Application of primurin as antibiotic synergist

Abstract

The invention discloses application of primurin as an antibiotic synergist, and belongs to the field of new medical application of primurin. Through an NDM-5 enzyme inhibition test, a trace chessboard dilution method, a time-sterilization curve test and other tests, it is found that primurin can significantly inhibit the activity of an NDM-5 enzyme and recover the antibacterial activity of meropenem to NDM-5-producing escherichia coli. Therefore, it is determined that primurin can be used as an inhibitor of beta-lactamase; when the beta-lactamase is combined with the beta-lactam antibiotics, the hydrolysis of the beta-lactamase on the beta-lactam antibiotics can be reduced or even eliminated, the beta-lactam antibiotics are effectively protected, and the sensitivity of beta-lactamase-producing drug-resistant bacteria on the beta-lactam antibiotics is recovered; the invention has application prospects in preparation of antibiotic synergists or preparation of drugs or preparations for inhibiting pathogenic bacteria producing beta-lactamase by combined use with antibiotics, and the like.

Description

Technical Field

[0001] The present invention relates to a new pharmacological use of primulin, in particular to a new pharmacological use of primulin as a β-lactamase inhibitor or in combination with antibiotics to inhibit β-lactamase-producing drug-resistant pathogens, belonging to the field of new pharmacological uses of primulin. Background Art

[0002] β-lactam antibiotics, due to their broad antimicrobial spectrum, strong activity, and high stability, have become an important weapon in the fight against bacterial infections. Carbapenems, a key member of the β-lactam antibiotic class, such as meropenem and imipenem, are considered the last line of defense against serious infections caused by multidrug-resistant Gram-negative bacteria in the clinic. However, with the widespread use of β-lactam antibiotics, an increasing number of pathogens have synthesized β-lactamases that hydrolyze β-lactam antibiotics, thereby mediating bacterial resistance to this class of antibiotics. These enzymes catalyze the cleavage of the C-N bond in the β-lactam ring of β-lactam antibiotics, leading to ring opening and inactivation of the antibiotic.

[0003] Metallo-β-lactamases rely on zinc ions in the active center to catalyze the hydrolysis of all β-lactam antibiotics, including carbapenems. There are no effective inhibitors for a variety of Gram-negative and Gram-positive pathogens carrying metallo-β-lactamases in clinical practice. NDM-1 Since its first report in 2009, the gene-encoded NDM-1 metallo-β-lactamase has mediated bacterial resistance to almost all β-lactam antibiotics, including carbapenems, significantly weakening the bactericidal effect of the drugs. NDM-1 It has been detected explosively and is prevalent worldwide, carrying bla NDM-1 Genetically resistant bacteria are also called "superbugs."

[0004] The selective pressure caused by the widespread use and misuse of antibiotics has played a key role in the directed evolution of NDM-1, leading to the continuous emergence of NDM-1 mutants. Among these, the NDM-5 mutant is the most representative clinically. Compared to NDM-1, it has higher hydrolytic activity against carbapenem antibiotics and exhibits high resistance to nearly all antibiotics. As the most widespread and serious metallo-β-lactamase discovered in recent years, NDM-5 is only moderately inhibited by tigecycline and polymyxin B. The continuous evolution of these mutants complicates clinical treatment. NDM-5 hydrolyzes commonly used β-lactam antibiotics in clinical practice. Compounds that inhibit NDM-5 activity could protect β-lactam antibiotics from hydrolysis, thereby restoring their antimicrobial efficacy. Therefore, identifying inhibitors of NDM-5 is one of the most effective approaches to curbing infections caused by "superbugs."

[0005] Primulain is a natural product found in the trichomes of Primula vulgaris leaves and stems, with potential antibacterial and anticancer activities. In in vitro studies, primulain demonstrated high activity against Trypanosoma brucei rhodesiense (IC50 0.144mM) and Leishmania donovani (IC50 0.711mM), with low cytotoxicity against mammalian cells (IC50 15.4mM). Furthermore, related studies have shown that primulain also exhibits moderate activity against Mycobacterium tuberculosis, Plasmodium falciparum, and Trypanosoma cruzi.

