouse tail genomic DNA, 1 μL of forward primer F1 (10 μM), 1 μL of reverse primer R1 (10 μM), 12.5 μL of Premix Taq Polymerase (Vazyme, P222), RNase-Free ddH 2 O 9.5 μL. Reaction conditions: 94℃ pre-denaturation for 3 min, followed by 35 cycles: 94℃ denaturation for 30 s, 60℃ annealing for 35 s, 72℃ extension for 35 s, and then 72℃ extension for 5 min after the cycle ends, and stored at 4℃.

[0104] The positive result of F1 / R1 amplification after deletion of the target gene and the acquisition of a 554 bp fragment indicated successful targeting.

[0105] Primer Information:

[0106] F1 (SEQ ID NO.6):5'-AGACAGATTAACCAGGCATCCTC-3';

[0107] R1 (SEQ ID NO. 7): 5'-TCCTGTCACCAGTTAGTTTTACTTG-3'.

[0108] Positive band: 554bp; wild type band: 1800bp.

[0109] It should be noted that because the Mid1 gene is located on the X chromosome, all positive male mice are hemizygous.

[0110] 1.2.2.3 Construction of F2 generation mice

[0111] Mid1(- / -) homozygous mice can be generated by selfing of Mid1(+ / -) heterozygous mice, and the genotypes were determined using the following primer sets F1 / R1 and F2 / R1.

[0112] F2 (SEQ ID NO. 8): 5'-CAAACTGTAAACAGTGCCTTGAGAG-3'.

[0113] Target gene not knocked out negative: 679bp;

[0114] (- / -) homozygous: 554 bp;

[0115] (+ / -) heterozygotes: 554 bp, 679 bp and 1800 bp;

[0116] (WT) Wild type: 679bp and 1800bp.

[0117] 1.2.3 Construction of Mid1 gene overexpression and Mid1 gene knockdown hepatocyte models

[0118] 1.2.3.1 Construction of Mid1 overexpression lentivirus

[0119] 1. Design and synthesis of Mid1 double-stranded DNA fragment

[0120] According to the mRNA sequence of mouse Mid1 gene in NCBI GenBank (NM_001290504.1), the protein coding region sequence is shown in SEQ ID NO.9, and Shanghai Jima Biotechnology Co., Ltd. was commissioned to synthesize the Mid1 DNA double-stranded fragment sequence shown in SEQ ID NO.9.

[0121] 2. Construction of Mid1 overexpression lentiviral vector

[0122] 1) Vector digestion and fragment ligation

[0123] Mid1 overexpression recombinant lentiviral vector was prepared by Shanghai Jima Biotechnology Co., Ltd.: 1 μl of Mid1 DNA double-stranded fragment sequence (1 μg / μl) as shown in SEQ ID NO.9, 4 μl 10*buffer, 33 μl ddH2O, 1 μl NotI, 1 μl BamHI reaction system was reacted in a 37°C water bath for 1-2 hours.

[0124] pIRES2-EF1a-EGFP-P3-Puro-CMV-MCS-WPRE (vector map as shown in Figure 1 The target fragment was recovered by agarose gel electrophoresis. The target fragment was ligated into the pIRES2-EF1a-EGFP-P3-Puro-CMV-MCS-WPRE vector after restriction digestion by one-step cloning using HB infusionTM (seamless cloning kit) to obtain the Mid1 overexpression recombinant lentiviral vector PIRES2-EF1a-EGFP-P3-Puro-CMV-Mid1-WPRE.

[0125] 2) The viral vector assembled in step 1 was transformed into E. coli Stbl3 competent cells; the transformants were screened by colony PCR, and the positive clones were sent for sequencing, and the positive clones were determined by sequence comparison; a large number of recombinant lentiviral vector PIRES2-EF1a-EGFP-P3-Puro-CMV-Mid1 plasmids and control PIRES2-EF1a-EGFP-P3-Puro-CMV-MCS-WPRE plasmids were prepared by amplifying the bacterial solution and extracting with a plasmid extraction kit;

[0126] 3) Preparation of virus concentrate

[0127] The Mid1 overexpression recombinant lentiviral vector PIRES2-EF1a-EGFP-P3-Puro-CMV-Mid1-WPRE plasmid / empty vector plasmid PIRES2-EF1a-EGFP-P3-Puro-CMV-MCS-WPRE was added to 1 mL of DMEM medium with the virus packaging auxiliary plasmids psPAX2 and pMD2G at a ratio of 4:3:1 (6 μg, 4.5 μg and 1.5 μg), and vortexed. Place at room temperature for 2 minutes, and add 24 μL of Biobest transfection reagent. After mixing, place at room temperature for 15 minutes, co-transfect 293T cells, collect cell culture fluid after 48 hours and 72 hours, and ultracentrifuge to obtain high-titer virus fluid, namely Mid1 overexpression / control virus fluid, which is aliquoted and stored in a -80°C refrigerator.

