Use of a fralpine and its analogues for the preparation of a medicament for the treatment of a pigmented skin disease
By inhibiting UBR5 activity and regulating melanin production using frapinol and its analogues, the problem of poor efficacy in traditional treatments of pigmented skin diseases has been solved, achieving safe and effective whitening and treatment effects, and expanding the application potential of UBR5 in the treatment of pigmented skin diseases.
Patent Information
- Application Number
- CN202510022990.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-07
- Publication Date
- 2026-01-09
- Estimated Expiration
- 2045-01-07
AI Technical Summary
Existing treatments for pigmentary skin diseases have limited effectiveness, lacking safe and effective therapeutic targets and drugs. Traditional treatments struggle to effectively regulate melanin production, making it difficult to resolve the aesthetic and health issues associated with these skin diseases.
By using voruciclib and its analogues such as vitexin, valericin, or vitexin, new drugs and skin whitening products can be developed by inhibiting the activity of UBR5, thereby regulating melanin production-related genes and tyrosinase activity. AI-based virtual drug screening technology can be used to verify the function and activity of potential small molecule drugs.
It significantly inhibits melanin production, reduces melanin content and tyrosinase activity, and demonstrates a whitening effect in zebrafish and mouse models, providing a safe and effective treatment for pigmented skin diseases.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of Flavopiridol and its analogues in preparation of medicines for treating pigmentary skin diseases. BACKGROUND
[0002] Flavopiridol (cas: 146426-40-6) is a semi-synthetic flavonoid derived from plant alkaloids, which is a broad-spectrum inhibitor of cyclin-dependent kinases (CDKs) that competitively inhibits the activity of CDK1, CDK2 and CDK4. Flavopiridol hydrochloride (FH) is a hydrochloride salt form of flavopiridol. In skin-related studies, FH may play a role by regulating signaling pathways and inflammatory responses, but there is no related report on the direct regulation of melanocyte function by FH.
[0003] Pigmentary skin diseases are caused by genetic, genetic mutation, external stimulation, drugs, diet and rest, etc. It can cause abnormal differentiation, proliferation and migration of melanocytes in the skin, and disorder of melanin synthesis, secretion and transport. Such skin diseases are very common in dermatology. Although most pigmentary skin diseases do not endanger life, a certain proportion of congenital diseases have the risk of melanoma malignancy. Large lesions in special parts are often difficult to surgically remove and have the risk of disfigurement or dysfunction, which can eventually seriously affect the appearance, daily work, study and life, and even death. It brings huge psychological, physical and economic burden to patients. With people's increasing attention to their physical and mental health and appearance, more and more patients begin to pay attention to early intervention and non-surgical treatment of pigmentary skin diseases. Common pigmentary skin diseases in clinical practice include various types of pigmented nevi (mainly congenital pigmented nevi and giant nevi with the risk of malignancy), melanoma, various pigmented spots (mainly chloasma, freckles, nevus of Ota, post-inflammatory hyperpigmentation, etc.), and pigment loss / hypopigmentation spots (mainly vitiligo, post-inflammatory hypopigmentation, etc.). However, the traditional treatment methods such as surgery, laser and conventional drug treatment have very limited effect, and it is still a great challenge for clinicians to find safe and effective treatment strategies. Therefore, it is urgent to screen new treatment targets, develop new drugs and treatment strategies.
[0004] Melanogenesis is a complex biological process involving melanocyte differentiation, proliferation, migration, and melanin synthesis, secretion, and transport. This process not only determines the color of the skin, hair, and eyes, but is also closely related to a variety of skin diseases, especially in diseases with abnormal melanin deposition. Melanocytes originate from neural crest cells during embryonic period, and they function by migrating to the skin, hair follicles, etc. During differentiation, Wnt signaling pathway, SOX10 and MITF, etc. play an important role in regulating the expression of melanin synthesis enzymes such as tyrosinase (TYR). The differentiation, proliferation, migration, melanin synthesis and transport of melanocytes during melanogenesis are precisely regulated. Any disorder in any link can lead to abnormal deposition or uneven distribution of melanin, and then cause a variety of pigmented skin diseases, such as vitiligo: an autoimmune disease, the immune system attacks melanocytes, leading to loss of skin pigmentation, forming white spots; various pigment spots such as freckles and chloasma, acanthosis nigricans, skin aging and photoaging, etc.; congenital pigmented nevus: abnormal proliferation of melanocytes during embryonic period leads to the formation of pigment deposition area on the skin surface; although most of them are benign, larger congenital pigmented nevus may have the risk of malignant transformation, such as developing into malignant melanoma. In-depth study of these mechanisms not only helps to explain the occurrence of pigmented diseases, but also provides a basis for the development of new treatment strategies.
