New application of sildenafil

Abstract

The invention relates to the technical field of biological medicines, and discloses novel application of sildenafil, namely application of sildenafil in preparation of a medicine for treating osteoporosis. The sildenafil can be used for preparing the medicine for treating osteoporosis.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a new use of sildenafil. Background Art

[0002] Osteoporosis is a systemic bone disease. Due to various reasons, bone density and bone quality decrease, bone microstructure is damaged, bone brittleness increases, and fractures are prone to occur. Osteoporosis not only increases the pain of patients, but also brings a heavy burden to their families and society. Studies have shown that in elderly and postmenopausal osteoporosis, the blood vessels in the bone decrease. Other studies have shown that these changes in bone structure are likely related to the impact on the osteogenic differentiation ability of mesenchymal stem cells.

[0003] There are many methods for preventing and treating osteoporosis in clinic. Drug therapy is the simplest, most convenient and effective way to treat osteoporosis. It can effectively reduce the risk of fractures by reducing bone resorption or stimulating bone formation. Among them, bisphosphonates are the most widely used in clinic, but they may also cause some side effects, such as upper gastrointestinal symptoms, renal toxicity, and some rare side effects such as drug-related osteonecrosis of the jaw, atypical femoral fractures, etc. Therefore, it is very necessary to explore new drugs to improve osteoporosis. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a new use of sildenafil. The sildenafil in the present invention can be used in the preparation of a drug for treating osteoporosis, and a low concentration (10 mg / L) of sildenafil is the best in in vitro experimental results.

[0005] The present invention provides a new use of sildenafil, which is the use of the sildenafil in preparing a medicine for treating osteoporosis.

[0006] Furthermore, the daily dosage of sildenafil is 1 mg / kg.

[0007] The invention discloses an application of sildenafil in preparing a medicine for treating osteoporosis by promoting the proliferation of human bone marrow mesenchymal stem cells.

[0008] Furthermore, the daily dosage of sildenafil is 1 mg / kg.

[0009] The embodiments of the present invention have the following technical effects:

[0010] The low concentration of sildenafil in the present invention can promote the proliferation and migration of human bone marrow mesenchymal stem cells (hBMSCs) in vitro and induce the differentiation of human bone marrow mesenchymal stem cells into osteoblasts, so it can be used to treat osteoporosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0012] Figure 1 is a test result diagram of sildenafil concentration provided by the present invention, wherein Figure 1 A in the middle is the structural formula of sildenafil. Figure 1 Figure B is the growth curve of hBMSCs measured by CCK-8 kit. Figure 1 Middle C is a microscopic picture of the Transwell experiment to detect the effect of different concentrations of sildenafil on the migration of hBMSCs. Figure 1 D in the middle is the Transwell experiment to detect the effect of different concentrations of sildenafil on the migration of hBMSCs. Figure 1 Figure E is the quantitative analysis of the migration area of ​​hBMSCs in the scratch assay. Figure 1 Middle F shows the morphological details of hBMSCs in the scratch assay; the scale bar of the Transwell analysis image is 100 μm; the scale bar of the scratch assay analysis image is 500 μm.

[0013] Figure 2 The data provided by the present invention are as follows: Figure 2 A in the middle is the ALP staining result of hBMSCs. Figure 2 B is the ARS staining result of hBMSCs. Figure 2 Figure C is the quantification of ALP activity of hBMSCs. Figure 2 D in the middle is the ARS quantitative result of hBMSCs. Figure 2 Middle E is the relative expression of ALP and RUNX2 mRNA in hBMSCs detected by qRT-PCR after 7 days of culture. Figure 2 Middle F is the relative mRNA expression levels of BGLAP and RUNX2 in hBMSCs detected by qRT-PCR after 14 days of culture.

[0014] Figure 3 The sildenafil provided by the present invention promotes the osteogenic differentiation of human bone marrow mesenchymal stem cells in a nude mouse subcutaneous translocation osteogenic model, wherein Figure 3 A in the middle is H&E staining of PM group and PM+sildenafil group. Figure 3 Middle B is Masson staining of the PM group and PM+sildenafil group; 10× means 10 times, and the scale of the data graph is 500 μm, and 40× means 40 times, and the scale of the data graph is 100 μm.

