Magnetic stimulation system and method for regulating and controlling neural development and application of magnetic stimulation system and method

Abstract

The invention relates to a magnetic stimulation system and method for regulating and controlling neural development and application of the magnetic stimulation system and method. The system comprises a parameter setting module used for setting parameters of magnetic stimulation; the magnetic stimulation module is used for performing magnetic stimulation on a target based on the parameters set by the parameter setting module; parameters of the magnetic stimulation comprise frequency, stimulation intensity, pulse duration, daily stimulation time and stimulation days. According to the invention, the key effect of the magnetic stimulation system and method in the neural stem cells cultured in vitro in neural development is proved, and a theoretical foundation is laid for clinical application and development of magnetic stimulation.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology and relates to a magnetic stimulation system, method and application thereof for regulating neural development. Background Art

[0002] Magnetic stimulation technology, especially transcranial magnetic stimulation (TMS), plays an increasingly important role in the treatment and research of neurological diseases. For example, it is used to treat neurodegenerative diseases: repetitive transcranial magnetic stimulation (rTMS) has shown potential in the treatment of neurodegenerative diseases. Studies have shown that rTMS can improve the motor function of patients with Parkinson's disease, and in the treatment of Alzheimer's disease, high-frequency rTMS has a significant effect on improving cognitive function; used to treat neurodevelopmental disorders: TMS technology has also been used to treat neurodevelopmental disorders in children, such as autism spectrum disorder and attention deficit hyperactivity disorder (ADHD), showing certain efficacy; used to treat dystonia: transcranial magnetic stimulation has also shown certain application value in the treatment of dystonia. Through different stimulation parameters and the selection of stimulation sites, it can have a positive effect on the patient's symptoms; used to treat spinal cord injury: the application of TMS in spinal cord injury rehabilitation is also being studied, and it may promote rehabilitation by regulating brain activity; neuroplasticity: TMS can induce plastic changes in specific areas of the brain, which has potential value for post-stroke rehabilitation, depression and other neuropsychiatric diseases. These applications show that magnetic stimulation technology has broad application prospects in the field of neuroscience, but the mechanism of action of magnetic stimulation on the central nervous system is still under study, and more research is still needed to optimize magnetic stimulation schemes and mechanisms.

[0003] Different magnetic stimulation parameters have different effects on the central nervous system. These parameters include stimulation intensity, frequency, duration, stimulation mode (such as single pulse or repeated pulse), stimulation coil type, etc. At present, it is not clear how these parameters affect the central nervous system. For example, some studies have found that the effect of a steady magnetic field of 5 to 60 mT can significantly inhibit the differentiation of midbrain nerve cells, but some studies have suggested that 5 Hz and 20 Hz sinusoidal alternating magnetic fields (8 mT) can promote the directional differentiation of NSC into neurons, which suggests that the mechanism of action of a constant magnetic field and an alternating magnetic field may be different. Therefore, how to design and develop effective magnetic stimulation strategies and personalized magnetic stimulation programs is one of the problems that urgently need to be solved in the field of magnetic stimulation technology. Summary of the invention

[0004] In view of the deficiencies in the prior art and actual needs, the present invention provides a magnetic stimulation system, method and application for regulating neural development. The specific magnetic stimulation system and method are used to confirm the key role of neural stem cells in neural development in vitro, laying a theoretical foundation for the clinical application and development of magnetic stimulation.

[0005] To achieve this object, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides a magnetic stimulation system for regulating neural development, the system comprising:

[0007] A parameter setting module, used to set the parameters of magnetic stimulation;

[0008] a magnetic stimulation module, configured to perform magnetic stimulation on a target based on the parameters set by the parameter setting module;

[0009] The parameters of the magnetic stimulation include frequency, stimulation intensity, pulse duration, stimulation time per day and number of stimulation days.

[0010] The present invention utilizes a specific magnetic stimulation system and method to confirm its key role in neural development in in vitro cultured neural stem cells, and further designs a magnetic stimulation system that controls specific parameters to achieve effective promotion of neural development, which is specifically manifested in a significant increase in synapse-related proteins. Under the intervention of a pulsed electromagnetic field, the expression levels of synaptophysin and postsynaptic density protein 95 are upregulated; the genes related to maintaining stemness (SOX6 and Oct4) are significantly downregulated, and it is found that pulsed electromagnetic intervention promotes the maturation of the electrical activity of nerve cells, laying a theoretical foundation for the clinical application and development of magnetic stimulation.