[0006] To date, there has been no report on the use of primulin to inhibit the activity of metallo-β-lactamases and enhance the inhibitory effect of β-lactam antibiotics against β-lactamase-producing resistant bacteria. Summary of the Invention

[0007] The main purpose of the present invention is to provide a new pharmacological use of primulin for enhancing the inhibitory effect of β-lactam antibiotics on β-lactamase-producing resistant pathogens.

[0008] In order to achieve the above-mentioned purpose, the technical solutions adopted by the present invention include:

[0009] One aspect of the present invention provides the use of primulin in combination with antibiotics in the preparation of a drug or preparation for inhibiting the production of β-lactamase-resistant pathogens.

[0010] The present invention finds through NDM-5 enzyme inhibition test, micro-checkerboard dilution method, time-kill curve test and other tests that primulin can restore the antibacterial activity of β-lactam antibiotics against NDM-5-positive bacteria by inhibiting the hydrolysis of β-lactam antibiotics by NDM-5. Therefore, primulin can be used as an antibiotic synergist or β-lactamase inhibitor, especially as a synergist of β-lactam antibiotics for inhibiting β-lactamase-producing and resistant pathogenic bacteria.

[0011] In a preferred embodiment of the present invention, the drug-resistant pathogenic bacteria include β-lactamase-producing Gram-negative pathogenic bacteria.

[0012] In a preferred embodiment of the present invention, the β-lactamase-producing pathogen is a bla NDM-5 NDM-5 positive bacteria of the gene, the bla NDM-5 The protein encoded by the gene is NDM-5 enzyme; the bla NDM-5 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0013] In a preferred embodiment of the present invention, the β-lactamase-producing resistant pathogenic bacteria may be a mutant of NDM-1 bacteria, and the mutant is preferably an NDM-5 mutant; as a reference, the NDM-5 mutant may be an NDM-5 positive resistant Escherichia coli.

[0014] The antibiotics described in the present invention are preferably β-lactam antibiotics, wherein the β-lactam antibiotics are further preferably carbapenem antibiotics, and the carbapenem antibiotics include but are not limited to carbapenem antibiotics such as meropenem or imipenem; β-lactam antibiotics have become an important weapon against bacterial infections due to their broad antibacterial spectrum, strong activity and high stability. Carbapenem antibiotics, one of the important members of the β-lactam antibiotics, are such as meropenem and imipenem.

[0015] Another aspect of the present invention is to provide a pharmaceutical composition for inhibiting the production of β-lactamase-resistant pathogenic bacteria, which is composed of active ingredients and excipients acceptable to pharmaceutical preparations; wherein the active ingredients are composed of primulin and antibiotics.

[0016] In a preferred embodiment of the present invention, the β-lactamase-producing drug-resistant pathogenic bacteria include β-lactamase-producing Gram-negative pathogenic bacteria.

[0017] In a preferred embodiment of the present invention, the β-lactamase-producing drug-resistant pathogen is a bla NDM-5 NDM-5 positive bacteria of the gene, the bla NDM-5 The protein encoded by the gene is the NDM-5 enzyme.

[0018] In a preferred embodiment of the present invention, the β-lactamase-producing resistant pathogenic bacteria may be a mutant of NDM-1 bacteria, and the mutant is preferably an NDM-5-producing mutant; as a reference, the NDM-5-producing mutant may be an NDM-5-positive resistant Escherichia coli.

[0019] The antibiotics described in the present invention are preferably β-lactam antibiotics, wherein the β-lactam antibiotics are further preferably carbapenem antibiotics, and the carbapenem antibiotics include but are not limited to carbapenem antibiotics such as meropenem or imipenem.

[0020] The pharmaceutical composition is prepared into commonly used clinical preparations, such as powders, granules, tablets, capsules, injections, etc., according to conventional preparation methods in the art, and is introduced into muscles, endothelium, subcutaneous tissue, veins, mucosal tissues by injection, oral administration, nasal drops, eye drops, physical or chemical methods, or is mixed or encapsulated with other substances and then introduced into the body.

[0021] The excipients are conventional excipients in the pharmaceutical field, such as diluents, disintegrants, lubricants, excipients, adhesives, glidants, fillers, surfactants, etc. In addition, other excipients such as flavoring agents and sweeteners may also be added to the composition.

[0022] The diluent may be one or more ingredients that increase the weight and volume of the tablet; commonly used diluents include lactose, starch, pregelatinized starch, microcrystalline cellulose, sorbitol, mannitol, and inorganic calcium salts, among which lactose, starch, and microcrystalline cellulose are the most commonly used.