[0015] Figure 4 The 10 mg / L sildenafil provided by the present invention can inhibit osteoporosis in ovariectomized mice, wherein Figure 4 Middle A is the micro-CT and H&E staining images of the horizontal and coronal planes of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 4 B in the figure is the bone density of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 4 C in the middle is the bone volume fraction of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 4 D in the middle is the number of trabeculae in the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 4 E in the middle is the trabecular thickness of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 4 F in the middle is the bone surface area / bone volume of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 4 Middle G is the trabecular bone separation of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 4 H in the middle is the expression level of bone alkaline phosphatase in the Sham+PBS group, Sham+sildenafil group, OVX+PBS group and OVX+sildenafil group. Figure 4 I in the middle is the expression level of type 1 procollagen N-terminal propeptide in the Sham+PBS group, Sham+sildenafil group, OVX+PBS group and OVX+sildenafil group; wherein, the scale bar of the H&E staining image is 500 μm.

[0016] Figure 5 The 10 mg / L sildenafil provided by the present invention can inhibit osteoporosis in suspended mice, wherein Figure 5 A in the middle is the micro-CT and H&E staining images of the horizontal and coronal planes of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 5 B in the figure is the bone density of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 5 C in the middle is the bone volume fraction of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 5D in the middle is the number of trabeculae in the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 5 E in the middle is the trabecular thickness of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 5 F in the middle is the bone surface area / bone volume of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 5 Middle G is the trabecular bone separation of the Sham+PBS group, Sham+sildenafil group, OVX+PBS group, and OVX+sildenafil group. Figure 5 H in the middle is the expression level of bone alkaline phosphatase in the Sham+PBS group, Sham+sildenafil group, OVX+PBS group and OVX+sildenafil group. Figure 5 I in the middle is the expression level of type 1 procollagen N-terminal propeptide in the Sham+PBS group, Sham+sildenafil group, OVX+PBS group and OVX+sildenafil group; wherein, the scale bar of the H&E staining image is 500 μm.

[0017] Figure 6 The 10 mg / L sildenafil provided by the present invention may promote the osteogenic differentiation of hBMSCs by regulating the TGF-β signaling pathway, wherein: Figure 6 A in the middle is the relative expression of TGF-β1 (transforming growth factor-β1) mRNA in hBMSCs detected by qRT-PCR. Figure 6 Figure B is the relative expression of TGF-β2 (transforming growth factor-β2) mRNA in hBMSCs detected by qRT-PCR. Figure 6 Middle C is the relative expression of TGF-βR1 (transforming growth factor-β type I receptor) mRNA in hBMSCs detected by qRT-PCR. Figure 6 D in the middle is the relative expression of TGF-βR2 (transforming growth factor-β type II receptor) mRNA in hBMSCs detected by qRT-PCR. Figure 6 E in the middle is Western blot detection of protein expression of TGF-β1, TGF-βR2, p-TGF-βR2 (phosphorylated transforming growth factor-β type II receptor), Smad2 / 3, p-Smad2 / 3 (phosphorylated-Smad2 / 3) and GAPDH (glyceraldehyde-3-phosphate dehydrogenase). Figure 6 F in the middle is the quantitative expression of TGF-β1 protein, Figure 6 The middle G is the protein expression quantification of p-TGF-beta R2 / TGF-beta R2. Figure 6 Middle L is the quantitative expression of p-Smad2 / 3 / Smad2 / 3 protein.

[0018] Figure 7 The present invention provides OVX mice injected with sildenafil without toxic reactions in the internal organs, H&E staining of the heart, liver, spleen, lung and kidney of OVX mice in Sham+PBS group, Sham+sildenafil group, OVX+PBS group and OVX+sildenafil group; the scale bar of the H&E staining image is 500 μm.

[0019] Figure 8 The viscera of the suspended mice injected with sildenafil provided by the present invention had no toxic reaction, and H&E staining of the heart, liver, spleen, lung and kidney of the suspended mice in the Sham+PBS group, the Sham+sildenafil group, the OVX+PBS group and the OVX+sildenafil group; the scale bar of the H&E staining image is 500 μm. DETAILED DESCRIPTION

[0020] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0021] In a first aspect, some embodiments of the present invention provide a new use of sildenafil, which is the use of sildenafil in the preparation of a drug for treating osteoporosis.

