A strain of polymixis oxyurus with arsenic oxidation function and its application in soil remediation

Abstract

The application belongs to the technical field of microorganisms, discloses a strain of Desmodesmus arsenicoxydans with arsenic oxidation function and application thereof in soil remediation, and specifically discloses a strain of Desmodesmus arsenicoxydans B3. The application separates a strain of microalgae B3 with arsenic oxidation function, the strain belongs to the genus Desmodesmus and can oxidize As(III) under day-night alternation conditions. Arsenic forms in a flooded soil solution are determined by using a liquid chromatography-atomic fluorescence spectrometer. Arsenic form analysis shows that As(III) is oxidized into As(V), the concentration of As(III) and total arsenic in soil pore water is reduced, which indicates that the Desmodesmus arsenicoxydans B3 can effectively oxidize As(III) and remove total arsenic in the soil solution under the condition of flooding, reduce the biological availability of arsenic, and play an important role in remediation of arsenic contaminated soil.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology, and particularly relates to a strain of polymorphic chain algae with arsenic oxidation function and application thereof in soil remediation. BACKGROUND

[0002] Arsenic (As) is a toxic metalloid element. Due to the influence of human activities such as mineral exploitation, pesticide and fertilizer application, the problem of soil arsenic pollution in China is becoming increasingly serious. Soil arsenic pollution can harm the growth and development of crops, and also lead to the increase of arsenic concentration in agricultural products, and enter the food chain through the soil-crop system, and finally endanger human health. Due to the continuous water management of paddy fields and the high efficiency of rice in absorbing trivalent arsenic, rice is more likely to accumulate more arsenic than other crops. At present, rice has become the main arsenic exposure way in rice planting and consumption areas. Therefore, the passivation of arsenic in flooded paddy soil is of great significance to ensure the quality and safety of rice and the health of people who mainly eat rice.

[0003] In recent years, microbial remediation of arsenic-contaminated environment has attracted attention. Microorganisms can change the environmental chemical behavior of arsenic in soil, passivate, reduce the toxicity or remove arsenic, so as to achieve the purpose of biological remediation. The principle of microbial remediation of arsenic-contaminated soil is to use the metabolic activities of bacteria, fungi, yeasts and algae in soil to change the form of arsenic in soil, so as to reduce the toxicity and bioavailability of arsenic. Microorganisms can change the form of arsenic in soil by biological transformation such as oxidation-reduction, methylation and demethylation, dissolution and organic complexation degradation, so as to reduce the activity or toxicity of arsenic. Microbial remediation is the most promising, lowest cost and most environmentally friendly remediation technology for treating arsenic-contaminated soil.

[0004] At present, the research work of microbial remediation focuses on screening and domesticating functional microorganisms, improving their activity, life and safety in soil, and finally realizing targeted, efficient and low-cost microbial remediation technology and engineering application. Algae are a kind of photosynthetic autotrophic organisms, which are primary producers in water and soil ecosystems, and have the characteristics of fast growth and strong environmental adaptability. In flooded paddy soil, a main strategy to reduce the availability of arsenic is to promote the oxidation of As(III). The newly formed As(V) can be adsorbed and fixed by soil solid particles, thereby reducing the activity of arsenic. In recent years, many researchers have screened microalgae with arsenic oxidation capacity from oceans, lakes and rivers, which can oxidize As(III) to produce As(III) with less toxicity and mobility. At present, endogenous microalgae with arsenic oxidation function have not been screened in paddy soil. Therefore, it is of great significance to isolate and screen microalgae with arsenic oxidation capacity in paddy soil for the remediation of flooded soil contaminated by arsenic. SUMMARY

[0005] The first aspect of the present application aims to provide a Desmodesmus.

[0006] The second aspect of the present application aims to provide a microbial preparation.

[0007] The third aspect of the present application aims to provide an application of the Desmodesmus of the first aspect of the present application or the microbial preparation of the second aspect of the present application.