[0023] The disintegrant can be one or a mixture of cross-linked polyvinyl pyrrolidone (2-6% by weight), cross-linked sodium carboxymethyl cellulose (2-6% by weight), alginic acid (2-5% by weight), and microcrystalline cellulose (5-15% by weight). Cross-linked polyvinyl pyrrolidone (2-7% by weight) and cross-linked sodium carboxymethyl cellulose (2-6% by weight) are preferred. Cross-linked polyvinyl pyrrolidone (2-6% by weight) is most preferred.

[0024] The lubricant includes one or a mixture of stearic acid, sodium stearate, magnesium stearate, calcium stearate, polyethylene glycol, talc, and hydrogenated vegetable oil. Magnesium stearate is particularly suitable. The amount of lubricant used (by weight) ranges from 0.10% to 1%, with a typical amount of 0.25% to 0.75% and an optimal amount of 0.5% to 0.7%.

[0025] The binder can be one or more components that are beneficial to granulation, and can be starch slurry (10-30% by weight of the total binder), hydroxypropyl methylcellulose (2-5% by weight of the total binder), or polyvinyl pyrrolidone (2-20% by weight of the total binder). An ethanol aqueous solution of polyvinyl pyrrolidone is preferred, and a 50% ethanol aqueous solution of polyvinyl pyrrolidone is most preferred.

[0026] The glidant can be one of micro powder silica gel, talc, magnesium trisilicate or a mixture of several of them.

[0027] The surfactant may be one or more components that can improve wettability and increase drug dissolution, and is commonly used as sodium lauryl sulfate (usually in the range of 0.2-6% by weight).

[0028] The primulin described in the present invention includes its prototype, pharmaceutically acceptable salt or preparation containing primulin.

[0029] Primulain, 2-methoxy-6-pentyl-1,4-benzoquinone, CAS number: 15121-94-5; its molecular formula is: C 12 H16 O3; molecular weight: 208.25; structural formula is as follows:

[0030]

[0031] The representative drug of the β-lactam antibiotics in the present invention is meropenem, and its molecular formula is: 17 H 25 N3O5S, molecular weight: 383.5.

[0032] The NDM-5 enzyme described in the present invention can be a recombinant NDM-5 enzyme carried by wild fungi in nature or prepared by genetically engineered fungi.

[0033] The present invention verifies through tests such as NDM-5 enzyme inhibition test, enzyme inhibition rate and half-inhibitory concentration determination, chessboard method for determining minimum inhibitory concentration, and time-kill curve method that primulin can inhibit the activity of NDM-5 and restore the antibacterial activity of meropenem against NDM-5-resistant bacteria, and is used to treat infectious diseases caused by resistant bacteria. The present invention has application prospects in preparing antibiotic synergists or in combining with antibiotics to prepare drugs or preparations for inhibiting β-lactamase-producing resistant pathogens.

[0034] Detailed description of the overall technical solution of the present invention

[0035] In this study, the crystal structure of NDM-5 (PDB: 4TZE) from the Protein Data Bank was used as the target protein. Using the computer-aided drug design software Discovery Studio, molecular docking was used to calculate the binding free energy between NDM-5 and the primulin ligand binding site. The docking product showed a binding free energy of less than -10.0 kcal / mol, and primulin tightly bound to the zinc ion-centered active region of NDM-5. Therefore, primulin was considered a potential candidate compound for NDM-5 inhibition.

[0036] On this basis, the present invention conducted a test on the inhibitory activity of primulin on NDM-5 enzyme. The test results showed that primulin could inhibit the activity of NDM-5 enzyme in a dose-dependent manner, with a maximum inhibition rate of 79.2% and an IC50 of 34±1.0 μM.

[0037] The results of the minimum inhibitory concentration test showed that primulin (or meropenem) had a poor antibacterial effect when used alone, and its combination with meropenem could reduce the MIC value of meropenem against NDM-5-positive Escherichia coli by 16 times; the FIC index showed that the combination of primulin and meropenem had a significant synergistic effect in inhibiting NDM-5-producing strains.