[0022] In some embodiments, the daily dosage of sildenafil is 1 mg / kg.

[0023] In a second aspect, some embodiments of the present invention provide the use of sildenafil for preparing a drug for treating osteoporosis by promoting the proliferation of human bone marrow mesenchymal stem cells.

[0024] In some embodiments, the daily dosage of sildenafil is 1 mg / kg.

[0025] The following is described in detail with reference to specific embodiments:

[0026] (1) Culture and osteogenesis of human mesenchymal stem cells:

[0027] Human bone marrow mesenchymal stem cells (hBMSCs) were purchased from ScienCell Company (San Diego, CA, USA). Human BMSCs and BMSCs were cultured at 37°C and 5% CO2.

[0028] (2) Preparation of sildenafil concentrate of different concentrations:

[0029] Sildenafil was dissolved in 1‰ dimethyl sulfoxide (DMSO) to obtain a 100 mg / L sildenafil concentrate. Then it was diluted to 1 mg / L, 5 mg / L, 10 mg / L, 20 mg / L, and 40 mg / L. The effects of different concentrations of sildenafil on the osteogenic differentiation of human mesenchymal stem cells were detected to explore the optimal concentration to promote their osteogenic differentiation.

[0030] (3) Cell proliferation assay CCK-8:

[0031] hBMSCs were seeded in 96-well plates, with 2000 cells per well. The cells were cultured in PM cell culture medium (commercially available) and PM cell culture medium containing 1 mg / L, 5 mg / L, 10 mg / L, 20 mg / L and 40 mg / L sildenafil. Three wells of cells with the same treatment were tested on day 0, 1 day, 3 days, 5 days, 7 days and 14 days. Cells were counted using Cell Counting Kit-8 (CCK8, Dojindo Laboratories, Kumamoto, Japan) and the absorbance at 450 nm was detected.

[0032] (4) Scratch test:

[0033] Cells were cultured in six-well plates. When the fusion rate reached nearly 90%, the tip of a 200 μL gun was used to make cell scratches and washed with PBS buffer. Then, serum-free medium (PM cell culture medium with serum components removed) and serum-free medium containing different concentrations of sildenafil were added to the well plates and cultured at 37°C. Observe and photograph with an inverted optical microscope at 0h, 12h and 24h. Cell migration images were analyzed using PS software. The cell migration rate was obtained by the following formula:

[0034] in

[0035] A0 and At are the scratch areas before and after adding serum-free medium, respectively.

[0036] (5) Tranwell experiment:

[0037] 1×10 5 Cells were added to the upper compartment of a transwell chamber with an 8-micron pore filter, and serum-free culture medium (containing different concentrations of sildenafil) was used in the upper compartment. 600 microliters of PM cell culture medium was added to the lower compartment. After 24 hours of culture, it was gently rinsed with PBS buffer. In order to remove the cells that did not migrate, after removing the upper chamber, the upper side of the membrane was wiped with a cotton swab. The membrane was fixed with 4% paraformaldehyde and stained with 0.1% crystal violet for 10 minutes. Five microscopic fields randomly selected in each well were counted to count the number of migrated cells.

[0038] (6) ALP staining and ALP activity quantification:

[0039] After culturing cells in PM cell culture medium, OM cell culture medium (commercially available) or OM cell culture medium containing different concentrations of sildenafil for 7 days, the cells were washed with PBS buffer, fixed with 95% cold ethanol, and then washed with PBS buffer. The cells were stained with an alkaline phosphatase (ALP) staining kit (Beijing, CWBIO, China) according to the manufacturer's instructions. After culturing cells in the same way for 7 days, the cells were gently washed with PBS buffer, lysed on ice with 1% Triton X-100, and centrifuged at 4°C for 30 min at a centrifugal force of 13362g. The total protein concentration was measured using a BCA protein assay kit (Pierce Thermo Scientific, Waltham, MA, USA). Alkaline phosphatase activity was measured using an ALP detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

[0040] (7) Alizarin red staining (ARS) and quantification:

[0041] After culturing for 14 days (hBMSCs) in PM cell culture medium, OM cell culture medium, or OM cell culture medium containing different concentrations of sildenafil, the images were scanned after staining with 2% Alizarin Red S staining solution (Sigma-Aldrich, St. Louis, MO, USA) at room temperature for 10-20 min. For Alizarin Red S quantification, cells were lysed with 100 mM hexadecylpyridinium chloride, and the OD value of each well solution at 490 nm was measured spectrophotometrically.