[0005] UBR5 (also known as EDD1) is an important member of the E3 ubiquitin ligase family, which is involved in the ubiquitin-proteasome pathway to regulate the degradation of various proteins in cells. As an E3 ubiquitin ligase, UBR5 marks proteins for degradation by proteasomes by binding to specific substrates and linking ubiquitin molecules to these proteins, thereby regulating protein homeostasis in cells. UBR5 has a wide range of functions, involving cell cycle control, DNA damage response, gene transcription regulation, signal transduction and other biological processes, and is closely related to a variety of diseases, especially in cancer, neurodegenerative diseases and inflammation-related pathological mechanisms. So far, no study has reported the effect and mechanism of UBR5 on the melanogenic function of melanocytes. SUMMARY
[0006] In view of the deficiencies of the prior art, the purpose of the present application is to clarify the regulatory role of the drug flupenthixol and its analogues in melanogenesis, and to provide a new drug for treating pigmented skin diseases.
[0007] In combination with AI drug virtual screening technology and biological function verification, we found that FH showed good potential in inhibiting the activity of UBR5. Based on the key role of UBR5 in melanogenesis, we speculated that this small molecule inhibitor and its analogues could inhibit the generation of melanin by regulating the expression or function of UBR5, thereby providing a theoretical basis for the development of efficient and safe whitening products. By further exploring the mechanism of UBR5 in pigment generation and screening and verifying the function and activity of potential small molecule drugs, this study provides a new idea for drug development based on the UBR5 target. This research not only expands the application potential of UBR5 in the treatment of pigmentary skin diseases, but also provides a scientific basis for the research and development of new cosmetics and therapeutic drugs.
[0008] The technical scheme of the present application is:
[0009] The present application provides the application of flupirtine and its analogues in the preparation of drugs for treating pigmentary skin diseases.
[0010] Preferably, the analogues of flupirtine include voruciclib, ostruthin or vitexin.
[0011] Preferably, the pigmentary skin diseases include pigmentary skin diseases with increased pigmentation and pigmentary skin diseases with reduced pigmentation.
[0012] Preferably, the pigmentary skin diseases include pigmented nevi, pigment spots, and pigment loss / reduction spots.
[0013] Preferably, the pigmentary skin diseases include pigmented nevi, congenital pigmented nevi, and giant nevi with the risk of malignant change, chloasma, freckles, nevus of Ota, post-inflammatory hyperpigmentation, vitiligo, and post-inflammatory hypopigmentation.
[0014] Further, the pigmentary skin diseases include various types of pigmented nevi (mainly congenital pigmented nevi and giant nevi with the risk of malignant change) and melanoma, various pigment spots (mainly chloasma, freckles, nevus of Ota, post-inflammatory hyperpigmentation, etc.), and pigment loss / reduction spots (mainly vitiligo, post-inflammatory hypopigmentation, etc.).
[0015] The present application also provides the application of flupirtine and its analogues in the preparation of inhibitors or activators for regulating melanogenesis.
[0016] The present application also provides the application of flupirtine and its analogues in the preparation of inhibitors or enhancers for tyrosinase activity.
[0017] The present application also provides the application of flupirtine and its analogues in the preparation of whitening preparations or whitening drugs.
[0018] Further, the analogues of flupirtine include voruciclib, ostruthin or vitexin.
[0019] Further, the said Flupirtine is Flupirtine hydrochloride.
[0020] The experimental results of the present application found that after treating melanocytes and melanoma cells with FH and its analogs, the melanin production ability of the above-mentioned cells decreased significantly, including inhibition of cell proliferation, reduction of melanin content, and significant down-regulation of the expression levels of key genes MITF, TYR, TYRP1, etc. of melanin production, and reduction of tyrosinase activity. Further, in zebrafish embryo models, we observed the strong whitening efficacy and safety of FH. The results of this study suggest that FH and its analogs are expected to become candidate therapeutic drugs for pigmentary skin diseases.
[0021] The detailed structure of the present application is further described below in combination with the accompanying drawings and specific embodiments: BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 is a difference analysis chart of the transcriptome sequencing data of skin tissue (left) and pigmented nevus tissue (right) in the GTEX database, which is converted by log2 and compared between the two groups using wilcox.test to compare the mRNA expression level of UBR5.
