Application of PAX 9 agonist in preparation of medicine for preventing or treating squamous cell carcinoma of head and neck

Abstract

The invention provides an application of a PAX 9 agonist in preparation of drugs for preventing or treating squamous cell carcinoma of head and neck. Through cell experiments, stable overexpression of the PAX 9 is established in SNU 1076 cells, the proliferation capacity of cells of a PAX 9 overexpression group and a control group is detected by CCK-8, and the proliferation capacity of the cells of the overexpression group is remarkably weakened. Animal experiments show that the tumor growth in a PAX 9 overexpression group is obviously slowed down by measuring the tumor volume; hE, Ki 67, Bax and Bcl-2 staining results in tumor tissues show that the expression level of the overexpression group ki-67 is remarkably reduced, the expression of the Bax is increased, and the expression of the Bcl-2 is reduced, which indicates that the PAX 9 has an inhibition effect on tumor cell proliferation and promotes the induction of tumor cell apoptosis.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to application of a PAX 9 agonist in the preparation of a method for preventing or treating head and neck squamous cell carcinoma. Background Art

[0002] Head and neck squamous cell carcinoma includes squamous cell carcinoma occurring in the oral cavity, oropharynx, nasopharynx, larynx, and hypopharynx. It is the most common malignant tumor affecting the head and neck, and ranks sixth in incidence, with approximately 930,000 new cases and 467,000 deaths each year (Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries [J]. CA Cancer J Clin, 2021, 71 (3): 209-249.). Epidemiological data released by the National Cancer Center in 2022 showed that there are 130,000 new cases and nearly 70,000 deaths in China each year. The overall incidence rate is highest in the lips, oral cavity, and pharynx, and the incidence rate in men is higher than that in women (Zheng RS, Zhang SW, Zeng HM, et al. Cancer incidence and mortality in China, 2016 [J]. J Natl Cancer Cent, 2022, 2 (1): 1-9.). Head and neck squamous cell carcinoma (HNSCC) accounts for about 90% of head and neck malignant tumors, and 70% to 80% of HNSCC patients are already in the locally advanced stage at the time of initial diagnosis. The recurrence rate of patients with locally advanced disease within 2 years after comprehensive treatment is as high as 40% to 60%.

[0003] (Lorch JH, Goloubeva O, Haddad RI, et al. Induction chemotherapy with cisplatin and fluorouracil alone or in combination with docetaxel in locally advanced squamous-cell cancer of the head and neck: long-term results of the TAX324 randomised phase 3 trial [J]. Lancet Oncol, 2011, 12 (2): 153-159.). For patients with recurrent or metastatic head and neck squamous cell carcinoma, the median survival time after traditional chemotherapy or targeted therapy is about 1 year (Winquist E, Agbassi C, Meyers BM, et al. Systemic therapy in the curative treatment of head and neck squamous cell cancer: a systematic review [J]. J Otolaryngol Head Neck Surg, 2017, 46 (1): 29.).

[0004] The biological behavior, clinical manifestations, response to treatment, and prognosis of head and neck squamous cell carcinoma show significant heterogeneity, and the high invasiveness of head and neck squamous cell carcinoma hinders the improvement of patients' overall survival. Therefore, in-depth understanding of its etiology and pathogenesis, as well as the identification of new diagnostic and prognostic biomarkers and molecular targets for therapeutic intervention, are of great clinical significance for improving its prognosis. Summary of the invention

[0005] In order to solve the problems in the prior art, the present invention provides use of a PAX 9 agonist in the preparation of a method for preventing or treating head and neck squamous cell carcinoma.

[0006] To achieve the above object, the technical solution of the present invention is:

[0007] Use of PAX 9 agonist in the preparation of a method for preventing or treating head and neck squamous cell carcinoma.