[0042] (8) qRT-PCR:

[0043] Total RNA of hBMSCs cultured for 7 days was extracted using TRIzol reagent (Invitgen) and reverse transcribed using Prime SCRIPT RT kit (Takara, Tokyo, Japan). Next, quantitative polymerase chain reaction was performed using 7500 real-time polymerase chain reaction detection system (Applied Biosystems, Foster City, CA, USA). The primers used for quantitative polymerase chain reaction are shown in Table 1.

[0044] Table 1 Primer sequences used in the present invention

[0045] Gene Forward Primer Reverse primer GAPDH CGGACCAATACGACCAAATCCG AGCCACATCGCTCAGACACC ALP GACCTCCTCGGAAGACACTC TGAAGGGCTTCTTGTCTGTG RUNX2 TCTTAGAACAAATTCTGCCCTTT TGCTTTGGTCTTGAAATCACA BGLAP AGCAAAGGTGCAGCCTTTGT GCGCCTGGGTCTCTTCACT TGF-β1 CAATTCCTGGCGATACCTCAG GCACAACTCCGGTGACATCAA TGF-βR1 TCAGCTCTGGTTGGTGTCAG ATGTGAAGATGGGCAAGACC TGF-β2 TCAAGAGGGATCTAGGGTGGAA GGCARGCTCCAGCACAGAA TGF-βR2 AATATCCTCTGAAGAACGACCTAA TCCCACCTGCCCACTGTTA

[0046] In Table 1, GAPDH is glyceraldehyde-3-phosphate dehydrogenase; ALP is alkaline phosphatase; RUNX2 is runt-related transcription factor II; BGLAP is bone gamma-carboxyglutamate protein; TGF-β1 is transforming growth factor-β1; TGF-βR1 is transforming growth factor-β type I receptor; TGF-β2 is transforming growth factor-β2; TGF-βR2 is transforming growth factor-β type II receptor.

[0047] (9) In vivo subcutaneous transplantation experiment:

[0048] Twelve 6-week-old female BALB / C nude mice were randomly divided into two groups, 6 mice in each group. The two groups were: PM group (PM cell culture medium only) and PM+10mg / L sildenafil group (PM cell culture medium + 10mg / L sildenafil). hBMSCs were cultured in PM group and PM+10mg / L sildenafil group for 10 days, and the human bone marrow mesenchymal stem cell line cells after 10 days of culture were mixed with tricalcium phosphate carrier and implanted subcutaneously in the back of the above nude mice. After 8 weeks, samples were collected and histological examination and analysis (HE staining, Masson staining, immunohistochemical staining) were performed to examine the osteogenesis and study the effect of sildenafil on the osteogenic differentiation of human bone marrow mesenchymal stem cells in vivo.

[0049] (10) Construction of bilateral ovariectomized (OVX) mouse model and in vivo experiments:

[0050] Animal model construction: C57BL / 6N mice were anesthetized and then intraperitoneally injected with sodium pentobarbital (50 mg / kg). Bilateral ovariectomy (OVX) or sham surgery was performed using standard methods.

[0051] 32 female SPF C57BL / 6N mice (8 weeks old) were divided into 4 groups (n=8): Sham group (mice without bilateral ovariectomy), Sham+sildenafil group (mice without bilateral ovariectomy + injection of sildenafil), OVX group (mice with bilateral ovariectomy), OVX+sildenafil group (mice with bilateral ovariectomy + injection of sildenafil). According to the optimal concentration of 10 mg / L obtained by in vitro experiments, the concentration of sildenafil in the blood of mice was ensured to be 10 mg / L. According to the adult mouse weight of about 25 g and the circulating blood volume of about 2.5 mL, the daily dosage of mice was finally calculated to be 1 mg / kg. Sildenafil was dissolved and dispersed in PBS buffer and then injected into mice. Sildenafil was injected intraperitoneally 3 months after surgery. Once a day, for one month, the control group was injected with the same volume of PBS buffer solution. One month later, the femur was taken for histological examination and analysis (HE staining, Masson staining, immunohistochemical staining) to examine the osteogenesis. At the same time, the heart, liver, spleen, lung and kidney of the mice were taken, and blood was collected.