[0023] Figure 2 is a detection result chart after knocking out UBR5 in B16F10 cells: among them, Figure 2 A is a color change chart of centrifugal precipitation; Figure 2 B is a chart of detecting changes in melanin content in cells; Figure 2 C is a chart of detecting changes in tyrosinase activity; Figure 2 D is a chart of detecting changes in the expression of important transcription factors MITF and melanin synthesis key proteins TRP1, TRP2 and TYR in cells by Western blot method, Figure 2 E is Figure 2 D is a statistical chart; Figure 2 F, 2G is a chart of detecting the head melanin signal intensity in zebrafish after knocking out UBR5 and its statistical chart;
[0024] Figure 3 is a chart of detecting the detection results after inhibiting the expression of UBR5 by Western blot method; among them Figure 3 A is a chart of the expression of important transcription factors MITF and melanin synthesis key proteins TRP1, TRP2 and TYR in PIG1, MNT1 cells, Figure 3 B, Figure 3 C is a chart of changes in melanin content and tyrosinase activity;
[0025] Figure 4is the detection result chart of Western blot method after overexpression of UBR5; wherein, Figure 4 A is the expression chart of MITF, which is an important transcription factor of melanin synthesis pathway in PIG1, MNT1 cells, and key proteins of melanin synthesis TRP1, TRP2 and TYR, Figure 4 B, Figure 4 C is the statistical chart of changes in melanin content and tyrosinase activity in MNT1 cells.
[0026] Figure 5 is the detection of changes in melanin content in B16F10 cells treated with specific concentration of UBR5 potential small molecule drug.
[0027] Figure 6 A is the 3D chart of EA docking with UBR5 protein, Figure 6 B is the CCK8 method for detecting the proliferation activity of B16F10 cell line cultured with medium containing different concentrations of EA for 24h and 48h.
[0028] Figure 7 A is the Western blot method for detecting the expression level of melanin production related gene proteins such as MITF, TYR, TYRP1 and TYRP1 in B16F10 cell line treated with specific concentration of EA; Figure 7 B, Figure 7 C is the result chart of detecting changes in melanin content and tyrosinase activity at the same time.
[0029] Figure 8 A, Figure 8 B is the observation of zebrafish head melanin signal intensity and its statistical results at 2dpf after zebrafish embryos are cultured with specific concentration of EA. Figure 8 C, Figure 8 D is the observation of changes in mouse tail color for 25 days and its statistical result chart by smearing 2mg / ml hydrogel of EA on the fixed position of mouse tail.
[0030] Figure 9 A, Figure 9 B is the detection of changes in melanin content (A) and tyrosinase activity (B) of B16F10 cell line treated with specific concentration of EA analogues E1, E2 and E3. Figure 9 Figure 9 B).
[0031] Figure 10 A is the 3D chart of FH docking with UBR5 protein, Figure 10 B is the CCK8 method for detecting the proliferation activity of B16F10 cell line cultured with medium containing different concentrations of FH for 24h and 48h.
[0032] Figure 11 A is to treat B16F10 cell line with a specific concentration of FH, Western blot method to detect MITF, TYR, TYRP1, TYRP1 and other melanin production related gene protein expression level chart; Figure 11 B is the result chart of melanin content detection; Figure 11 C is the result chart of detecting the change of tyrosinase activity.
[0033] Figure 12 To culture zebrafish embryos with a specific concentration of FH culture solution, observe the melanin signal intensity of zebrafish head at 2dpf chart ( Figure 12 A) and its statistical result chart ( Figure 12 B).
[0034] Figure 13 To treat B16F10 cell line with specific concentration of FH analog F1, F2, F3, detect melanin content ( Figure 13 A) and tyrosinase activity change chart ( Figure 13 B); Figure 13 C is the molecular docking diagram of voruciclib and UBR5. DETAILED DESCRIPTION Example 1
[0035] 1. Construction of mouse melanocyte cell line with UBR5 gene knockout and Western blot identification.
[0036] 1.1 Group setting:
[0037] sgNC (control group)
[0038] sg Ubr5 (UBR5 gene knockout group)
[0039] 1.2 Experimental method and process:
[0040] (1) lip2000 transfection reagent, 1 μg plasmid (purchased from Fenghui Biological) mixed with 3 μl transfection reagent, room temperature for 15 min;
[0041] (2) Add preselected B16F10 cells, incubate for 6 h, then replace with complete culture medium;
[0042] (3) After 48h, add 1 μg / ml puromycin for screening for one week, and when there are only a few dead cells, take the cells for subsequent detection.
[0043] (4) The sgRNA sequence for UBR5 knockout is:
[0044] #1 GGGTCTGCCTGCGTGAATCA CGG (SED ID NO1)
[0045] #2 CAGACCCGCGTCATCCGCAC CGG (SED ID NO2)
[0046] 1.3 Experimental results:
[0047] By Figure 2 The mouse melanocyte cell line with UBR5 knocked down by the gene D was successfully constructed, and the Western blot identification results showed that the expression amount of UBR5 protein in the gene knockout group was significantly reduced compared with the control group.