[0008] PAX 9 gene encodes a transcription factor that plays an important role in embryonic development and organ formation. Studies have found that PAX 9 plays an important role in the initiation and differentiation of teeth (Chu KY, Wang YL, Chen JT, Lin CH, Yao CJ, Chen YJ, Chen HW, Simmer JP, Hu JC, Wang SK. PAX9 mutations and genetic synergisminfamilial tooth agenesis. Ann N Y Acad Sci. 2023 Jun; 1524 (1): 87-96.; Bhol CS, Mishra SR, Patil S, Sahu SK, Kirtana R, Manna S, Shanmugam MK, Sethi G, Patra SK, Bhutia SK. PAX9 reactivation by inhibiting DNAmethyltransferase triggers antitumor effect in oral squamous cell carcinoma. Biochim Biophys Acta Mol Basis Dis. 2022 Sep

[0009] 1; 1868(9):166428.). The PAX 9 sequence is as follows:

[0010] ATGGAGCCAGCCTTCGGGGAGGTGAACCAGCTGGGAGGAGTGTTCGTGAACGGG

[0011] AGGCCGCTGCCCAACGCCATCCGGCTTCGCATCGTGGAACTGGCCCAACTGGGCA

[0012] TCCGACCGTGTGACATCAGCCGCCAGCTACGGGTCTCGCACGGCTGCGTCAGCAA

[0013] GATCCTGGCGCGATACAACGAGACGGGCTCGATCTTGCCAGGAGCCATCGGGGGC

[0014] AGCAAGCCCCGGGTCACTACCCCCACCGTGGTGAAACACATCCGGACCTACAAGC

[0015] AGAGAGACCCCGGCATCTTCGCCTGGGAGATCCGGGACCGCCTGCTGGCGGACG

[0016] GCGTGTGCGACAAGTACAATGTGCCCTCCGTGAGCTCCATCAGCCGCATTCTGCG

[0017] CAACAAGATCGGCAACTTGGCCCAGCAGGGTCATTACGACTCATACAAGCAGCAC

[0018] CAGCCGACGCCGCAGCCAGCGCTGCCCTACAACCACATCTACTCGTACCCCAGCC

[0019] CTATCACGGCGGCGGCCGCCAAGGTGCCCACGCCACCCGGGGTGCCTGCCATCCC

[0020] CGGTTCGGTGGCCATGCCGCGCACCTGGCCCTCCTCGCACTCCGTCACCGACATC

[0021] CTGGGCATCCGCTCCATCACCGACCAAGTGAGCGACAGCTCCCCCTACCACAGCC

[0022] CCAAGGTGGAGGAGTGGAGCAGCCTGGGCCGCAACAACTTCCCCGCCGCCGCCC

[0023] CGCACGCGGTGAACGGGTTGGAGAAGGGAGCCCTGGAGCAGGAAGCCAAGTAC

[0024] GGTCAGGCACCAAATGGTCTCCCAGCTGTGGGCAGTTTTGTGTCAGCATCCAGCA

[0025] TGGCTCCTTACCCTACCCCAGCCCAAGTGTCGCCTTACATGACCTACAGTGCTGCT

[0026] CCTTCTGGTTATGTTGCTGGACATGGGTGGCAACATGCTGGGGGCACCTCATTGTC

[0027] TCCCCACAACTGTGACATTCCGGCATCGCTGGCGTTCAAGGGAATGCAGGCAGCC

[0028] AGAGAAGGTAGTCATTCTGTCACGGCTTCCGCGCTCTGA.

[0029] According to one embodiment of the present invention, the use is to inhibit the proliferation, invasion, migration and tumor formation ability of head and neck squamous cell carcinoma cells.

[0030] Beneficial effects:

[0031] The present invention provides the use of a PAX 9 agonist in the preparation of a method for preventing or treating head and neck squamous cell carcinoma. The present invention establishes stable overexpression of PAX 9 in SNU 1076 cells through cell experiments, and uses CCK-8 to detect the proliferation ability of cells in the PAX 9 overexpression group and the control group, and the proliferation ability of cells in the overexpression group is significantly weakened. The cell experiment of the present invention shows that the cloning ability of SNU1076 cells overexpressing PAX9 is significantly reduced, the migration ability of cells overexpressing PAX 9 is significantly reduced within 24 hours, and the migration ability and invasion of cells overexpressing PAX 9 are significantly reduced. The inventors also revealed the upregulation of the pro-apoptotic protein Bax and the relative downregulation of the anti-apoptotic protein Bcl-2 in the PAX9 overexpression group of SNU 1076 cells through Western blotting and qPCR analysis, indicating that PAX 9 can promote the apoptotic process in SNU 1076. The inventors also established a subcutaneous xenograft model of SNU 1076 cells overexpressing PAX 9, and demonstrated a significant deceleration of tumor growth in the PAX 9 overexpression group by measuring tumor volume; while the HE, Ki 67, Bax and Bcl-2 staining results in the tumor tissue showed that the expression level of Ki-67 in the overexpression group was significantly reduced, Bax expression was increased, and Bcl-2 expression was decreased, indicating that PAX 9 has an inhibitory effect on tumor cell proliferation and promotes the induction of tumor cell apoptosis.