[0011] Preferably, the magnetic stimulation is in the form of pulsed electromagnetic stimulation (PEMF).

[0012] Preferably, the stimulation coil type of the magnetic stimulation may be a Helmholtz coil.

[0013] Preferably, the frequency is 5 to 50 Hz, for example, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48 or 49 Hz.

[0014] Preferably, the stimulation intensity is 1 to 5 mT, for example, it can be 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 4.6, 4.7, 4.8 or 4.9 mT.

[0015] Preferably, the pulse duration is 2 to 5 ms, for example, it may be 2.1, 2.2, 2.3, 2.4, 2.5, 3, 3.5, 4, 4.5, 4.6, 4.7, 4.8 or 4.9 ms.

[0016] Preferably, the daily stimulation time is 2 to 6 hours, for example, it can be 2.1, 2.2, 2.3, 2.4, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 5.6, 5.7, 5.8 or 5.9 hours, etc., and the number of stimulation days is 6 to 10 days, for example, it can be 7, 8 or 9 days, etc.

[0017] Preferably, the targets comprise neural stem cells.

[0018] Preferably, the neural stem cells include iPSCs in which pTet-O-Ngn2-puro and FUdeltaGW-rtTA are integrated into the genome.

[0019] Preferably, under neuronal culture conditions, neurogenin 2 (Ngn2) mediates the neural differentiation of iPSCs, which is mainly divided into two stages: stage one: the neural precursor cell generation process; stage two, the neural differentiation process, and magnetic stimulation can be performed on the cells in the neural differentiation process.

[0020] In the present invention, the device / apparatus for performing magnetic stimulation may be a power supply, a two-channel digital oscilloscope, an arbitrary wave signal generator and a Helmholtz coil.

[0021] In the present invention, performing magnetic stimulation may include placing the target in a Helmholtz coil to perform pulsed electromagnetic stimulation (PEMF).

[0022] In a second aspect, the present invention provides a magnetic stimulation method for regulating neural development, the method comprising performing magnetic stimulation on a target, wherein the parameters of the magnetic stimulation include frequency, stimulation intensity, pulse duration, daily stimulation time and number of stimulation days.

[0023] Preferably, the frequency is 5 to 50 Hz, the stimulation intensity is 1 to 5 mT, the pulse duration is 2 to 5 ms, the daily stimulation time is 2 to 6 hours, and the number of stimulation days is 6 to 10 days.

[0024] In the present invention, a specific magnetic stimulation method is designed to promote the development of nerves (such as human induced pluripotent stem cells mediated by Ngn2), which can provide a reference for the clinical application and development of magnetic stimulation. It can also be applied to non-disease treatment fields, such as in vitro culture to induce the development of nerve cells, construct experimental models, conduct basic research on neural development, etc.

[0025] In a specific embodiment of the present invention, ngn2-mediated iPSCs can be cultured and magnetically stimulated at the neural differentiation stage, and the cultured cells are placed in a Helmholtz coil for pulsed electromagnetic stimulation (PEMF). After testing, low frequency (5-50 Hz), low intensity (1-5 mT), pulse duration (2-5 ms), daily action time 2-6 h, and continuous pulse electromagnetic stimulation for 6 to 10 days are achieved.

[0026] In a third aspect, the present invention provides the use of the magnetic stimulation system for regulating neural development described in the first aspect or the magnetic stimulation method for regulating neural development described in the second aspect in promoting neural development.

[0027] In a fourth aspect, the present invention provides the use of the magnetic stimulation system for regulating neural development described in the first aspect or the magnetic stimulation method for regulating neural development described in the second aspect in promoting the expression of synaptophysin and / or postsynaptic density protein 95 in nerves.

[0028] In a fifth aspect, the present invention provides the use of the magnetic stimulation system for regulating neural development described in the first aspect or the magnetic stimulation method for regulating neural development described in the second aspect in inhibiting the expression of genes related to maintaining stemness in nerves.

[0029] Preferably, the stemness maintenance-related genes include the SOX6 gene and / or the OCT4 gene.

[0030] In a sixth aspect, the present invention provides the use of the magnetic stimulation system for regulating neural development described in the first aspect or the magnetic stimulation method for regulating neural development described in the second aspect in promoting the maturation of electrical activity of nerve cells.