[0008] The fourth aspect of the present application aims to provide a product.

[0009] The fifth aspect of the present application aims to provide a method.

[0010] In order to achieve the above-mentioned purposes, the technical solutions adopted by the present application are as follows:

[0011] The first aspect of the present application provides a Desmodesmus, which is named Desmodesmus arsenicoxydans B3, preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M2024172, the preservation date January 22, 2024, and the preservation address Wuhan, China.

[0012] The Desmodesmus screened by the present application is a microalgae with arsenic oxidation function, which can oxidize trivalent arsenic to pentavalent arsenic, and the pentavalent arsenic is adsorbed and fixed by the soil solid phase. The algal strain of the present application can be used for biological remediation of arsenic contaminated environment, and has good application prospect in the treatment of arsenic contaminated flooded soil.

[0013] The second aspect of the present application provides a microbial preparation, which comprises the Desmodesmus of the first aspect of the present application.

[0014] In some embodiments of the present application, the microbial preparation further comprises a pharmaceutically acceptable excipient.

[0015] In some embodiments of the present application, the pharmaceutically acceptable excipient comprises at least one of a filler, a disintegrant, a diluent, a dispersant, an excipient, a stabilizer, a lubricant, a binder, a humectant, a flavoring agent, a suspending agent, a solvent, a sustained-release agent, an emulsifying agent, an absorption enhancer, a surfactant, a preservative, a pigment, an essence, and a solvent.

[0016] In some embodiments of the present application, the filler is selected from starch, sucrose, lactose, mannitol, sorbitol, xylitol, microcrystalline cellulose or glucose, etc.; the binder is selected from cellulose derivatives, alginates, starch, water, dextrin, gelatin or polyvinylpyrrolidone, etc.; the disintegrant is selected from microcrystalline cellulose, sodium carboxymethyl starch, cross-linked polyvinylpyrrolidone, low-substituted hydroxypropyl cellulose or cross-linked sodium carboxymethyl cellulose; the lubricant is selected from stearic acid, polyethylene glycol, calcium carbonate, sodium bicarbonate, microfine silica, talc or magnesium stearate; the suspending agent is selected from microfine silica, beeswax, cellulose, solid polyethylene glycol; the wetting agent is selected from glycerol, Tween-80, hydrogenated castor oil or lecithin; the solvent is selected from ethanol, liquid polyethylene glycol, isopropyl alcohol, Tween-80, glycerol, propylene glycol or vegetable oil, the vegetable oil is selected from soybean oil, castor oil, peanut oil, blended oil, etc.; the surfactant is selected from sodium dodecylbenzenesulfonate, stearic acid, polyoxyethylene-polyoxypropylene copolymer, sorbitan fatty acid ester or polysorbate, etc.; the flavoring agent is selected from aspartame, sucralose, essence, stevioside, acesulfame potassium, citric acid or saccharin sodium; the preservative is selected from at least one of methyl paraben or propyl paraben.

[0017] In a third aspect of the present application, the use of the polyzooidal algae of the first aspect of the present application or the microbial preparation of the second aspect of the present application in any one of (1) to (7) is provided:

[0018] (1) arsenic oxide;

[0019] (2) a product for preparing arsenic oxide;

[0020] (3) absorbing or adsorbing As(V);

[0021] (4) a product for absorbing or adsorbing As(V);

[0022] (5) remediation of an arsenic-contaminated environment;

[0023] (6) a product for remediation of an arsenic-contaminated environment;

[0024] (7) a soil conditioner.

[0025] In some embodiments of the present application, the arsenic in (1) to (2) is inorganic trivalent arsenic.

[0026] In some embodiments of the present application, the arsenic includes arsenous acid and / or arsenite.

[0027] In some embodiments of the present application, the environment in (5) to (6) is an arsenic-contaminated environment, and the arsenic is inorganic trivalent arsenic, such as arsenous acid or arsenite.