[0128] 1.2.3.2 Construction of Mid1 knockdown virus;

[0129] According to the mRNA sequence of the mouse Mid1 gene in NCBI GenBank (NM_001290506.2) and the vector information used, a shRNA sequence specific to the Mid1 gene (SEQ ID NO.1) was designed. The selected vector is pLV3-LTR-eCMV-ZsGreen1-PGK-Puro-U6 (abbreviated as pLV3-LTR-U6) with a puromycin resistance gene inserted, and Bam HI and EcoR I restriction sites are added at both ends of the primer. The designed Mid1 shRNA sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. and the competent cells were transformed to extract the plasmid. The obtained lentiviral plasmid pLV3-LTR-U6-shMid1 was co-transfected with packaging plasmids psPAX2 and pMD2G into HEK293T cells using liposomes to obtain recombinant lentivirus. The specific steps are as described above.

[0130] 1.2.3.3 Transfection of lentivirus into AML12 cell line

[0131] Adjust AML12 cells (mouse liver cells) to logarithmic growth state. Inoculate cells into 96-well culture plates one day before virus infection, so that the cell density reaches 60-70% on the next day, and the cell inoculation volume is 100 μL. Prepare virus dilution: F-12K medium + 2% FBS. Dilute the virus solution according to MOI of 0, 2, 5, 10, 20, 50, 100, 200. Make at least two replicates for each MOI. Discard the cell culture medium, add 100 μL of virus solution to each well according to the concentration gradient, and place in CO 2 Continue to culture in the incubator for 72 hours. Observe the expression of fluorescent protein and cell growth status under a fluorescence microscope to determine the most appropriate MOI value.

[0132] 1.2.3.4 Screening and identification of Mid1 knockdown cell line AML12 shMID1 and overexpression cell line AML12 MID1 .

[0133] One day before adding the screening drug, AML12 wild-type cells were seeded into 6-well plates at a density of 50%. On the second day, puromycin (0, 1, 2.5, 5, 7.5, 10 μg / mL) was added to the culture medium at different concentrations, and the culture medium with antibiotics was replaced every 2 days. The lowest antibiotic concentration at which all cells died on the third day was selected as the optimal screening concentration. One day before lentiviral transfection, AML12 cells were seeded at 5×10 4 / well in a 6-well plate. The number of cells in the next day of lentiviral transfection was 8×10 4 / well. Add appropriate amount of virus suspension (MO1=80) according to the concentration of virus solution. The next day, discard the medium containing lentivirus, rinse twice with PBS, and add 2mL of fresh medium. 2 Continue to culture in the incubator for 72 hours, and observe the fluorescence under the microscope. Add 2 mL of complete culture medium containing 1 μg / mL puromycin to each well, and change the medium or subculture as appropriate. After three subcultures, extract RNA from MID1 overexpression and interference lentivirus-transfected cells and wild-type cells, and perform QRT-PCR to detect efficiency, Western Blot to verify the protein level of MID1, and perform subsequent experiments.

[0134] 1.2.4 Infection response studies in Mid1 knockout mice and cells

[0135] 1.2.4.1 Establishment of cecal ligation and puncture infection model

[0136] (1) Fast for 12 h before the experiment.

[0137] (2) Mice were anesthetized by intraperitoneal injection of 4% chloral hydrate according to body weight, and fixed on an operating board in a supine position.

[0138] (3) Routine abdominal disinfection and shaving were performed. An incision of approximately 1 cm was made in the midline of the abdomen. The cecum was gently removed and separated and ligated distal to the ileocecal valve (approximately 1.2 cm in length).

[0139] (4) Use a syringe needle to pierce the entire middle of the ligated end and squeeze out a small amount of feces. Suture the peritoneum and skin, then inject 1 mL of 37°C saline subcutaneously. Place the postoperative mouse on a warming pad and wait for it to wake up. The mouse can drink water and eat freely.

[0140] (5) The liver was harvested at the corresponding time points for protein determination and immunohistochemical analysis.