[0048] The sgRNA sequence synthesis method, siRNA sequence synthesis, and shRNA sequence synthesis method in the examples are existing methods, and reference can be made to the literature: Bek JW, Shochat C, De Clercq A, De Saffel H, Boel A, Metz J, Rodenburg F, Karasik D, Willaert A, Coucke PJ. Lrp5 Mutant and Crispant Zebrafish Faithfully Model Human Osteoporosis, Establishing the Zebrafish as a Platform for CRISPR-Based Functional Screening of Osteoporosis Candidate Genes. J Bone Miner Res. 2021 Sep;36(9): 1749-1764. doi: 10.1002 / jbmr.4327. Epub 2021 May 19. PMID: 33957005.
[0049] 2. Construction of human melanocyte cell line with UBR5 gene silenced / overexpressed and Western blot identification.
[0050] 2.1 Group setting:
[0051] siNC or Vector (control group)
[0052] si UBR5 or UBR5 OE (UBR5 gene silencing / overexpression group)
[0053] 2.2 Experimental methods and processes:
[0054] Use lip2000 transfection reagent, mix 100 pmol siRNA with 5 μl transfection reagent, and stand at room temperature for 20 min;
[0055] PIG1, MNT1 cells in pre-selected plating were added, and after 6 h of incubation, the liquid was changed;
[0056] (3) After 48 h of culture, the cells were collected for the next step experiment.
[0057] (4) UBR5 silencing siRNA sequence (purchased from Suzhou Jimake Gene Co., Ltd.) is:
[0058] #1 GCAAGGUUGAAUUGUUUCATT (SED ID NO3)
[0059] #2 GGUCAAUAGUAGAGAAGAUTT (SED ID NO4)
[0060] UBR5 overexpression shRNA sequence (purchased from Suzhou Jimake Gene Co., Ltd.) is: ACGUGACACGUUCGGAGAA (SED ID NO5)
[0061] 2.3 Experimental results:
[0062] From Figure 3 A, 4A shows that the construction of human melanocyte cell line with UBR5 gene silencing or overexpression is successful, and the Western blot identification result shows that compared with the control group, the expression amount of UBR5 protein in the gene silencing / overexpression group is significantly decreased / increased.
[0063] 3, After interfering UBR5 gene expression, the expression level of melanin production related genes MITF (microphthalmia-associated transcription factor), TRP1 (tyrosinase related protein 1), TRP2 (tyrosinase related protein 2), TYR (tyrosinase) of melanocytes, melanin content of melanocytes and tyrosinase activity were detected.
[0064] 3.1 Experimental method and process:
[0065] Western Blot: Protein was extracted with RIPA lysis buffer (Cat. No. P0013C, Biyun Tian) and centrifuged at 12000 rpm (rev / min) for 10 min (min) at 4 ℃. The protein concentration was determined by BCA protein assay (Cat. No. P0010S, Biyun Tian) and boiled for 5 min before the experiment. 20 μg of protein sample was loaded per well, separated by 10% SDS PAGE (separation gel), and transferred to a PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibody (TYR, TYRP1, TYRP1, MITF, UBR5) at 4 ℃ overnight. The PVDF membrane was washed with PBST and then incubated with HRP (horseradish peroxidase)-labeled goat anti-rabbit IgG (Cat. No. AS014, abclonal) or anti-mouse IgG (Cat. No. AS003, abclonal) secondary antibody at room temperature for 60 min, and the bound antibody was detected by ECL chemiluminescence (Cat. No. P10300, Xin Saimei).
[0066] wherein BCA: bicinchoninic acid, diquinoline carboxylic acid; PVDF: polyvinylidene fluoride membrane, polyvinylidene fluoride; BSA: bovine serum albumin, bovine serum albumin; ECL: Electrochemiluminescence, electrochemiluminescence.
[0067] (2) Melanin content determination: PIG1, MNT1, B16F10 cells (2.5 x 10 5 cells per 35 mm culture dish) were plated, trypsinized, centrifuged, and the cells were collected, 1 ml 1 mol / L NaOH was heated in a 100 ℃ water bath for 30 min to dissolve the cells, and the absorbance was measured at 470 nm using a microplate reader.
[0068] (3) Tyrosinase activity determination: PIG1, MNT1, B16F10 cells (2.5 x 10 5 cells per 35 mm culture dish) were plated, trypsinized, centrifuged, and the cells were collected, 200 μl 1% tritonX100 (Cat. No. A600198-0500, Shengong) was used to lyse the cells, which were immediately placed in -80 ℃ for 30 min, then taken out and thawed at 37 ℃, centrifuged at 1000g for 10 min, and the supernatant was mixed with L-DOPA (Cat. No. 59-92-7, Aladdin) and incubated at 37 ℃ for 20 min, then the absorbance at 475 nm was detected using a microplate reader.