[0031] In the present invention, it is found that the design of a specific magnetic stimulation system and method can promote a significant increase in synapse-related proteins during neural development. Specifically, under the intervention of a pulsed electromagnetic field, the expression levels of synaptophysin and postsynaptic density protein 95 are upregulated; the genes related to maintaining stemness (SOX6, OCT4) are significantly downregulated. In addition, it is found that pulsed electromagnetic intervention promotes the maturation of electrical activity of nerve cells, which can provide a reference for the clinical application and development of magnetic stimulation, and can also be applied to non-disease treatment fields, such as for culturing nerve cells in vitro, or constructing cell models with different characteristics (such as high expression of the SOX6 gene), etc.

[0032] Compared with the prior art, the present invention has at least the following beneficial effects:

[0033] The present invention utilizes a specific magnetic stimulation system and method to confirm its key role in neural development in in vitro cultured neural stem cells, and designs specific pulse electromagnetic stimulation parameters to promote neural development, which is manifested in a significant increase in synapse-related proteins, specifically up-regulated expression of synaptophysin and postsynaptic density protein 95 under the intervention of a pulsed electromagnetic field; significantly down-regulated genes related to maintaining stemness (SOX6, OCT4); it is also found that pulsed electromagnetic intervention promotes the maturation of electrical activity of iPSC-derived neurons, laying a theoretical foundation for the clinical application and development of magnetic stimulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a schematic diagram of the pulse electromagnetic device.

[0035] Figure 2 Schematic diagram of the process of neurogenin 2-mediated neural differentiation of iPSCs and pulsed electromagnetic stimulation intervention.

[0036] Figure 3 Schematic diagram of parameter design of pulse electromagnetic stimulation in Example 1.

[0037] Figure 4 Figure 3: Pulsed electromagnetic stimulation promotes the expression of synapse-related genes. Figure A is a western blot analysis of the expression of synaptophysin in the cells of the magnetic stimulation group (MF) and the control group (noMF); Figure B is a quantitative analysis of the western blot bands in Figure A; Figure C is a real-time fluorescence quantitative PCR analysis of the expression of stemness-related genes (SOX2 and OCT4) and neural-related genes (nestin, SYN1, SYP and PSD95) in the cells of the magnetic stimulation group and the control group.

[0038] Figure 5 These are the results of pulsed electromagnetic stimulation promoting the maturation of electrophysiological activities of iPSCs-derived neural cells, where Figure A is a schematic diagram of the maturity (mature) and immaturity (immature) of neural activity, and Figure B is a graph showing the percentage of cells with mature and immature neural activity in the magnetic stimulation group and the control group.

[0039] Figure 6 The figures are the expression results of synaptophysin in cells treated with Examples 4-8, wherein Figure A is the result of Example 4, Figure B is the result of Example 5, Figure C is the result of Example 6, and Figure D is the result of Examples 7-8.

[0040] The existing magnetic stimulation technology for promoting neural development has the following disadvantages:

[0041] (1) They do not pay attention to the maturation of synapses during neural development. The theoretical support of many technologies promotes neural development by identifying the increased expression of specific neuronal skeleton proteins, ignoring the important role of synapses in neural development. Synapses are specialized structures for information transmission between neurons. They are responsible for information transmission between neurons and their target cells and are the basis for brain information processing and brain function realization. Therefore, the maturation of synapses can directly reflect the maturation of neuronal development.

[0042] (2) They do not pay attention to the functional maturation of nerve cells during their development. The functional maturation of neurons is a key link in neural development and has a decisive influence on the cognitive and behavioral abilities of individuals. Paying attention to the functional maturation of neurons during their development by magnetic stimulation is of great significance for the treatment of clinical diseases.

[0043] (3) The experimental subjects of the study were rodent neural stem cells, which have species differences. By comparing neural stem cells from different species such as humans, mice, and fruit flies, scientists found that although there are similarities at the gene expression level, there are significant differences in DNA methylation patterns, cell surface markers, differentiation potential, and function. In addition, certain species-specific gene expression patterns may affect the behavior of neural stem cells. For example, the human-specific gene ARHGAP11B plays a key role in the development of the human cerebellum, promoting the massive proliferation and differentiation of granule cells and the formation of more grooves and folds.