[0028] In some embodiments of the present application, the environment includes, but is not limited to, water body, soil (e.g. paddy soil), wetland, sediment.

[0029] In a fourth aspect of the present application, a product is provided, which comprises the chain-forming algae of the first aspect of the present application or the microbial preparation of the second aspect of the present application.

[0030] In some embodiments of the present application, the product includes a reagent, a soil remediation agent, an amendment, an adsorbent.

[0031] In a fifth aspect of the present application, a method is provided, which comprises the step of treating an arsenic-containing sample using the chain-forming algae of the first aspect of the present application, the microbial preparation of the second aspect of the present application or the product of the fourth aspect of the present application.

[0032] The method includes any one of 1) to 3): 1) a method for oxidizing arsenic; 2) a method for absorbing or adsorbing As(V); 3) a method for remediation of a contaminated environment.

[0033] In some embodiments of the present application, the arsenic in 1) is inorganic trivalent arsenic.

[0034] In some embodiments of the present application, the arsenic includes arsenite and / or arsenite salt.

[0035] In some embodiments of the present application, the chain-forming algae, the microbial preparation or the product is used to treat an arsenic-containing sample by applying, wetting, drenching, atomizing, drizzling, spraying, misting, soaking.

[0036] In some embodiments of the present application, the sample includes, but is not limited to, arsenic-contaminated water body, arsenic-contaminated soil, plant, inorganic pentavalent arsenic, inorganic trivalent arsenic, etc.

[0037] The present application has the following advantages:

[0038] The present application isolates a microalgae B3 with arsenic oxidation function, which belongs to Desmodesmus genus and can oxidize As(III) under day-night alternation. Liquid chromatography-atomic fluorescence spectrometer is used to determine the arsenic species in soil solution. The analysis of arsenic species shows that As(III) is oxidized to As(V), which reduces the concentration of As(III) and total arsenic in soil pore water, indicating that under the condition of flooding, the chain-forming algae B3 can effectively oxidize As(III) and remove total arsenic in soil solution, reduce the bioavailability of arsenic, and play an important role in the remediation of arsenic-contaminated soil. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 The fluorescence microscope picture of the chain-forming algae B3 with arsenic oxidation function.

[0040] Figure 2 Phylogenetic analysis of arsenic-oxidizing algae B3.

[0041] Figure 3 Growth curve of arsenic-oxidizing algae B3.

[0042] Figure 4 Kinetic curve of arsenic-oxidizing algae B3 oxidizing 1mg / L (a) and 5mg / L (b) of As(III).

[0043] Figure 5 Concentration of As(III) in overlying water (a), As(III) (b) and total arsenic (c) in soil pore water of paddy field. DETAILED DESCRIPTION

[0044] The content of the present application will be further described in detail by specific examples.

[0045] It should be understood that these examples are only used to illustrate the present application and not used to limit the scope of the present application.

[0046] In order to make the purpose, technical scheme and advantages of the embodiments of the present application more clear, the technical scheme in the embodiments of the present application will be clearly and completely described below. The specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments not mentioned by the manufacturer are all conventional products which can be purchased in the market.

[0047] The features and performances of the present application will be further described in detail below in combination with the examples.

[0048] Example 1 Isolation and screening of arsenic-oxidizing algae B3 from arsenic-contaminated paddy soil

[0049] (1) Sample collection

[0050] The soil sample was collected from the arsenic-contaminated paddy field in Lechang City, Guangdong Province, and the sampling depth of the cultivated layer soil was 0-20cm. The soil sample was packaged with a self-sealing bag and transported back to the laboratory on ice the same day for screening of arsenic-oxidizing algae.