[0069] 3.2 Experimental results:
[0070] Figure 2DE, 3A, 4A showed that compared with the control group, the expression level of melanin generation related genes MITF, TRP1, TRP2, TYR and other proteins in the gene intervention group changed significantly.
[0071] Figure 2 BC, 3BC, 4BC results showed that compared with the control group, the melanin content and tyrosinase activity in the gene intervention group changed significantly.
[0072] 4. After knocking out UBR5 gene, observe the change of melanin generation ability in zebrafish model.
[0073] 4.1 Group setting:
[0074] sgNC (control group)
[0075] sg Ubr5 (UBR5 gene knockout group)
[0076] 4.2 Experimental methods and procedures:
[0077] (1) The sgRNA sequence for UBR5 knockout is designed as follows:
[0078] #1 GGGTCTGCCTGCGTGAATCA CGG (SED ID NO1),
[0079] #2 CAGACCCGCGTCATCCGCAC CGG (SED ID NO2)
[0080] Co-injection of sgRNA target. The control group is injected with invalid target. Wild type zebrafish embryos were microinjected at 1-cell stage, about 200 embryos were injected in each group, and after 2 dpf, 15 fish were randomly selected from each group to take pictures of the head of zebrafish, and the melanin signal intensity of the head of zebrafish was analyzed to evaluate the difference change of melanin generation.
[0081] 4.3 Experimental results:
[0082] From Figure 2 FG, compared with the control group, after knocking out UBR5, the melanin signal intensity of the head of zebrafish decreased significantly.
[0083] 5. Based on the high-throughput AI virtual screening of UBR5 potential small molecule drugs in the drug library
[0084] 5.1 Experimental methods and procedures:
[0085] Specifically, protein docking can be obtained, and the molecular docking of the target protein and the compound is simulated by using the software Maestro to predict the possible binding sites and interactions. The molecular docking of UBR5 and the compounds in the Seleck compound library (L1200, L1300, L1400, L1700, L1700-1, L3500, L3600, L3800, L3900, L5000, L5800, L7800, L7900) is simulated by using the software Maestro, and the compounds that can be combined with UBR5 are found. 5.2 Experimental results:
[0086] The results show that about 30 small molecule compounds are well combined with the active center of UBR5 enzyme or its surrounding, which indicates that these compounds block or activate the catalytic site of UBR5 to a certain extent, thereby exerting the inhibition or activation effect on the enzyme activity of UBR5. See Table 1 below for details:
[0087]
[0088] 6. Detection of melanin content change of melanocytes after UBR5 potential binding small molecule drug intervention.
[0089] 6.1 Group setting:
[0090] Control (control group)
[0091] GSK369796 dihydrochloride 50 μM (U1 intervention group)
[0092] CP-91149 50 μM (U2 intervention group)
[0093] Cefprozil monohydrate 50 μM (U3 intervention group)
[0094] Cefaclor 50 μM (U4 intervention group)
[0095] Ampicillin 50 μM (U5 intervention group)
[0096] Cefalexin 50 μM (U6 intervention group)
[0097] AZD5363 50 μM (U7 intervention group)
[0098] Ellagic acid 0.25 μM (EA intervention group)
[0099] Flavopiridol 0.1 μM (FH intervention group)
[0100] 6.2 Experimental methods and processes:
[0101] (1) Melanin content determination: B16F10 melanocytes (2.5 x 10 5 cells per 35 mm culture dish) were plated, trypsinized, centrifuged, and the cells were collected. 1 ml of 1 mol / L NaOH was heated at 100 °C for 30 min to lyse the cells. The absorbance was measured at 470 nm using a microplate reader.
[0102] 6.3 Experimental results:
[0103] Figure 5 The results showed that compared with the control group, the melanin content in the U1-U7 intervention group did not change significantly. EA and FH
[0104] groups showed significant differences in melanin content. The results suggest that EA and FH as potential UBR5 binding small molecules exhibit unique melanogenesis inhibition activity.
[0105] Example 2
[0106] 1. Effect of EA (ellagic acid) on the proliferation of melanocyte cell lines.