[0044] In summary, at the basic experimental stage, the current magnetic stimulation technology for promoting neural development has insufficient theoretical support and no clear research mechanism. However, the present invention conducts in-depth analysis and uses a specific magnetic stimulation system and method to confirm its key role in neural development in in vitro cultured neural stem cells, laying a theoretical foundation for the clinical application and development of magnetic stimulation. DETAILED DESCRIPTION

[0045] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0046] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0047] In a specific embodiment of the present invention, the electromagnetic stimulation device is composed of the following four parts (see Figure 1 ): (1) power supply; (2) two-channel digital oscilloscope (owon / Lilliput, EDS112C); (3) arbitrary wave signal generator (feelelec, fy6900); (4) Helmholtz coil (Hunan Derivative Technology Co., Ltd., PS-1HM348).

[0048] In a specific embodiment of the present invention, a magnetic stimulation system for regulating neural development can be provided, the system comprising: a parameter setting module for setting the parameters of magnetic stimulation; a magnetic stimulation module for performing magnetic stimulation on a target based on the parameters set by the parameter setting module; the parameters of the magnetic stimulation include frequency, stimulation intensity, pulse duration, daily stimulation time and number of stimulation days, the frequency is 5 to 50 Hz, the stimulation intensity is 1 to 5 mT, the pulse duration is 2 to 5 ms, the daily stimulation time is 2 to 6 h, and the number of stimulation days is 6 to 10 days.

[0049] In a specific embodiment of the present invention, a magnetic stimulation method for regulating neural development can be provided, the method comprising performing magnetic stimulation on a target, wherein the parameters of the magnetic stimulation include frequency, stimulation intensity, pulse duration, daily stimulation time and number of stimulation days. Figure 1 The device shown performs magnetic stimulation, and the target to be stimulated is placed in the Helmholtz coil.

[0050] In a specific embodiment of the present invention, a method for promoting neural development can be provided, wherein the magnetic stimulation system or method for regulating neural development is used to magnetically stimulate nerves to promote their development.

[0051] In a specific embodiment of the present invention, a method for promoting the expression of synaptophysin and / or postsynaptic density protein 95 in nerves can be provided, and the magnetic stimulation system or method for regulating neural development is used to perform magnetic stimulation on the nerves to promote the expression of synaptophysin and / or postsynaptic density protein 95 in the nerves.

[0052] In a specific embodiment of the present invention, a method for inhibiting the expression of genes related to maintaining stemness in nerves can be provided, wherein the magnetic stimulation system or method for regulating neural development is used to magnetically stimulate nerves to inhibit the expression of genes related to maintaining stemness in nerves.

[0053] In a specific embodiment of the present invention, a method for promoting the maturation of electrical activity of nerve cells can be provided, wherein the magnetic stimulation system or method for regulating nerve development is used to magnetically stimulate nerves to promote the maturation of electrical activity of nerve cells.

[0054] Induced pluripotent stem cells (iPSCs) were purchased from the Stem Cell Bank of the Chinese Academy of Sciences (Shanghai). pTet-O-Ngn2-puro (Plasmid #52047) and FUdeltaGW-rtTA (Plasmid #19780) were integrated into the genome of iPSCs by lentiviral infection. Under neuronal culture conditions, Ngn2 mediated the neural differentiation of iPSCs, which was mainly divided into two stages (see Figure 2 ), stage 1: the process of generating neural progenitor cells; stage 2: the process of neural differentiation. In the specific embodiment of the present invention, Ngn2-mediated iPSCs were used as an example to conduct magnetic stimulation research.

[0055] Example 1

[0056] During the Ngn2-mediated iPSCs neural differentiation stage, the cultured cells were placed in a Helmholtz coil and subjected to pulsed electromagnetic stimulation (PEMF), such as Figure 2 As shown in the figure, the pulse electromagnetic stimulation parameter setting diagram is as follows Figure 3As shown, the frequency was 15 Hz, the intensity of magnetic stimulation was 1 mT, the pulse duration was 3.75 ms, the intervention was 2 hours per day, and the stimulation was continued for 7 days (d). Cells that were cultured under the same conditions and did not receive pulsed magnetic stimulation were used as the control group.

[0057] Example 2

[0058] During the Ngn2-mediated iPSCs neural differentiation stage, the cultured cells were placed in a Helmholtz coil for pulsed electromagnetic stimulation (PEMF) at a frequency of 5 Hz, a magnetic stimulation intensity of 5 mT, and a pulse duration of 2 ms. The intervention lasted for 6 hours per day for 6 consecutive days.