[0051] (2) Enrichment culture of arsenic-oxidizing algae

[0052] The enrichment culture adopts BG-11 liquid medium. 100 mL of prepared medium is divided into 250 mL conical bottles by using a dispenser, and the bottles are sealed with sterile breathable film and sterilized. The sterilized medium is cooled before use. 1 mL of A5 trace elements is added to the sterilized medium by using a syringe. Sodium arsenite is added to the BG-11 liquid medium, and the final concentration of As(III) is set to 0.1 mg / L. 1.0 g of fresh soil sample is weighed and added to 100 mL of sterilized BG-11 liquid medium, and the soil suspension is inoculated into the medium at a ratio of 1:100, and then cultured in an artificial climate incubator. The culture conditions are as follows: temperature 25°C, light intensity 2000 lux, light / dark cycle 12h / 12h, culture for 10 days, and enrichment for 3 generations.

[0053] (3) Gradient dilution plate coating method screening

[0054] The single algae screening adopts the gradient dilution plate coating method. First, 1 mL of enrichment liquid is diluted to a concentration of 10 -1 ~ 10 -7 μL of the dilution liquid is taken and placed on a BG-11 solid medium plate, and the dilution liquid is evenly coated on the whole plate by using a triangular coating rod. The plate culture dish is sealed with a sealing film, and then placed in a 25°C light incubator for inverted culture for 5 days, with a light intensity of 2000 lux and a light / dark cycle of 12h / 12h. The single algae with good growth are selected and inoculated on a BG-11 solid medium, and sodium arsenite is added to the medium to make the final concentration of As(III) 0.1 mg / L. The plate streaking process is repeated until a sterile pure algae strain is obtained, which is recorded as B3 algae.

[0055] The BG-11 liquid medium is used for the culture and separation and purification of microalgae, and the specific formula is shown in Table 1. The BG-11 solid medium is different from the BG-11 liquid medium in that it also contains 1.5% agar powder.

[0056] Table 1 BG-11 liquid medium formula

[0057]

[0058]

[0059] Table 2 A5 trace element solution formula

[0060]

[0061] Example 2 Identification of algae strain

[0062] (1) Morphological observation

[0063] The B3 algae separated in Example 1 were observed under an Olympus BX53 microscope, and the morphology of the algal cells is shown in FIG. 1. The algal cell population of the screened B3 algae consists of 2, 4 or 8 cells, arranged in a row in a straight line; the cells are oval to long-elliptical or long-circular, with wide round ends, a single pericentral chloroplast, and one protein nucleus. The outer cells of the population have one main spine at each end, 6-12 μm long, and one to several short spines; the inner cells have one short spine at one or both ends, and rarely two. The cell diameter is 3-7 μm, and the length is 6-13 μm. Figure 1 The algal cell population of the screened B3 algae consists of 2, 4 or 8 cells, arranged in a row in a straight line; the cells are oval to long-elliptical or long-circular, with wide round ends, a single pericentral chloroplast, and one protein nucleus. The outer cells of the population have one main spine at each end, 6-12 μm long, and one to several short spines; the inner cells have one short spine at one or both ends, and rarely two. The cell diameter is 3-7 μm, and the length is 6-13 μm.

[0064] (2) 18S rRNA sequence and phylogenetic tree analysis

[0065] 2 mL of the B3 algae liquid in the logarithmic growth phase was taken into a centrifuge tube, centrifuged at 8 000 r / min for 5 min, and the algal bodies were collected and used to extract the genomic DNA of the B3 algae by using an Ezup column fungal genomic DNA extraction kit (Shanghai Bioengineering Co., Ltd.). The genomic DNA of the B3 algae was used as a template to amplify the 18S rRNA gene fragment. The 18S rRNA of the B3 algae was amplified by PCR using the algal 18S rRNA universal primers 18S-F (5'-ACCTGGTTGATCCTGCCAGT-3', SEQ ID NO: 1) and 18S-R (5'-TCACCTACGGAAACCTTGT-3', SEQ ID NO: 2). The PCR product was detected by agarose gel electrophoresis, and an obvious band appeared near 2000 bp. The PCR product was recovered and purified, and then sent to Bioengineering (Shanghai) Co., Ltd. for sequencing.