[0107] 1.1 Group settings:
[0108] Control (control group)
[0109] EA 0.1 μM (EA group concentration 1)
[0110] EA 1 μM (EA group concentration 2)
[0111] EA 10 μM (EA group concentration 3)
[0112] EA 50 μM (EA group concentration 4)
[0113] 1.2 Experimental methods and procedures:
[0114] (1) CCK8 determination: Cells were seeded into 96-well plates at 5 x 10 3 cells per well in 100 µL of medium per well, with blank wells. EA was added at a concentration gradient, and incubation was continued for 24 h and 48 h. After incubation, 10 µL of CCK-8 solution (1:10 ratio with medium) was added to each well. The 96-well plate was returned to the incubator at 37 °C, 5% CO2, and protected from light for 2-3 h. After incubation, the absorbance (OD value) of each well was read at 450 nm using a microplate reader.
[0115] 1.3 Experimental results:
[0116] Figure 6AB shows that EA binds to the active center of UBR5 enzyme or around it, and can significantly inhibit the proliferation of melanocyte lines, and has concentration-dependent and time-dependent.
[0117] 2. Western blot to identify changes in the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR proteins.
[0118] 2.1 Group settings:
[0119] Control (control group)
[0120] EA 0.25 μM 24h (EA intervention group 1)
[0121] EA 0.25 μM 48h (EA intervention group 2)
[0122] 2.2 Experimental methods and procedures:
[0123] (1) Western Blot: Protein was extracted with RIPA lysis buffer (Bi Yun Tian) and centrifuged at 12000 rpm for 10 min at 4 ℃. Protein concentration was determined by BCA protein assay method, and boiled for 5 min before experiment. 20 μg of protein sample was loaded per well, separated by 10% SDS PAGE, and transferred to PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibody (TYR, TYRP1, TYRP1, MiTF, UBR5) at 4 ℃ overnight. The PVDF membrane was washed with PBST, then incubated with HRP-labeled goat anti-rabbit IgG or anti-mouse IgG secondary antibody at room temperature for 60 min, and the bound antibody was detected by ECL chemiluminescence method. (Specific method same as Example 1)
[0124] 2.3 Experimental results:
[0125] From Figure 7 A, Western blot results showed that after EA treatment of B16F10 cells, compared with the control group, the expression of melanin synthesis-related proteins MITF, TYRP1, TYRP2, and TYR proteins in the intervention group was significantly down-regulated.
[0126] 3. Determination of the effect of EA on melanin content and tyrosinase activity of melanocyte lines.
[0127] 3.1 Group settings:
[0128] Control (control group)
[0129] EA 0.25 μM 24h (EA intervention group 1)
[0130] EA 0.25 μΜ 48h (EA intervention group 2)
[0131] 3.2 Experimental methods and procedures:
[0132] (1) Melanin content determination: Melanocyte cell line (2.5 x 10 5 cells per 35 mm culture dish) was plated, trypsinized, centrifuged, and the cells were collected. The cells were lysed by heating in 1 ml of 1 mol / L NaOH at 100°C for 30 min. The absorbance was measured at 470 nm using a microplate reader.
[0133] (2) Tyrosinase activity determination: Melanocyte cell line (2.5 x 10 5 cells per 35 mm culture dish) was plated, trypsinized, centrifuged, and the cells were collected. The cells were lysed by 200 μL of 1% triton X100, immediately placed in -80°C for 30 min, then taken out and thawed at 37°C. Centrifugation was performed at 1000g for 10 min, and the supernatant was incubated with L-DOPA at 37°C for 20 min. The absorbance was then measured at 475 nm using a microplate reader.
[0134] 3.3 Experimental results:
[0135] Figure 7 BC showed that EA could significantly inhibit the melanin content and tyrosinase activity of B16F10 cells.
[0136] 4. In vivo study of the regulatory effect of EA on melanogenesis in zebrafish and mouse tail models.
[0137] 4.1 Group settings:
[0138] Control (control group)
[0139] EA (EA intervention group)
[0140] Gel-vehicle (blank gel group)
[0141] Gel-EA (EA gel group)
[0142] 4.2 Experimental methods and procedures
[0143] (1) Zebrafish melanin detection: 6 hpf wild-type AB strain zebrafish were randomly selected in a 6-well plate, and 30 zebrafish embryos were treated in each well. EA was administered in water (concentration 1.95 μg / ml) while a normal control group was set up, and the volume in each well was 3 mL. After 2 days of treatment at 28°C, 5 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. Image J advanced image processing software was used to analyze and collect data, and the intensity of the melanin signal in the head of the zebrafish was analyzed. The statistical analysis results of this indicator were used to evaluate the whitening efficacy of the sample. The statistical processing results were expressed as mean ± SEM. Statistical analysis was performed using SPSS 26.0 software.
[0144] (2) Mouse tail melanin detection: The mice were randomly divided into three groups. In addition to the control group, blank gel and EA gel were applied to the fixed area of the mouse tail every day. After 25 days of continuous administration, the color change of the drug application area of the mouse tail was observed, and Image J advanced image processing software was used to analyze and collect data, and the mouse tail gray value was analyzed.