[0032] Studies have found that PAX 9 overexpression has an important effect on the proliferation, invasion, migration and tumor formation of head and neck squamous cell carcinoma cells, and PAX 9 agonists have the potential to be used to prevent or treat head and neck squamous cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The figure shows the result of establishing stable overexpression of PAX 9 in SNU 1076 cells;

[0034] Figure 2 This is the result of using CCK-8 to detect the proliferation ability of cells in the PAX 9 overexpression group and the control group;

[0035] Figure 3 This is a graph showing the clone-forming ability of SNU1076 cells overexpressing PAX9;

[0036] Figure 4 This is the result graph of the migration ability of cells overexpressing PAX 9 within 24 hours;

[0037] Figure 5 This is the result graph of the migration and invasion ability of cells overexpressing PAX 9;

[0038] Figure 6 This is the result of up-regulation of pro-apoptotic protein Bax and relative down-regulation of anti-apoptotic protein Bcl-2 in the PAX9 overexpression group;

[0039] Figure 7 This is a graph showing the results of a subcutaneous xenograft model of SNU 1076 cells overexpressing PAX 9;

[0040] Figure 8 Representative images of HE, Ki 67, Bax, and Bcl-2 staining patterns in tumor tissues. DETAILED DESCRIPTION

[0041] The present invention is described in detail below by specific examples. It is pointed out that the following examples are only used to further illustrate the present invention and cannot be understood as limiting the scope of protection of the present invention. Those skilled in the art can make some non-essential improvements and adjustments to the present invention based on the above invention content. The raw materials and reagents used in the present invention are all commercially available products.

[0042] Example 1 Cell experiment

[0043] 1. The human laryngeal squamous cell carcinoma cell line (SNU 1076) was divided into two groups: a control group (transfected with a control lentiviral vector) and a PAX 9 overexpression group (transfected with a lentiviral vector-mediated PAX 9 overexpression). SNU1076 cells under optimal growth conditions were cultured at 7.5×10 4 The cells were seeded at a density of 10 cells / well in a 6-well plate. 24 hours after seeding, when the cell confluence reached about 30%, the lentivirus was transfected using MOI=50. In order to improve the transfection efficiency, polybrene was added at a concentration of 5ug / ml. 24 hours after lentiviral transfection, the culture medium was replaced with complete culture medium and then changed every day. 72 hours after transfection, a transfection efficiency of about 70% was achieved under fluorescence microscopy, and puromycin at a concentration of 5ug / ml was introduced to select resistant cells. After two rounds of screening, the puromycin concentration was halved, while selection continued to obtain a stable cell line for subsequent experiments.

[0044] 2. Total protein was extracted from laryngeal squamous cell carcinoma cell lines and its concentration was determined using a BCA protein concentration assay kit according to the manufacturer's instructions. Subsequently, equal volumes of protein (30 μg) were separated by electrophoresis on a 12% SDS-PAGE gel and then transferred to a 0.22 μm PVDF membrane. The membrane was sealed in a fast sealing solution for 15 minutes at room temperature. It was then incubated with anti-PAX 9 antibody (1:500; #AG2804, Beyotime), BAX antibody (1:500; #WL01637, Wan LeiBiotech), bcl-2 antibody (1:500; #WL01556, Wan Lei Biotech), and β-actin antibody (1:2000; #R23613 Zenbio). After washing with TBST three times for 10 minutes each time, the membrane was incubated with a secondary antibody (#A0208, Beyotime) for 2 hours at room temperature and then washed three times with TBST for 10 minutes each time. Finally, enhanced chemiluminescence (ECL, P0018AS, Beyotime) was used to detect protein signals. The relative protein expression levels were normalized to those of β-actin and automatically quantified using ImageJ software.

[0045] 3. According to the different culture time, the overexpression group and the vector group were divided into 5 experimental groups, namely 24-hour group, 48-hour group, 72-hour group, 96-hour group and 120-hour group. 3 / well) were inoculated in a 96-well culture plate for incubation. Subsequently, CCK-8 (C 0041; Beyotime; China) was added to the corresponding group at each corresponding time point of 24h, 48h, 72h, 96h and 120h, with a volume of 10μl / well. After incubation at 37°C in an incubator for 4 hours, the absorbance value at 450nm was measured using SpectraMax iD 5 (Molecular Devices).