[0052] (11) Construction of mouse suspension model and in vivo experiments:

[0053] Animal model construction: The mice were suspended by their tails, with their heads tilted 30° downward and their hind limbs elevated for 14 days. The mice were allowed to move freely 360° in the cage.

[0054] 32 mice (8 weeks old) were divided into 4 groups (n=8): Sham group (mice without suspension), Sham + sildenafil group (mice without suspension + sildenafil injection), suspension group (mice treated with suspension), suspension + sildenafil group (mice treated with suspension + sildenafil injection). The daily dosage for each mouse was 1 mg / kg. According to the optimal concentration of 10 mg / L obtained by in vitro experiments, the concentration of sildenafil in the blood of mice was ensured to be 10 mg / L. According to the weight of adult mice of about 25 g and the circulating blood volume of about 2.5 mL, the daily dosage of mice can be calculated to be 1 mg / kg. Sildenafil was dissolved and dispersed in PBS buffer and then injected into mice. Sildenafil or PBS buffer was intraperitoneally injected every day on the 14th day after the tail of the mouse was suspended, and samples were collected after 14 days. Femurs were taken for histological examination and analysis (HE staining, Masson staining, immunohistochemical staining) to examine the osteogenesis. At the same time, the heart, liver, spleen, lungs, and kidneys of the mice were taken, and blood was collected.

[0055] (12) Serum biomarker analysis:

[0056] Blood samples were obtained from the two animal models mentioned above. After blood collection, the whole blood was centrifuged at 3000 rpm for 15 minutes to separate the serum. Serum biomarkers were detected using ELISA kits. Indicators of bone formation: procollagen type 1 N-terminal propeptide (P1NP) and bone alkaline phosphatase (BALP).

[0057] (13) Micro-CT analysis:

[0058] The collected mouse femurs were fixed with 10% formalin for 24 h and then gently washed with PBS buffer solution. The proximal femurs of mice were scanned with a scanning resolution of 8.82 μm, a tube voltage of 60 kV, a tube current of 500 μA, and a scanning time of 1500 ms. Inveon Research Workplace (Siemens, Munich, Germany) was used for analysis and calculation. The following indicators were mainly calculated: bone density (BMD), bone volume / total volume (BV / TV), trabecular number (Tb.N), trabecular thickness (Tb.Th) and trabecular spacing (Tb.Sp).

[0059] (14) RNA-seq:

[0060] Total RNA was extracted using TRIzol reagent. RNA samples were then subjected to strict quality control, mainly using the Agilent 2100bioanalyzer. The library was constructed and, after passing the library test, Illumina sequencing was performed. The core of RNA-seq is the significance analysis of gene expression differences. Specific genes related to the conditions were found, and then the biological significance of these specific genes was further analyzed. The analysis process included quality control, reference genome comparison, quantitative analysis, difference significance analysis, functional enrichment analysis, and other links.

[0061] (15) Western blot:

[0062] Cells were lysed in radioimmunoprecipitation assay (RIPA) buffer supplemented with 1% phosphatase and protease inhibitors (P002, NCM Biotech, Suzhou, China) for 30 min. The cells were centrifuged at 14,000 rpm for 20 min at 4°C and the supernatant was carefully collected. Total protein concentration was determined by BCA protein assay kit. Using a digital protein blotting system, called SimpleWestern blot (Wes Separation Module, ProteinSimple, USA), we measured the expression levels of TGF-β1, TGF-βR2, p-TGF-βR2, Smad2 / 3, and p-Smad2 / 3 proteins. The experimental results were analyzed using Compass software (ProteinSimple). The antibodies used were as follows: GAPDH rabbit polyclonal antibody (HX1832, Huaxing Biotechnology, Beijing, China), anti-TGF-β1 antibody (ab215715, abcam), TGF-βR2 antibody (T56879, abmart), anti-TGF-βR2 (phosphoS225) antibody (ab183037, abcam), anti-smad2+Smad3 antibody [EPR19557-4] (ab202445, abcam), anti-smad2+Smad3 (phospho T8) antibody (ab254407, abcam).