[0038] According to the time-kill curve, primulin combined with meropenem can significantly inhibit the growth of NDM-5 positive Escherichia coli. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is a diagram of the binding position of primulin at the active site of the target protein NDM-5.

[0040] Figure 2 These are the time growth curve and time killing curve of primulin combined with meropenem against NDM-5 positive Escherichia coli. DETAILED DESCRIPTION

[0041] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0042] Experimental Example 1 Molecular docking experiment of primulin and target protein NDM-5

[0043] This study used the crystal structure of NDM-5 (PDB: 4TZE) in the protein database as the target protein, and applied the computer-aided drug design software Discovery Studio to calculate the binding free energy of the binding site between NDM-5 and the primulin ligand using the molecular docking method. The molecular docking results showed that the binding free energy of the docking product was less than -10.0 Kcal / mol, and primulin was tightly bound to the active region of NDM-5 centered on the zinc ion ( Figure 1 ), therefore, primulin was considered as a candidate compound with potential NDM-5 inhibitory effect.

[0044] Experimental Example 2 Expression and purification of NDM-1 protein

[0045] Through EcoRI and XhoⅠ restriction sites, bla NDM-5 The gene sequence was inserted into the pET28(α) plasmid to construct the Pet28(α)-NDM-1 recombinant plasmid, which was verified by DNA sequencing. NDM-5 There is no gene mutation.

[0046] bla NDM-5 Nucleotide sequence of the gene:

[0047] ATGGAATTGCCCAATATTATGCACCCGGTCGCGAAGCTGAGCAC

[0048] CGCATTAGCCGCTGCATTGATGCTGAGCGGGTGCATGCCCGGTGAA

[0049] ATCCGCCCGACGATTGGCCAGCAAATGGAAACTGGCGACCAACGGT

[0050] TTGGCGATCTGGTTTTCCGCCAGCTCGCACCGAATGTCTGGCAGCAC

[0051] ACTTCCTATCTCGACATGCCGGGTTTCGGGGCAGTCGCTTCCAACGG

[0052] TTTGATCGTCAGGGATGGCGGCCGCGTGCTGTTGGTCGATACCGCCT

[0053] GGACCGATGACCAGACCGCCCAGATCCTCAACTGGATCAAGCAGGA

[0054] GATCAACCTGCCGGTCGCGCTGGCGGTGGTGACTCACGCGCATCAG

[0055] GACAAGATGGGCGGTATGGACGCGCTGCATGCGGCGGGGATTGCGA

[0056] CTTATGCCAATGCGTTGTCGAACCAGCTTGCCCCGCAAGAGGGGCT

[0057] GGTTGCGGCGCAACACAGCCTGACTTTCGCCGCCAATGGCTGGGTC

[0058] GAACCAGCAACCGCGCCCAACTTTGGCCCGCTCAAGGTATTTTACCC

[0059] CGGCCCCGGCCACACCAGTGACAATATCACCGTTGGGATCGACGGC

[0060] ACCGACATCGCTTTTGGTGGCTGCCTGATCAAGGACAGCAAGGCCA

[0061] AGTCGCTCGGCAATCTCGGTGATGCCGACACTGAGCACTACGCCGC

[0062] GTCAGCGCGCGCGTTTGGGTGCGGCGTTCCCCAAGGCCAGCATGATC

[0063] GTGATGAGCCATTCCGCCCCCGATAGCCGCGCCGCAATCACTCATACGGCCCGCATGGCCGACAAGCTGCGCTGA (SEQ ID No. 1)

[0064] The recombinant plasmid was transformed into Escherichia coli BL21 (DE3) competent cells, screened on kanamycin plates, and single clones were selected and inoculated into 5 mL of LB liquid medium. The culture was shaken at 37°C and 180 rpm overnight. 50% glycerol was mixed with the bacterial solution in a 1:1 ratio, and the engineered bacteria E. coli BL21 (DE3) -pET28 (α) -NDM-5 were stored at -80°C.

[0065] The engineered bacteria were cultured in LB medium containing kanamycin at 37°C and 180 rpm until the logarithmic growth phase with an OD value of 0.6-0.8. Isopropyl-β-D-thiogalactopyranoside (IPTG) with a final concentration of 0.2 mM was applied and induced at 30°C for 16 h. The bacteria were then collected by centrifugation at 4°C.