[0145] 4.3 Experimental results: Figure 8 It was shown that EA could significantly inhibit the melanin production ability of zebrafish embryos and mouse tail skin.
[0146] 5. Determination of the effect of structural analogs of EA on melanin content and tyrosinase activity of melanocyte cell lines.
[0147] 5.1 Group settings:
[0148] Control (control group)
[0149] E1 (punicoside intervention group)
[0150] E2 (Corilagin intervention group)
[0151] E3 (granatine intervention group)
[0152] 5.2 Experimental methods and procedures
[0153] (1) Cell intervention: B16F10 cell lines were treated with 10 μM punicoside, Corilagin and granatine, respectively, and the cells were trypsinized 24 h later for the next experiment.
[0154] (1) Melanin content determination: B16F10 cells (2.5×10 5 cells per 35 mm culture dish) were plated, trypsinized, centrifuged, and the cells were collected. 1 ml of 1 mol / L NaOH was heated in a 100°C water bath for 30 min to lyse the cells. The absorbance was measured at 470 nm using a microplate reader.
[0155] (2) Tyrosinase activity assay: B16F10 cells (2.5×10⁻⁶) were subjected to tyrosinase activity assay. 5 Cells were seeded in 35 mm culture dishes, digested with trypsin, centrifuged, and collected. Cells were lysed with 200 μl of 1% Triton X100, immediately placed in -80 ℃ for 30 min, removed, and thawed at 37 ℃. After centrifugation at 1000g for 10 min, the supernatant was collected and incubated with L-DOPA at 37 ℃ for 20 min. The absorbance at 475 nm was then measured using a microplate reader.
[0156] 5.3 Experimental Results: Figure 9 AB showed that structural analogues of EA can significantly inhibit melanin content and tyrosinase activity in the B16F10 melanocyte cell line.
[0157] Example 3
[0158] 1. Effects of FH (Frappindyl hydrochloride) on the proliferation of melanocyte lines.
[0159] 1.1 Group settings:
[0160] Control group
[0161] FH 0.1 μM (FH group concentration 1)
[0162] FH 1 μM (FH group concentration 2)
[0163] FH 10 μM (FH group concentration 3)
[0164] FH 50 μM (FH group concentration 4)
[0165] 1.2 Experimental methods and procedures:
[0166] (1) CCK8 assay: Cells were packed at 5 x 10 3 Seeds were inoculated into 96-well plates with 100 µL of culture medium per well, and blank wells were included. A gradient of FH was added, and the plates were incubated for 24 h and 48 h. After incubation, 10 µL of CCK-8 solution (1:10 ratio mixed with the culture medium) was added to each well. The 96-well plates were then returned to an incubator and incubated at 37 °C and 5% CO2 in the dark for 2–3 h. After incubation, the absorbance (OD value) of each well was read at 450 nm using a microplate reader.
[0167] 1.3 Experimental Results:
[0168] Figure 10 AB showed that FH binds to or around the active site of UBR5 enzyme and can significantly inhibit the proliferation of melanocyte lines in a concentration- and time-dependent manner.
[0169] 2. Western blot to identify changes in melanin synthesis related protein MITF, TYRP1, TYRP2, TYR protein expression.
[0170] 2.1 Group Settings:
[0171] Control (control group)
[0172] FH 0.1 μM 24h (FH intervention group 1)
[0173] FH 0.1 μM 48h (FH intervention group 2)
[0174] 2.2 Experimental methods and procedures:
[0175] (1) Western Blot: Protein was extracted with RIPA lysis buffer (Bi Yun Tian) and centrifuged at 12000 rpm for 10 min at 4 ℃. The protein concentration was determined by BCA protein assay method, and boiled for 5 min before experiment. 20 μg of protein sample was loaded per well, separated by 10% SDS PAGE, and transferred to PVDF membrane. After blocking with 5% BSA for 2 h, the membrane was incubated with primary antibody (TYR, TYRP1, TYRP1, MiTF, UBR5) at 4 ℃ overnight. The PVDF membrane was washed with PBST, then incubated with HRP-labeled goat anti-rabbit IgG or anti-mouse IgG secondary antibody at room temperature for 60 min, and the bound antibody was detected by ECL chemiluminescence method. (Specific method same as Example 1)
[0176] 2.3 Experimental results:
[0177] From Figure 11 A shows that after FH treatment of B16F10 cells, Western blot results show that compared with the control group, the expression of melanin synthesis related proteins MITF, TYRP1, TYRP2, TYR in the intervention group is significantly down-regulated.
[0178] 3. Determination of the effect of FH on melanin content and tyrosinase activity of melanocyte cell line.