[0063] Results and Analysis:

[0064] exist Figure 1 In the present invention, sildenafil is used for research, and its structural formula is as follows Figure 1 As shown in A. In the present invention, low concentration of sildenafil can promote the proliferation and migration of hBMSCs in vitro. The results of CCK-8 experiments showed that low concentration of sildenafil can promote the proliferation of hBMSCs in vitro, and 10 mg / L has a better effect ( Figure 1 B) In Figure 1 C- Figure 1 In D, the results of the Transwell experiment showed that low concentrations of sildenafil can promote the migration of hBMSCs in vitro, and 10 mg / L has the best effect. Figure 1 E- Figure 1 In F, the results of the cell scratch experiment also verified that low concentration of sildenafil can promote the migration of hBMSCs in vitro, and 10 mg / L has the best effect. In general, low concentration of sildenafil can promote the proliferation and migration of hBMSCs in vitro, and 10 mg / L has the best effect.

[0065] Figure 2 Medium and low concentrations of sildenafil can promote the osteogenic differentiation of hBMSCs in vitro. Figure 2 A and Figure 2 In C, for hBMSCs, after 7 days of culture, ALP staining and quantitative results showed that 5mg / L, 10mg / L, and 20mg / L of sildenafil could promote the osteogenic differentiation of hBMSCs in vitro, among which 10mg / L had the most significant promoting effect. Figure 2 B and Figure 2 In D, for hBMSCs, ARS staining and quantitative experiments were performed after 14 days of culture; the experimental results were similar to those of ALP staining and quantitative results. After 7 days of osteogenic induction, 10 mg / L sildenafil can better promote the expression of hBMSCs osteogenic-related genes (ALP, RUNX2), such as Figure 2 E. After 14 days of osteogenic induction, 10 mg / L was also the optimal concentration to promote the expression of hBMSCs osteogenic-related genes (BGLAP, RUNX2). Figure 2 F. In summary, low concentration of sildenafil can more effectively promote the osteogenic differentiation of hBMSCs in vitro, and 10 mg / L has a better effect.

[0066] Figure 3 In the in vitro experiment, we found that 10mg / L sildenafil can promote the osteogenic differentiation of hBMSCs in vivo. More importantly, 10mg / L is also the optimal concentration to promote the osteogenic differentiation of hBMSCs in vitro. Therefore, we chose 10mg / L for the subsequent in vivo experiments. hBMSCs were cultured in PM and PM with 10mg / L sildenafil added for 10 days, mixed with tricalcium phosphate carrier, and implanted subcutaneously in the back of nude mice. After 2 months, samples were collected and analyzed. HE staining results showed that the PM+sildenafil group had more new bone formation than the PM group ( Figure 3 A). MASSON staining results showed that PM+sildenafil had more new bone formation, while the PM group had more collagen ( Figure 3 B).

[0067] Figure 4 In the study, 10 mg / L sildenafil can inhibit bone loss in OVX mice. In order to further explore whether sildenafil can improve osteoporosis and inhibit bone loss in OVX mice, we divided the mice into the following four groups for experiments: sham+PBS, sham+sildenafil, OVX+PBS, and OVX+sildenafil groups. Different groups of mice were injected with PBS or sildenafil by intraperitoneal injection every day, and samples were taken for micro-CT scanning and HE staining analysis one month later. Compared with the sham+PBS group, the OVX+PBS group had obvious bone loss, indicating that the OVX model was successfully constructed. The results showed that there was no significant difference in the relevant parameters after the sham group mice were injected with PBS and sildenafil. The micro-CT macrograph showed that the bone loss of OVX mice was significantly improved one month after the injection of sildenafil ( Figure 4 A). Through micro-CT analysis, we found that after sildenafil injection in the OVX group, BMD, BV / TV, trabecular thickness and trabecular number increased significantly, while Tb.Sp and BS / BV decreased ( Figure 4 B- Figure 4 G), HE staining of femoral sections showed the same results ( Figure 4 A). At the same time, we took mouse serum for ELISA experiment. The results showed that sildenafil treatment can increase the content of BALP and PINP in the serum of OVX mice ( Figure 4 H- Figure 4 I), thereby inhibiting bone loss in OVX mice. HE staining results of the heart, liver, spleen, lung and kidney of the four groups of mice showed no significant inflammatory response, indicating that 10 mg / L sildenafil has good biological safety ( Figure 7 ).