[0141] 1.2.4.2 Cell infection experiment

[0142] Preparation of LB liquid culture medium: weigh 5.0g of yeast extract, 10.0g of peptone, and 10.0g of sodium chloride, add 1L of water, and sterilize by high pressure for later use. Preparation of LB solid plate: add 15.0g of agar powder to 1L of LB culture medium, sterilize by high pressure, and dispense into 6cm culture dishes for later use. Inoculate MRSA and E.coli stored at -80℃ on solid LB plates using the three-line method, and culture at 37℃ overnight to revive the strains. Select a single colony the next day, inoculate it into liquid LB liquid culture medium, and shake it at 37℃ at 200rpm / min overnight. Inoculate equal amounts of bacteria into AML12 shMID1 、AML12 MID1 and AML12 NCAll cell culture media used in this experiment did not contain antibiotics. The supernatants of each co-culture group were spread on LB plates and cultured at 37°C overnight.

[0143] 1.2.5 Confirmation that Mid1 specifically degrades HRG

[0144] Cycloheximide (CHX) is an inhibitor of intracellular protein synthesis. MG132 is a proteasome inhibitor. After 2 hours of LPS stimulation, AML12 cells were treated with CHX and MG132 respectively. NC and AML12 MID1 Cells were analyzed to observe the changes in HRG levels at 0h, 2h, 4h, 8h, and 12h. After 2 hours of LPS stimulation, AML12 cells were treated with MG132. NC and AML12 shMID1 The cells were incubated for 10 hours, and then the co-immunoprecipitation (Co-IP) experiment of ubiquitin molecules and HRG was performed to observe the co-precipitation of HRG in different cell lines.

[0145] 1.2.6 Statistical analysis

[0146] All experiments in this part were repeated three times independently, and the quantitative data were expressed as mean ± standard deviation. SPSS (25.0) software was used to perform statistics and analysis on the obtained data, and the differences between the groups were compared using independent sample t-test and one-way analysis of variance. P < 0.05 was considered statistically significant.

[0147] 2. Experimental results

[0148] 2.1 Identification results of liver-specific Mid1 knockout mice

[0149] After killing the mice, the main organs (heart, liver, spleen, lung, and kidney) were obtained and fluorescent imaging (EGFP) was performed in a small animal in vivo imaging system at the same time as the control group. hep-KD The fluorescence intensity of mouse liver was significantly stronger than that of NC group and other organs ( Figure 2 ), indicating that liver-specific knockdown was successful.

[0150] 2.2 Identification results of Mid1 gene systemic knockout mice

[0151] The chimeric male mice were mated with C57BL / 6J mice, and the newborn mice were genetically identified. The target gene was amplified in F1 / R1. The gel electrophoresis results showed that the 554 bp fragment was obtained in newborn mice No. 5, 11, and 13 ( Figure 3 ), and the targeting was successful. Mid1(+ / -) heterozygous offspring (F1) were obtained and can be used for subsequent experimental research.

[0152] 2.3Mid1 knockdown cell line AML12 shMID1 and overexpression cell line AML12 MID1 Screening and identification

[0153] Fluorescence imaging ( Figure 4 A) shows that lentiviral transfection was successful. qPCR ( Figure 4 B) Display AML12 shMID1 The expression of Mid1 in cell line was higher than that in AML12 NC Significantly downregulated, while AML12 MID1 The expression of Mid1 in cell line was higher than that in AML12 NC Significantly upregulated, the model was successfully constructed.

[0154] 2.4 Study on infection response of Mid1 gene knockout mice and cells 2.4.1

[0156] Infection of knockdown cell line AML12 with Escherichia coli (E. coli) and methicillin-resistant Staphylococcus aureus (MRSA) shMID1 and overexpression cell line AML12 MID1 , found AML12 shMID1 It can significantly reduce the number of bacteria in the cell culture supernatant; on the contrary, AML12 MID1 Promote bacterial proliferation ( Figure 5 ). This suggests that inhibition of Mid1 enhances the antibacterial ability of hepatocytes. In addition, observation of infected hepatocytes under trypan blue staining revealed ( Figure 6 ), AML12 shMID1 The proportion of dead cells in the group was significantly lower than that in the control group and AML12 MID1 These results indicate that MID1 interference enhances the antibacterial capacity of hepatocytes and reduces cell damage after infection stimulation. 2.4.2

[0158] Liver-specific Mid1 knockout mice were infected with Escherichia coli by cecal ligation and puncture or intraperitoneal injection. hep-KD , and found that their survival was significantly improved compared with the idling control group (NC) ( Figure 7 ); PH staining of liver tissue sections showed ( Figure 8 ), the hepatocytes in the NC group showed large patches of degeneration and necrosis, while the Mid1 hep-KD The group only had slight hepatocyte degeneration; serum liver function test showed that Mid1 hep-KD The liver injury of group A was significantly better than that of group B ( Fig. 9 ).