[0046] 4. The horizontal migration ability of laryngeal squamous cell carcinoma was evaluated by wound healing assay. 6 Cells were seeded evenly onto 6-well plates at a density of 10 cells / well. After 24 h, the scratch area was observed and compared by culturing the cells in serum-free medium for another 24 h. To determine vertical migration and invasion capabilities, Transwell assays were used. For migration experiments, a total of 2 × 10 5Cells were seeded into the upper chamber of the Transwell, which had an 8 μm pore membrane in a volume of 200 μl, while the lower chamber contained 600 μl of culture medium supplemented with 20% FBS. After 24 hours of culture, cells that migrated to the lower surface were fixed, stained with a solution containing 0.5% crystal violet, and then photographed and counted. To evaluate the invasion ability, a gel matrix (C 0372; beyotime; China) was applied to the Transwell membrane before a procedure similar to that used in the migration assay.

[0047] Experimental results:

[0048] To investigate the specific role of PAX 9 in laryngeal squamous cell carcinoma, the inventors selected the SNU 1076 cell line, which has a relatively low expression level of PAX 9 compared to other HNSCC cell lines. First, the inventors successfully established stable overexpression of PAX 9 in SNU 1076 cells, which was confirmed by Western blot analysis ( Figure 1 In addition, the proliferation ability of cells in the PAX 9 overexpression group was significantly weakened ( Figure 2 ), and their colony-forming ability was significantly reduced ( Figure 3 In addition, it was observed that in cells overexpressing PAX 9, the migration ability ( Figure 4 ) and invasive ability ( Figure 5 ) were significantly decreased. These findings suggest that PAX 9 may play a tumor suppressor function in HNSCC by participating in processes such as cell proliferation, migration, and invasion. Further studies by Western blot analysis revealed the upregulation of the pro-apoptotic protein Bax and the relative downregulation of the anti-apoptotic protein Bcl-2 in the overexpression group of SNU 1076 cells ( Figure 6 ), indicating that PAX 9 can promote the apoptotic process in SNU 1076. The results of this study showed that PAX 9 has an inhibitory effect on the proliferation, migration, and invasion of SNU 1076 cells, while promoting apoptosis of these cells.

[0049] Figure 1 Stable overexpression of PAX 9 was established in SNU 1076 cells, which was confirmed by western blot and qPCR analysis.

[0050] Figure 2 CCK-8 was used to detect the proliferation ability of cells in the PAX 9 overexpression group and the control group. The proliferation ability of cells in the overexpression group was significantly weakened.

[0051] Figure 3 This indicates that the clone-forming ability of SNU1076 cells overexpressing PAX9 is significantly reduced.

[0052] Figure 4This indicates that the migration ability of cells overexpressing PAX 9 was significantly reduced within 24 hours.

[0053] Figure 5 This indicates that the migration and invasion ability of cells overexpressing PAX 9 are significantly reduced.

[0054] Figure 6 Western blot and qPCR analysis revealed upregulation of the pro-apoptotic protein Bax and relative downregulation of the anti-apoptotic protein Bcl-2 in the PAX9-overexpressing group of SNU 1076 cells, indicating that PAX 9 can promote the apoptotic process in SNU 1076.

[0055] Example 2 Animal Experiment

[0056] Establishment of nude mouse xenograft tumor model: The control group (SNU 1076 cells transfected with control vector) was cultured at 1×10 7 The xenograft mouse subcutaneous tumor model was established by subcutaneously inoculating nude mice with a concentration of 1 cell / cell (150 μl cell suspension). The tumor size (length L and width W) was measured weekly, and the tumor volume V was calculated using the formula V=L×W2 / 2 to obtain the tumor survival curve. After four weeks, the mice were euthanized by anesthesia followed by asphyxiation with high concentrations of CO2. Tumor tissues were resected for immunohistochemical analysis to determine the expression levels of Ki-67, Bax, and Bcl-2.

[0057] SPSS 21.0 software was used to process the data. The measured data were expressed as mean ± standard deviation (SD) and statistically analyzed using t-test. A p value less than 0.05 was considered statistically significant.