[0066] The collected bacteria were resuspended in phosphate buffered saline (PBS, pH = 8.0) and disrupted in an ice bath using an ultrasonic cell disruptor. The bacterial lysate was centrifuged and the supernatant was collected and passed through a Ni-NTA His tag affinity chromatography column to isolate and purify the NDM-1 protein. Finally, the NDM-5 protein was dialyzed for 36 hours using a 10 kD molecular cutoff dialysis bag to remove salts and concentrated using a 10 kD molecular cutoff ultrafiltration tube. The expression and purification results of the NDM-5 protein were analyzed by SDS-PAGE, resulting in an NDM-1 recombinant protein with a purity greater than 90%.

[0067] Test Example 3 In vitro inhibition test of primulin on NDM-5 enzyme

[0068] A reaction system was constructed to determine the enzyme inhibition of primulin against NDM-5. Reactions were performed in 96-well plates with triplicate wells for each reaction. The enzyme inhibition activity reaction system contained 200 μmol / L meropenem as the substrate, 50 μL of a 20 nmol / L final concentration of NDM-5 protein solution, and primulin solutions of varying concentrations. The reaction was incubated at 30°C for 30 min, and enzyme activity was measured using a microplate reader at a wavelength of 300 nm.

[0069] The specific process is as follows:

[0070] The reaction was carried out in a 96-well plate. 50 μL of purified NDM-5 protein solution with a final concentration of 20 nmol / L and gradient concentrations of primulin (0, 2, 4, 8, 16, 32, 64, 128 μg / mL) were added to each well and incubated at 30°C for 30 minutes. Subsequently, 100 μL of meropenem solution with a final concentration of 200 μmol / L was added and the plate was immediately placed in a microplate reader to measure the absorbance OD within 30 minutes. 300 changes.

[0071] The inhibition rate was calculated as follows: the enzyme reaction rate V0 in the control group and the enzyme hydrolysis rate V1 after inhibitor treatment were calculated. The enzyme activity in the control group was set as 100%, and the remaining enzyme activity was (V1 / V0)×100%.

[0072] Calculation of half inhibitory concentration IC of primulin against NDM-5 50 value.

[0073] The results of the in vitro inhibition test of primulin on NDM-5 enzyme showed that primulin could inhibit the activity of NDM-5 enzyme in a dose-dependent manner, with a maximum inhibition rate of 79.2% and an IC50 of 34±1.0μM.

[0074] Test Example 4 Minimum Inhibitory Concentration Test of Primulin and Meropenem Combined Against NDM-5 Positive Bacteria

[0075] Take 2 μL of NDM-5 positive Escherichia coli (engineered bacteria E. coli BL21 (DE3) - pET28 (α) - NDM-5 constructed in Experimental Example 2) and inoculate it into 5 ml of LB medium. Incubate at 37 ° C and 180 rpm for about 12 hours until the bacteria are in the late logarithmic growth phase. Take the bacterial solution into MH broth medium and adjust the bacterial solution concentration to 5 × 10 6 CFUs / mL. Drug susceptibility testing for primulin and meropenem (concentration gradient of 1-2048 μg / mL) was performed using the broth microdilution method. A bacterial suspension without meropenem was used as a positive control, and MH broth was used as a negative control. After incubation at 37°C for 24 hours, the MIC results were read in 96-well plates. Each operation was repeated three times. The drug MIC value was the drug concentration in the clear well immediately preceding the turbid well in the 96-well plate.

[0076] Take the above-activated cultured bacterial solution, use the checkerboard method to prepare a 96-well plate, and simultaneously detect 77 possible concentration combinations. Add different concentration combinations of primulaquine and meropenem, and place the 96-well plate in a constant temperature biochemical incubator at 37°C for incubation for 24 h. Conduct an antibacterial activity test of the combination of primulaquine and meropenem against NDM-5 positive bacteria to determine the minimum inhibitory concentration (MIC) value of their combined application. At the same time, set up a negative control group and a positive control group, and perform parallel operations 3 times. Calculate the fractional inhibitory concentration index (FIC) value based on the MIC value. The calculation method is as follows:

[0077] FIC = MIC(meropenem in combination) / MIC(meropenem alone) + MIC(primulaquine in combination) / MIC(primulaquine alone)

[0078] When FICI ≤ 0.5, the two have a synergistic effect; 0.5 < FICI ≤ 4, the two have an indifferent effect; FICI > 4, the two have an antagonistic effect.