[0159] 2.5 Mid1-specific ubiquitination and degradation of HRG 2.5.1

[0161] To further explore the mechanism of MID1 function, we performed mass spectrometry analysis to search for mid1-binding proteins and identified HRG as a candidate for interacting with MID1. Fig.10 As shown, Co-IP analysis confirmed the interaction between MID1 and HRG. Next, after using the protein synthesis inhibitor CHX, the AML12 cell line overexpressing MID1 The HRG in the cell line was gradually degraded, and this effect was blocked by the proteasome inhibitor MG132, indicating that Mid1 promoted the proteasome-dependent degradation of HRG. The Co-IP experiment of ubiquitin molecules and HRG showed that under LPS stimulation, the binding of HRG to ubiquitin molecules in the control group cells increased, while in the knockdown cell line AML12 shMID1 The binding of HRG to ubiquitin molecules was significantly reduced. The above results indicate that HRG is a specific ubiquitination degradation substrate of Mid1. 2.5.2

[0163] Knockdown of the hepatocyte cell line AML12 using infection with Escherichia coli and methicillin-resistant Staphylococcus aureus shMID1 , found AML12 shMID1 The HRG content in the cell culture supernatant was higher than that in the control group. Similarly, the liver-specific Mid1 knockout mice were infected with Escherichia coli by cecal ligation and puncture or intraperitoneal injection. hep-KD , Mid1 hep-KD Serum HRG levels in infected mice increased ( Fig.11 A), Immunofluorescence staining of liver tissue sections ( Fig.11 B) Display Mid1 hep-KD Mid1 was downregulated and HRG content was increased in mouse hepatocytes.

[0164] 3. Analysis

[0165] Hepatocytes are an important cell type involved in innate immunity. The liver is supplied by both the portal vein and the hepatic artery and is the first line of defense against pathogens in the blood. In the integrated immune system, hepatocytes are at the core of the acute phase response. LPS can be detected in the liver 20-30 minutes after intravenous injection, and the concentration of LPS in hepatocytes is higher compared to liver Kupffer cells. Up to 75% of LPS is directly cleared by hepatocytes rather than Kupffer cells. However, there are no reports on whether hepatocytes directly kill bacteria. During bacterial infection, the liver usually serves as a target cell for immune molecules. For example, when bacterially infected monocytes, macrophages, etc. secrete cytokines (such as IL-6, IL-1, TNF-α, etc.), they stimulate hepatocytes to produce related proteins or mediators to promote bactericidal effects. The main mechanisms are: secretion of opsonins such as C-reactive protein (CRP), serum amyloid protein P component (SAP), and serum amyloid protein (SAA) to mediate bactericidal; production of lipopolysaccharide (LPS) ligands or receptors to activate the body's innate immunity; secretion of iron metabolism-related proteins such as transferrin, lipocalin-2, and hepcidin (LEAP) to limit bacterial growth; production of coagulation factor fibrinogen to activate complement or recruit neutrophils to produce NETs to eliminate pathogens. During viral infection, hepatocytes can directly produce effectors such as NO, IFNγ, IFNβ, and ROS through innate immune receptors to exert liver immune function8. The liver mainly expresses RIG-like receptors (retinoic acid-inducible gene I-like receptors, RLRs), NOD-like receptors (nucleotide-binding oligomerization domain-like receptors, NLRs), and a small amount of Toll-like receptors (TLRs). In addition, during sepsis, hepatocytes can also synthesize self-protective tolerance molecules such as ferritin heavy chain (FTH), which can maintain the production of endogenous glucose through hepatic gluconeogenesis, maintain blood sugar and thus improve tolerance to sepsis. The latest view is that metabolic adaptation dominated by hepatocytes plays an important role and is closely related to the prognosis of sepsis. Tolerance molecules can be produced in hepatocytes during sepsis to perform self-protection functions. However, compared with the depth and breadth of research on the infection response mechanism of immune cells, the research on the anti-infection, anti-inflammatory and infection tolerance mechanisms of hepatocytes is slightly less popular, and the understanding of how hepatocytes maintain the balance of the above functional mechanisms is far from enough. The liver is the first line of defense against infection, and the largest proportion of hepatocytes is the immune driver, which coincides with the new guidelines for sepsis treatment (Sepsis 3.0) for earlier and more timely anti-infection. Therefore, exploring strategies to enhance hepatocyte anti-infection will undoubtedly bring new hope.