[0058] Experimental results:

[0059] Investigating the effect of PAX9 on subcutaneous tumor formation in vivo: The inventors established a subcutaneous xenograft model of SNU 1076 cells overexpressing PAX 9, demonstrating a significant deceleration of tumor growth in the PAX 9 overexpression group, showing a statistically significant difference. In addition, a significant decrease in ki-67 expression levels was observed in tumor tissues from the overexpression group, which is consistent with the results obtained from in vitro experiments. In addition, in tumor tissues from the overexpression group, Bax expression increased and Bcl-2 expression decreased. In vivo experiments also demonstrated that PAX 9 has an inhibitory effect on tumor cell proliferation and promotes the induction of tumor cell apoptosis.

[0060] Figure 7 A subcutaneous xenograft model of SNU 1076 cells overexpressing PAX 9 was established. The significant slowing down of tumor growth in the PAX 9 overexpression group was demonstrated by measuring tumor volume. Figure 8It is a representative picture of HE, Ki 67, Bax and Bcl-2 staining patterns in tumor tissues. In the overexpression group, the expression level of Ki-67 was significantly reduced, the expression of Bax was increased, and the expression of Bcl-2 was decreased, indicating that PAX 9 has an inhibitory effect on tumor cell proliferation and promotes the induction of tumor cell apoptosis.

Claims

1. Application of PAX 9 agonists in the preparation and prevention or treatment of squamous cell carcinoma in the head and neck; the PAX 9 sequence is as follows: ATGGAGCCAGCCTTCGGGGAGGTGAACCAGCTGGGAGGAGTGTTCGTGAACGGGAGCCGCTGCCCAACGCCATCCGGCTTCGCATCGTGGAACTGGCCCAACTGGGCATCCGACCGTGTGACATCAG CCGCCAGCTACGGGTCTCGCACGGCTGCGTCAGCAAGATCCTGGCGCGATACAACGAGACGGGCTCGATCTTGCCAGGAGCCATCGGGGCAGCAAGCCCCGGGTCACTACCCCCACCGTGGTGAAAC ACATCCGGACCTACAAGCAGAGAGACCCCGGCATCTTCGCCTGGGAGATCCGGGACCGCCTGCTGGCGACGGCGTGTGCGACAAGTACAATGTGCCCTCCGTGAGCTCCATCAGCCGCATTCTGCGC AACAAGATCGGCAACTTGGCCCAGCAGGGTCATTACGACTCATACAAGCAGCACCAGCCGCCGCAGCCAGCCAGCGCTGCCTACAACCACATCTACTCGTACCCCCAGCCCTATCACGGCGGCCGCC AAGGTGCCACGCCACCCGGGGTGCCTGCCATCCCCGGTTCGGTGGCCATGCCGCACCTGGCCCTCCTCTCGCACTCCGTCACCGACATCCTGGGCATCCGCTCCATCACCGACCAAGTGAGCGACAG CTCCCCCCCTACCACAGCCCAAGGTGGAGGAGTGGAGCAGCCTGGGCCGCAACAACTTCCCCGCCGCCGCACGCGGTGAACGGGTTGGAGAAGGGAGCCCTGGAGCAGGAAGCCAAGTACGGTCA GGCACCAAATGGTCTCCCAGCTGTGGGCAGTTTTGTGTCAGCATCCAGCATGGCTCCCTTACCCTACCCCAGCCCAAGTGTCGCCTTACATGACCTACAGTGCTGCTCCCTTCTGGTTATGTTGCTGGAC ATGGGTGGCAACATGCTGGGGCACCTCATTGTCTCCCCCACAACTGTGACATTCCGCATCGCTGGCGTTCAAGGGAATGCAGCCAGAGAAGGTAGTCATTCTGTCACGGCTTCCGCGCTCTGA.

2. The application of claim 1, Its characteristics are: The application is to inhibit the proliferation ability of squamous cell carcinoma cells in the head and neck.

3. The application of claim 1, Its characteristics are: The application is to inhibit the invasion of squamous cell carcinoma cells in the head and neck.

4. The application of claim 1, Its characteristics are: The application is to inhibit the migration ability of squamous cell carcinoma cells in the head and neck.

5. The application of any one of claims 1-4, Its characteristics are: The application is to inhibit the tumor formation ability of squamous cell carcinoma in the head and neck.

Images