[0059] Example 3

[0060] During the Ngn2-mediated iPSCs neural differentiation stage, the cultured cells were placed in a Helmholtz coil for pulsed electromagnetic stimulation (PEMF) at a frequency of 50 Hz, a magnetic stimulation intensity of 1 mT, a pulse duration of 5 ms, and intervention for 4 hours per day for 10 consecutive days.

[0061] Example 4

[0062] Compared with the embodiment 1, the only difference is that the frequency is 75 Hz, and the rest is the same as the embodiment 1.

[0063] Example 5

[0064] Compared with Example 1, the only difference is that the pulse duration is 66.67 ms, and the rest is the same as Example 1.

[0065] Example 6

[0066] Compared with Example 1, the only difference is that the intervention is 12 hours per day, and the rest is the same as Example 1.

[0067] Example 7

[0068] Compared with Example 1, the only difference is that the pulse electromagnetic stimulation is continued for 14 days (14d-MF), and the rest is the same as Example 1.

[0069] Example 8

[0070] Compared with Example 1, the only difference is that the pulse electromagnetic stimulation is continued for 21 days (21d-MF), and the rest is the same as Example 1.

[0071] Example 9

[0072] Compared with Example 1, the only difference is that the intensity of the pulse electromagnetic stimulation is 100 mT, and the rest is the same as Example 1.

[0073] Test Case

[0074] This test example analyzes the neural stem cells treated with magnetic stimulation in each embodiment, and uses real-time quantitative PCR, western blot and patch clamp experimental methods to evaluate the cell neural development process.

[0075] Specific operation of real-time quantitative PCR: RNA of cells in the magnetic stimulation intervention group (MF) and the control group (noMF) was extracted using trizol extraction method. Sample cDNA was synthesized using a kit (Yeasen, #11141ES60). Fluorescence real-time quantitative PCR was performed using a kit (Yeasen, #11184ES08) and primers of the corresponding genes (see Table 1 for details).

[0076] Table 1

[0077] Primers SYP-F TCGGCTTTGTGAAGGTGCTGCA SYP-R TCACTCTCGGTCTTGTTGGCAC SYN1-F CGATGCCAAATATGACGTGCGTG SYN-R AGCATCGCAGAGCCAGTATTGG PSD-95-F TCCACTCTGACAGTGAGACCGA PSD-95-R CGTCACTGTCTCGTAGCTCAGA Nestin-F TCAAGATGTCCCTCAGCCTGGA Nestin-R AAGCTGAGGGAAGTCTTGGAGC SOX2-F CAGCATGTCCTACTCGCAGCAG SOX2-R CTGGAGTGGGAGGAAGAGGTAA OCT4-F GTGGTCCGAGTGTGGTTCTGTAAC OCT4-R CCCAGCAGCCTCAAAATCCTCTC GAPDH-F GTGGACCTGACCTGCCGTCTAG GAPDH-R GAGTGGGTGTCGCTGTTGAAGTC

[0078] Specific operation of Western blot: Use ripa to extract the protein of the intervention group and the control group cells, mix the protein sample with the loading buffer, and heat it at 95℃ for 8 minutes to denature the protein and carry a negative charge. Prepare 10% Tris-Glycine gel, load the denatured protein sample onto the gel, and perform electrophoresis separation; transfer the separated protein from the gel to a nitrocellulose membrane, and use 5% skim milk or other blocking solution to block the membrane to reduce nonspecific binding. Incubate the specific primary antibody (anti-synaptophsin, 1:1000; anti-GAPDH, 1:5000) with the protein on the membrane at 4℃ overnight, and incubate with a fluorescently labeled secondary antibody (Anti-rabbit IgG (H+L) (DyLight 680Conjugate), Anti-mouse IgG (H+L) (DyLight 800Conjugate)), and use the odyssey development equipment for imaging and development.

[0079] The specific operation of the patch clamp is as follows: the membrane is punctured in the cell attachment mode of the treatment group and the intervention group, and the ionic current of the whole cell membrane outside the patch is recorded. After various compensations, all currents flowing out of the electrode, entering the cell and passing through the cell membrane to the ground electrode are accurately measured.

[0080] The results of magnetic stimulation treatment of cells in Example 1 are as follows Figure 4 and Figure 5 As shown, under the intervention of pulsed electromagnetic fields, the expression levels of synaptophysin and postsynaptic density protein 95 (PSD95) were significantly upregulated; the genes related to maintaining stemness (SOX6, OCT4) were significantly downregulated; pulsed electromagnetic intervention promoted the maturation of electrical activity of iPSC-derived neurons.