[0166] The present invention starts from the perspective of cellular diversity of immune response and is applied to the study of hepatocyte immune response, laying the foundation for finding new biomarkers and new intervention targets for sepsis and exploring non-antibiotic treatment strategies. Faced with the clinical dilemma of high mortality rate of sepsis, especially the severe situation of frequent infection with drug-resistant bacteria and failure of antibiotics to reconstruct immune function, how to realize new strategies for parenchymal cells to cooperate with immune cells to resist pathogens is undoubtedly of great clinical significance and application prospects.

[0167] In the past, it was generally believed that the synthesis capacity and consumption level determined the serum content of serum proteins secreted by the liver, but this part of the experiment found for the first time that the ubiquitination and degradation of HRG in hepatocytes also had a huge impact on its serum content. Ubiquitination modification will cause HRG to be degraded in hepatocytes and cannot be secreted into the serum. Therefore, studying the ubiquitination and degradation mechanism of HRG is of great significance for achieving the clinical application of HRG and then achieving specific treatment of sepsis. However, no one has reported a ubiquitin ligase that can specifically degrade HRG.

[0168] This part of the experiment found for the first time that knocking down Mid1 can reduce damage to hepatocytes after infection in vitro and promote bacterial death. It was found for the first time that HRG interacts with Mid1 and HRG is a substrate for ubiquitination and degradation of Mid1. It was found for the first time that knocking down Mid1 effectively increased the HRG content in serum, liver status and survival rate in the mouse Escherichia coli intraperitoneal infection model. It is strongly suggested that "regulating the ubiquitination modification of hepatocyte HRG protein through Mid1" may be a potential measure to replace "exogenous HRG supplementation therapy" for the treatment of sepsis.

Claims

1. A method for constructing a liver-specific Mid1 gene knockout mouse model, characterized in that: The steps include: S1. Construction of adeno-associated virus AAV-shMid1: The sequence of the shRNA that specifically knocks down the Mid1 gene is: GACCGATGACCAGTTAATCTGTGTTTTTT; Inserting the shRNA into a backbone plasmid adeno-associated virus vector cut with NheI and HindIII to obtain a recombinant plasmid; The recombinant plasmid and the adeno-associated virus packaging plasmid are co-transfected into embryonic kidney cells transformed by adenovirus, and the cells are lysed to release AAV particles to obtain the recombinant adeno-associated virus AAV-shMid1; S2. Construction of liver-specific Mid1 knockout mice AAV-shMid1 was diluted to the injection titer, and mice were injected intravenously and fed normally to obtain Mid1. hep-KD Liver-specific knockout mice.

2. The construction method according to claim 1, characterized in that: The embryonic kidney cells transformed by the adenovirus are AAV-293 cells; The backbone plasmid is pAAV-ApoE / hAATp-EGFP-MCS-SV40 PolyA; The adeno-associated virus packaging plasmids are the plasmid pHelper carrying adenovirus-derived genes and pAAV-RC carrying AAV replication and capsid genes; The AAV is AAV8.

3. A method for constructing a Mid1 gene knockout mouse model, characterized in that: The steps include: (1) Using the CRISPR-Cas9 gene editing method to obtain F0 generation mice: preparing a gene editing solution, the gene editing solution containing Cas9 and two gRNAs targeting the mouse Mid1 gene: gRNA-A1 and gRNA-A2; electro-transfecting the gene editing solution into mouse fertilized eggs, and transplanting the surviving fertilized eggs after electro-transfection into pseudo-pregnant female mice to produce F0 generation mice; the gRNA sequence is as follows: gRNA-A1: CATTTCAGACACCAGAGCCGCGG; gRNA-A2: CTTATCATAGCTAAGGCTGAAGG; (2) The chimeric male mice in the F0 generation were mated with wild-type mice to obtain F1 generation Mid1(+ / -) heterozygous offspring; (3) F1 generation Mid1(+ / -) heterozygous mice were mated with each other to produce F2 generation Mid1(- / -) homozygous mice, which is the Mid1 gene knockout mouse model.