[0179] 3.1 Group Settings:
[0180] Control (control group)
[0181] FH 0.1 μM 24h (FH intervention group 1)
[0182] FH 0.1 μM 48h (FH intervention group 2)
[0183] 3.2 Experimental methods and procedures:
[0184] (1) Melanin content determination: melanocyte cell line (2.5 x 10 5 cells per 35 mm culture dish) was plated, trypsinized, centrifuged, and the cells were collected. 1 ml of 1 mol / L NaOH was heated in a 100°C water bath for 30 min to dissolve the cells. The absorbance was measured at 470 nm using a microplate reader.
[0185] (2) Tyrosinase activity determination: melanocyte cell line (2.5 x 10 5 cells per 35 mm culture dish) was plated, trypsinized, centrifuged, and the cells were collected. 200 μL of 1% triton X100 was used to lyse the cells, which were immediately placed in -80°C for 30 min, then taken out and thawed at 37°C. 1000g centrifugation for 10 min, the supernatant was taken and incubated with L-DOPA at 37°C for 20 min, then the absorbance at 475 nm was detected using a microplate reader.
[0186] 3.3 Experimental results:
[0187] Figure 11 BC shows that FH can significantly inhibit the melanin content and tyrosinase activity of B16F10 cells.
[0188] 4. In vivo study of the regulatory effect of FH on melanogenesis in zebrafish model.
[0189] 4.1 Group setting:
[0190] Control (control group)
[0191] FH (FH intervention group)
[0192] 4.2 Experimental methods and procedures
[0193] Zebrafish melanin detection: randomly selected 6 hpf wild type AB strain zebrafish in 6 well plates, 30 zebrafish embryos per well were treated. FH was given in water, and a normal control group was set up, with a volume of 3 mL per well. After 2 days of treatment at 28°C, 5 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. Image J advanced image processing software was used to analyze and collect data, and the melanin signal intensity of the zebrafish head was analyzed. The statistical analysis results of this index were used to evaluate the whitening efficacy of the samples. The statistical processing results were expressed as mean ± SEM. Statistical analysis was performed using SPSS 26.0 software.
[0194] 4.3 Experimental results: Figure 12 It is shown that FH can significantly inhibit the melanogenesis ability of zebrafish embryos.
[0195] 5. Determination of the effect of structural analogs of FH on the melanin content and tyrosinase activity of melanocyte cell line.
[0196] 5.1 Group Settings:
[0197] Control (Control Group)
[0198] F1 (voruciclib group)
[0199] F2 (Oroxylin A group)
[0200] F3 (Vicenin-2 group)
[0201] 5.2 Experimental Methods and Procedures
[0202] (1) Cell intervention: B16F10 cell lines were treated with 10 μM voruciclib, oroxylin A and vicenin-2, respectively, and 24 h later the cells were trypsinized for the next step.
[0203] (1) Melanin content determination: B16F10 cells (2.5×10 5 cells per 35 mm dish) were plated, trypsinized, centrifuged, and the cells were collected, 1 ml 1 mol / L NaOH was heated in a 100 ℃ water bath for 30 min to dissolve the cells, and the absorbance was measured at 470 nm using a microplate reader.
[0204] (2) Tyrosinase activity determination: B16F10 cells (2.5×10 5 cells per 35 mm dish) were plated, trypsinized, centrifuged, and the cells were collected, 200 μl 1% triton X100 was used to lyse the cells, which were immediately placed in -80 ℃ for 30 min, then taken out and thawed at 37 ℃, centrifuged at 1000g for 10 min, and the supernatant was incubated with L-DOPA at 37 ℃ for 20 min, then the absorbance at 475 nm was detected using a microplate reader.
[0205] 5.3 Experimental Results:
[0206] Figure 13 AB shows that among the structural analogs of FH, voruciclib can significantly increase the content of pigment and the activity of tyrosinase in B16F10 cells of mice, Figure 13 C suggests that voruciclib interacts with UBR5.
Claims
1. The application of frappindo in the preparation of drugs for treating hyperpigmented skin diseases, wherein the hyperpigmented skin diseases are selected from pigmented nevi, melasma, freckles, nevus of Ota, and post-inflammatory hyperpigmentation.
2. Application of Frapin in the preparation of skin whitening agents.
Citation Information
Patent Citations
Compounds with anti-aging activities
CN104254370A
Application of UBR5 in preparation of medicine for treating pigmented dermatosis
CN119700983A
Pharmaceutical and food composition including Eragrostis genus extracts having antioxidant activity
KR1020160015174A
Treatment of cancer by simultaneous inhibiton of BRAF and restoration or mimicry of p16INK4A activity
US20060134068A1