[0068] Figure 5 In the study, 10 mg / L sildenafil can inhibit bone loss in suspended mice. In order to explore whether sildenafil can inhibit bone loss in weightlessness, we conducted experiments using a mouse suspension model. The mice were divided into two groups: suspension + PBS group and suspension + sildenafil group. After sampling, micro-CT scanning and HE staining analysis were performed. The results were similar to those of the previous experiment. The sildenafil injection group significantly improved bone loss compared with the PBS injection group. The gross image shows that the suspension + sildenafil group has a denser bone structure and more trabeculae than the suspension + PBS group ( Figure 5 A). After intraperitoneal injection of sildenafil in suspended mice, femoral BMD, BV / TV, trabecular thickness and trabecular number increased significantly, while Tb.Sp and BS / BV decreased ( Figure 5 B- Figure 5 G), HE staining results are the same as above ( Figure 5A). Serological test results showed that the levels of BALP and PINP in the serum of mice in the treatment group increased ( Figure 5 H and Figure 5 I). In addition, HE staining was performed on the heart, liver, spleen, lung and kidney sections of mice, and no obvious toxicity and inflammation were observed in either the experimental or control group ( Figure 8 ).

[0069] Figure 6 Sildenafil may promote the osteogenic differentiation of hBMSCs by affecting the TGF-β pathway. In order to explore the potential mechanism by which sildenafil promotes the osteogenic differentiation of hBMSCs, we divided hBMSCs into OM group and OM+sildenafil group, and extracted the RNA of the cells for RNA-seq sequencing analysis 7 days after osteogenic induction. Among these metabolic pathways, we found that the TGF-β signaling pathway was significantly different and was closely related to osteogenesis. The results of qRT-PCR experiments showed that compared with the OM group, the gene expressions of TGF-β1, TGF-β2, TGF-βR1, and TGF-βR2 in the OM+sildenafil group were significantly upregulated ( Figure 6 A- Figure 6 D). Western blot results showed that compared with the control group, the protein expressions of TGF-β1, smad2 / 3, and p-smad2 / 3 in the OM+sildenafil group were significantly increased ( Figure 6 E- Figure 6 H). In summary, the experimental results of this study preliminarily indicate that sildenafil may promote the osteogenic differentiation of hBMSCs by affecting the TGF-β pathway, laying a foundation for further exploration.

[0070] It should be noted that the terms used in the present invention are only for describing specific embodiments, rather than limiting the scope of the present application. As shown in the present specification, unless the context clearly indicates an exception, the words "one", "a", "a kind of" and / or "the" do not specifically refer to the singular, but may also include the plural. The terms "include", "comprise" or any other variant thereof are intended to cover non-exclusive inclusion, so that the process, method or device including a series of elements includes not only those elements, but also includes other elements not explicitly listed, or also includes elements inherent to such process, method or device. In the absence of more restrictions, the elements defined by the sentence "include one..." do not exclude the presence of other identical elements in the process, method or device including the elements.

[0071] It should also be noted that the terms "center", "up", "down", "left", "right", "vertical", "horizontal", "inside", "outside", etc., indicating the orientation or positional relationship, are based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention. Unless otherwise clearly specified and limited, the terms "installed", "connected", "connected", etc. should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be an indirect connection through an intermediate medium, or it can be a connection between the two elements. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the technical solutions of the embodiments of the present invention.

Claims

1. A new use of sildenafil, characterized in that: The application of sildenafil in preparing medicine for treating osteoporosis.

2. The use of sildenafil in the preparation of a drug for treating osteoporosis by promoting the proliferation of human bone marrow mesenchymal stem cells.

Images