4. The construction method according to claim 3, characterized in that: The molar ratio of Cas9 to the gRNA mixture in the gene editing solution is 3:2, and the gRNA mixture is obtained by mixing gRNA-A1 and gRNA-A2 in a molar ratio of 1:

1.

5. The construction method according to claim 3, characterized in that: in, The identification of F0 and F1 generation mice was performed by genotyping PCR, and the primer pair F1 / R1 was used for PCR identification. If the PCR band was a 554 bp fragment, it indicated that the targeting was successful; the F1 / R1 primer sequence was as follows: F1:5'-AGACAGATTAACCAGGCATCCTC-3'; R1:5'-TCCTGTCACCAGTTAGTTTTACTTG-3'.

6. The construction method according to claim 3, characterized in that: The identification of F2 generation mice was performed by genotypic PCR, and primer pairs F1 / R1 and F2 / R1 were used for PCR identification. A 554 bp PCR amplification product band was detected for Mid1(- / -) homozygotes, a 554 bp band, a 679 bp band and a 1800 bp band were detected for Mid1(+ / -) heterozygotes, and a 679 bp band was detected for negative mice without knockout of the target gene. The sequence of the primer pair is as follows: F1:5'-AGACAGATTAACCAGGCATCCTC-3'; R1:5'-TCCTGTCACCAGTTAGTTTTACTTG-3'; F2: 5'-CAAACTGTAAACAGTGCCTTGAGAG-3'.

7. A method for constructing a Mid1 gene-edited cell model, characterized in that: The Mid1 gene-edited cell model is a Mid1 gene-knockdown liver cell model or a Mid1 gene-overexpression liver cell model. The method for constructing the Mid1 gene overexpression hepatocyte model comprises the following steps: performing double restriction digestion on the DNA sequence of the Mid1 gene and the blank expression plasmid respectively, and then connecting them to obtain a Mid1 overexpression recombinant lentiviral vector, and then transforming Escherichia coli competent cells, extracting plasmids from positive clones, and obtaining a large number of Mid1 overexpression recombinant lentiviral vectors; mixing the Mid1 overexpression recombinant lentiviral vector and the virus packaging plasmid to co-transfect competent cells, culturing, and centrifuging the cell culture fluid to obtain the overexpression recombinant lentivirus; transfecting the overexpression recombinant lentivirus into a hepatocyte cell line, screening and identifying to obtain a Mid1 overexpression cell strain, and thus obtaining a Mid1 gene overexpression hepatocyte model; The method for constructing the Mid1 gene knockdown hepatocyte model comprises the following steps: inserting the shRNA sequence of the Mid1 gene into a double-enzyme-cut backbone plasmid to obtain a recombinant plasmid; taking the recombinant plasmid and the virus packaging plasmid to co-transfect competent cells, culturing, and centrifuging the cell culture fluid to obtain a knockdown recombinant lentivirus; transfecting the knockdown recombinant lentivirus into a hepatocyte cell line, screening and identifying to obtain a Mid1 knockdown cell line, and thus obtaining a Mid1 gene knockdown hepatocyte model; the sequence of the shRNA is: GACCGATGACCAGTTAATCTGTGTTTTTT.

8. The construction method according to claim 7, characterized in that: The Mid1 gene DNA sequence is shown in SEQ ID NO.9; The co-transfected competent cells are 293T cells; the hepatocyte cell line is AML12 cell line. The packaging plasmids are psPAX2 and pMD2G; The blank expression plasmid is pIRES2-EF1a-EGFP-P3-Puro-CMV-MCS-WPRE, and the restriction endonucleases used for double enzyme digestion are NotI and BamHI; The backbone plasmid is pLV3-LTR-eCMV-ZsGreen1-PGK-Puro-U6, and the restriction endonucleases used for double enzyme digestion are Bam HI and EcoR I.

9. A Mid1 gene-edited cell model, characterized in that: The method is constructed by the method of claim 7 or 8.

10. Use of the mouse model constructed by the method of claim 1, the mouse model constructed by the method of claim 3, or the cell model of claim 9 in any of the following: (1) Application in studying the interaction between liver ubiquitin ligase and liver secretory protein, preferably in studying the effect of ubiquitin ligase Mid1 on the degradation of liver cell secretory protein HRG; (2) Application in studying hepatocyte responses to sepsis; (3) Application of Mid1 in studying the mechanism of action of other infectious problems besides sepsis.

Images