[0081] In addition, the results of Examples 2 and 3 are similar to those of Example 1, indicating that the pulsed electromagnetic stimulation designed by the present invention with low frequency (5-50 Hz), low intensity (1-5 mT), pulse duration (2-5 ms), daily action time of 2-6 h, and continuous 6-10 days can promote Ngn2-mediated iPSCs neural differentiation.

[0082] The results of Examples 4-8 are as follows Figure 6 As shown, Figure A is the result of Example 4, the frequency is increased to 75Hz, other parameters are the same, and it cannot promote Ngn2-mediated iPSCs neural differentiation; Figure B is the result of Example 5, the pulse time is 66.67ms, other parameters are the same, but Ngn2-mediated iPSCs neural differentiation is inhibited; Figure C is the result of Example 6, the daily stimulation time is 12 hours, other parameters are the same, reducing pulse magnetic stimulation promotes Ngn2-mediated iPSCs neural differentiation; Figure D is the result of Example 7-8; the stimulation cycle is as long as 14 to 21 days, other parameters are the same, and as time increases, the effect of magnetic stimulation on promoting Ngn2-mediated iPSCs neural differentiation decreases. Example 9, the magnetic field intensity greater than 100mT affects cell growth, further proving that the present invention designs multiple magnetic stimulation parameters for overall synergy to achieve a good effect of promoting neural development.

[0083] In summary, the present invention utilizes a specific magnetic stimulation system and method to confirm its key role in neural development in in vitro cultured neural stem cells, and designs specific pulse electromagnetic stimulation parameters to promote neural development, which is manifested in a significant increase in synapse-related proteins, specifically up-regulated expression of synaptophysin and postsynaptic density protein 95 under the intervention of pulsed electromagnetic fields; significantly down-regulated genes related to maintenance of stemness (SOX6, OCT4), and it is also found that pulsed electromagnetic intervention promotes the maturation of electrical activity of iPSC-derived neurons, laying a theoretical foundation for the clinical application and development of magnetic stimulation.

[0084] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A magnetic stimulation system for regulating neural development, characterized in that: The system comprises: A parameter setting module, used to set the parameters of magnetic stimulation; a magnetic stimulation module, configured to perform magnetic stimulation on a target based on the parameters set by the parameter setting module; The parameters of the magnetic stimulation include frequency, stimulation intensity, pulse duration, stimulation time per day and number of stimulation days.

2. The magnetic stimulation system for regulating neural development according to claim 1, characterized in that: The frequency is 5 to 50 Hz; Preferably, the stimulation intensity is 1 to 5 mT; Preferably, the pulse duration is 2 to 5 ms; Preferably, the daily stimulation time is 2 to 6 hours, and the number of stimulation days is 6 to 10 days.

3. The magnetic stimulation system for regulating neural development according to claim 1 or 2, characterized in that: Such targets include neural stem cells.

4. A magnetic stimulation method for regulating neural development, characterized in that: The method includes performing magnetic stimulation on the target, and the parameters of the magnetic stimulation include frequency, stimulation intensity, pulse duration, stimulation time per day and stimulation days.

5. The magnetic stimulation method for regulating neural development according to claim 4, characterized in that: The frequency is 5 to 50 Hz, the stimulation intensity is 1 to 5 mT, the pulse duration is 2 to 5 ms, the daily stimulation time is 2 to 6 hours, and the number of stimulation days is 6 to 10 days.

6. Use of the magnetic stimulation system for regulating neural development as described in any one of claims 1 to 3 or the magnetic stimulation method for regulating neural development as described in claim 4 or 5 in promoting neural development.

7. Use of the magnetic stimulation system for regulating neural development as described in any one of claims 1 to 3 or the magnetic stimulation method for regulating neural development as described in claim 4 or 5 in promoting the expression of synaptophysin and / or postsynaptic density protein 95 in nerves.

8. Use of the magnetic stimulation system for regulating neural development as described in any one of claims 1 to 3 or the magnetic stimulation method for regulating neural development as described in claim 4 or 5 in inhibiting the expression of genes related to maintaining stemness in nerves.

9. The use according to claim 8, characterized in that: The stemness maintenance-related genes include the SOX6 gene and / or the OCT4 gene.

10. Use of the magnetic stimulation system for regulating neural development as described in any one of claims 1 to 3 or the magnetic stimulation method for regulating neural development as described in claim 4 or 5 in promoting the maturation of electrical activity of nerve cells.

Images