[0066] The sequencing showed that the 18S rRNA gene fragment of the B3 algae was 2042 bp in size, and the 18S rRNA sequence thereof is shown as SEQ ID NO: 3.

[0067] TTATGCCATGCATGTCTAAGTATAAACTGCTTATACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTATTTGGTGGTACCTTCTTACTCGGAATAACCGTAAGAAAATTAGAGCTAATACGTGCGTAAATCCCGACTTCTGGAAGGGACGTATATATTAGATAAAAGGCCGACCGGGCTCTGCCCGACCCGCGGTGAATCATGATATCTTCACGAAG

[0068] CGCATGGCCTTGTGCCGGCGCTGTTCCATTCAAATTTCTGCCCTATCAACTTTCGAT

[0069] GGTAGGATAGAGGCCTACCATGGTGGTAACGGGTGACGGAGGATTAGGGTTCGATT

[0070] CCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCG

[0071] CAAATTACCCAATCCTGATACGGGGAGGTAGTGACAATAAATAACAATACCGGGCA

[0072] TTTCATGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG

[0073] GAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTT

[0074] AAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTCTCAGCGGTCCG

[0075] CCTATGGTGAGTACTGCTGTGGCCTTCCTTACTGTCGGGGACCTGCTTCTGGGCTT

[0076] CATTGTCCGGGACAGGGATTCGGCATGGTTACTTTGAGTAAATTAGAGTGTTCAAA

[0077] GCAGGCTTACGCCGTGAATACTTTAGCATGGAATAACATGATAGGACTCTGCCCTAT

[0078] TCTGTTGGCCTGTAGGAGTGGAGTAATGATTAAGAGGAACAGTCGGGGGCATTCGT

[0079] ATTTCATTGTCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACTACTGCGAAAG

[0080] CATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGA

[0081] TTAGATACCGTCGTAGTCTCAACCATAAACGATGCCGACTAGGGATTGGCGGACGT

[0082] TTTTGCATGACTCCGTCAGCACCTTGAGAGAAATCAAAGTTTTTGGGTTCCGGGGG

[0083] GAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGG

[0084] CGTTGAGTATTGGCTCTAGCGCCTAAAAGTTTCCCTGAAAGGGGAGGCTAGTCGGT

[0085] AGTGGCTCGCTATTGGTGAGAGCTGCTATTCGGCTACACTGTCGAATTGCGGGAAG

[0086] TTCCTTAGAGCTCAAGCTACCAAGCTAGGGTGGAAACACACCTAGTGGCCAGGGT

[0087] AACGACCTCGGGTATGGTAAAAACGCTTGAGATTGGATAATCCGCAGCCAAGCTCC

[0088] TAAGGGCAGCAATGCCTATGGAGAAGGTTCAGAGACTAAGTGGCAGTGGGCTGAT

[0089] TGCTGTTGCAATTGGCTTAAGATAGAGTCCGTCCCTACCGAGAGGTAGCTCTGAGA

[0090] GGAAAGGCCTAACCAGCCCGGAGCTCAGAGAGCTTGTGCATAAGCACAAGTGGG

[0091] GTGAAACGGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTTACCAGGTC

[0092] CAGACATAGGAAGGATTGACAGATTGAGAGCTCTTTCTTGATTCTATGGGTGGTGG

[0093] TGCATGGCCGTTCTTAGTTGGTGGGTTGTCTTGTCAGGTTGATTCCGGTAACGAAC

[0094] GAGACCTCAGCCTTTAAATAGTCACGGTCGCTTTTTGCGGCTGGTTTGACTTCTTA

[0095] GAGGGACAGTTGGCGTTTAGTCAACGGAAGTATGAGGCAATAACAGGTCTGTGAT

[0096] GCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGCATTCAACAAGCCTAT

[0097] CCCTAGCCGAAAGGCTCGGGTAATCTTTGAAACTGCATCGTGATGGGGATAGATTA

[0098] TTGCAATTATTAGTCTTCAACGAGGAATGCCTAGTAAGCGCAATTCATCAGATTGCG

[0099] TTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATTGGGTGTG

[0100] CTGGTGAAGTGTTCGGATTGGCAATTGAAG (SEQ ID NO: 3).