[0079] Table 1 MIC values and FIC values of the combination of meropenem and primulaquine against NDM-5 positive Escherichia coli

[0080]

[0081] The results of the minimum inhibitory concentration test showed that primulaquine alone did not have antibacterial effect, and its combination with meropenem could reduce the MIC value of meropenem against NDM-5 positive drug-resistant Escherichia coli by 16 times. The FIC index indicated that the combination of primulaquine and meropenem had a significant synergistic effect on inhibiting drug-resistant strains producing NDM-5.

[0082] Experimental Example 5 Time-kill curve test of the combination of primulaquine and meropenem against NDM-5 positive Escherichia coli

[0083] Pick single colonies from the pure culture plate of NDM-5 positive Escherichia coli and culture them in MH broth medium at 37°C for 6 - 8 h. Take the bacterial culture, adjust the concentration of the bacterial solution to 5×10 7 CFU / ml with a McFarland turbidimeter using sterile physiological saline, and then dilute it 10-fold with sterile MH broth to make its final concentration 10 6 CFU / mL.

[0084] Set up an antibiotic-free blank control group, a 4 μg / ml meropenem group, a 16 μg / ml primulaquine group, and a group combining 4 μg / ml meropenem and 16 μg / ml primulaquine. The experimental groups and the control group were cultured at 37°C under the condition of the same bacterial solution concentration. At 0, 1, 3, 5, 7, 9, and 11 h, take a quantitative culture solution from each group and transfer it to the corresponding agar medium for culture. After culturing at 37°C for 18 - 24 h, perform colony counting. Use the logarithm of the colony number as the ordinate and the culture time as the abscissa to draw a time-kill curve ( Figure 2 ).

[0085] according to Figure 2 The time-kill curve showed that primulin combined with meropenem could significantly inhibit the growth of NDM-5 positive resistant Escherichia coli.

Claims

1. The use of primulin in combination with antibiotics in the preparation of drugs for inhibiting β-lactamase-producing drug-resistant pathogens.

2. The use according to claim 1, characterized in that The β-lactamase-producing drug-resistant pathogenic bacteria include β-lactamase-producing Gram-negative drug-resistant pathogenic bacteria.

3. The use according to claim 1 or 2, characterized in that: The β-lactamase-producing drug-resistant bacteria are bla NDM-5 gene NDM-5-positive bacteria, the bla NDM-5 The protein encoded by the gene is NDM-5 enzyme; the bla NDM-5 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

4. The use according to claim 3, characterized in that The NDM-5 positive bacteria are mutants of NDM-1 resistant bacteria, and the mutants are NDM-5 mutants.

5. The use according to claim 4, characterized in that The NDM-5 mutant strain is NDM-5 positive drug-resistant Escherichia coli.

6. The use according to claim 1, characterized in that: The primulin includes its prototype, pharmaceutically acceptable salt or preparation containing primulin; the antibiotic is a β-lactam antibiotic.

7. The use according to claim 6, characterized in that The β-lactam antibiotic is a carbapenem antibiotic; preferably, the carbapenem antibiotic includes but is not limited to meropenem or imipenem.

8. A pharmaceutical composition for inhibiting the production of β-lactamase-producing pathogenic bacteria, the pharmaceutical composition comprising an active ingredient and an excipient acceptable to pharmaceutical preparations; wherein: The active ingredients are composed of primulin and antibiotics; preferably, the antibiotics are β-lactam antibiotics.

9. The pharmaceutical composition according to claim 8, characterized in that The β-lactamase-producing resistant pathogenic bacteria include β-lactamase-producing Gram-negative pathogenic bacteria; preferably, the β-lactamase-producing resistant pathogenic bacteria are bla NDM-5 gene NDM-5-positive bacteria, the bla NDM-5 The protein encoded by the gene is the NDM-5 enzyme; further preferably, the NDM-5 positive bacteria is a mutant of NDM-1 bacteria, which is a mutant strain producing NDM-5; more preferably, the NDM-5 producing mutant strain is NDM-5 positive resistant Escherichia coli.

10. The pharmaceutical composition according to claim 8, characterized in that The primulin includes its prototype, pharmaceutically acceptable salt or preparation containing primulin.

Images