[0101] The 18S rRNA gene fragment sequence of this B3 alga was homologously compared in GenBank and EzTaxon Server 2.1 databases. A phylogenetic tree of the Scenedesmus family was constructed using MEGA 6.0 software, and the results are as follows: Figure 2 As shown, the screened microalgae B3 belongs to the genus Desmodesmus.

[0102] According to the morphology and 18S rRNA gene fragment sequencing results of B3 algae, it is shown that the screened B3 algae belongs to Chlorophyta, Chlorophyceae, Sphaeropleales, Scenedesmaceae and Desmodesmus.

[0103] The B3 algae is named as Desmodesmus arsenicoxydans B3, which is sent to the China Center for Type Culture Collection for preservation, the preservation date is January 22, 2024, the preservation number is CCTCC NO: M 2024172, and the preservation address is Wuhan University, Wuhan, China.

[0104] Example 3 Test of arsenic tolerance of Desmodesmus arsenicoxydans B3

[0105] Sodium arsenite is added to the BG-11 liquid medium (formula same as example 1) to make the final concentration of As(III) 1 mg / L and 5 mg / L respectively. The algal suspension of Desmodesmus arsenicoxydans B3 is inoculated to make the final cell number of Desmodesmus arsenicoxydans B3 in the BG-11 liquid medium 6.7 x 10 4 / mL, and cultured in a 25℃ light incubator for 10 days, with light intensity 2000 lux, humidity 60%, and light / dark cycle 12h / 12h. The absorbance value of the algal strain at wavelength 680 nm (OD 680nm ) is measured every 24h.

[0106] The results are shown in Table 1. Figure 3 As shown in Table 1, Desmodesmus arsenicoxydans B3 can grow in the medium containing 1 mg / L and 5 mg / L As(III), and the OD 680 nm of Desmodesmus arsenicoxydans B3 at the 10th day is not reduced compared with the control group without adding As(III), indicating that Desmodesmus arsenicoxydans B3 has excellent As(III) tolerance.

[0107] Example 4 Study on the ability of Desmodesmus arsenicoxydans B3 to oxidize As(III)

[0108] The BG-11 liquid medium (same as in Example 1) was sterilized and then arsenic sodium was added to make the final concentration of As(III) 1 mg / L and 5 mg / L, respectively. 1 mL of algal suspension of Polytomella sp. B3 was inoculated into the sterilized BG-11 liquid medium containing As(III) and incubated in a 25 °C artificial climate box for 10 days with a light / dark cycle of 12 h / 12 h, light intensity of 2000 lux and humidity of 60%. Two treatments were set up, i.e. inoculation and non-inoculation of algae, and each treatment was set up in triplicate. 2 mL of culture was filtered on day 0, day 2, day 4, day 7 and day 10, and the filtered solution was determined for arsenic speciation by liquid chromatography-atomic fluorescence spectrometry.

[0109] The oxidation effect of Polytomella sp. B3 on As(III) is shown in Table 1. Figure 4 Table 1 Oxidation effect of Polytomella sp. B3 on As(III)

[0110] Example 5 Test of the ability of Polytomella sp. B3 to oxidize As(III) in submerged rice field soil

[0111] First, Polytomella sp. B3 was cultured in BG-11 liquid medium under the same conditions as in Example 1. When the number of cells of Polytomella sp. B3 with arsenic oxidation function reached 1 x 10 7The algal liquid of the algae was obtained when the concentration of As(III) was 1.8 μg / L. 500 g of paddy soil was weighed and placed in a 2 L open glass beaker, 700 mL of ultrapure water was added to maintain a 5 cm overlying water layer, and the waterlogged culture was carried out for 7 days for experimental treatment. The experiment was divided into three groups. The first group was inoculated with 100 mL of fresh B3 algae suspension, cultured in an artificial climate chamber, and the light and dark cycle was 12 h / 12 h (recorded as Soil+B3 treatment); the second group was the paddy soil without B3 algae inoculation, cultured in the dark (recorded as Soil+dark); and the third group was the paddy soil cultured in an artificial climate chamber, and the light and dark cycle was 12 h / 12 h (recorded as Soil). After the experimental treatment, the beaker was sealed with a sealing film and placed in an artificial climate incubator at 25°C for 30 days of static culture, and the light intensity was 2000 lux. Each group of experiments was repeated 3 times.

[0112] On the 0th day, the 5th day, the 10th day, the 15th day, the 20th day and the 30th day of culture, the overlying water was collected with a syringe, and the soil pore water was collected with a pore water collector. The overlying water and the pore water were filtered with a 0.22 μm water filter membrane, and the arsenic speciation in the overlying water and the pore water was determined by atomic fluorescence-liquid chromatography.

[0113] The results are shown in Table 1. Figure 5 It is shown that the B3 algae with arsenic oxidation function inoculated into the paddy soil significantly reduces the concentration of As(III) in the overlying water and the pore water under long-term waterlogging conditions, and the concentration of As(III) is reduced to 1.8 μg / L and 7.1 μg / L respectively on the 30th day, indicating that the B3 algae inoculated into the paddy soil can also perform the function of As(III) oxidation well. The inoculation ladder of B3 algae increases the concentration of total arsenic in the pore, indicating that As(III) in the pore water is continuously oxidized to As(V) by B3 algae, and the generated As(V) may be fixed by the soil solid phase, which makes the B3 algae with arsenic oxidation function have application prospect in the remediation of arsenic contaminated paddy soil.

[0114] The embodiments of the application are described in detail above with reference to the drawings, but the application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the application. In addition, the embodiments of the application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A strain of Polylepis varians, the deposit name is Desmodesmus arsenicoxydans B3, deposited in China Center for Type Culture Collection, the deposit number is CCTCC NO: M 2024172, and the deposit date is January 29, 2024.

2. A microbial preparation comprising the Desmodesmus arsenicoxydans of claim 1.

3. The microbial preparation according to claim 2, characterized in that, The microbial preparation further comprises a pharmaceutically acceptable excipient.

4. Use of the Desmodesmus arsenicoxydans of claim 1 or the microbial preparation of claim 2 or 3 in any one of (1) to (7): (1) oxidizing trivalent arsenic to pentavalent arsenic; (2) preparing a product for oxidizing trivalent arsenic to pentavalent arsenic; (3) absorbing or adsorbing pentavalent arsenic; (4) preparing a product for absorbing or adsorbing pentavalent arsenic; (5) remediating an environment contaminated with arsenic; (6) preparing a product for remediating an environment contaminated with arsenic; (7) preparing a soil amendment; the environment in (5) to (6) is an environment contaminated with arsenic; the soil amendment in (7) is a soil amendment for an environment contaminated with arsenic.

5. Use according to claim 4, characterized in that, The trivalent arsenic comprises arsenous acid and / or arsenite.

6. A product comprising the Desmodesmus arsenicoxydans of claim 1 or the microbial preparation of claim 2 or 3.

7. A method comprising the step of treating a sample containing arsenic with the Desmodesmus arsenicoxydans of claim 1, the microbial preparation of claim 2 or 3, or the product of claim 6; The method comprises any one of 1) to 3): 1) a method for oxidizing trivalent arsenic to pentavalent arsenic; 2) a method for absorbing or adsorbing pentavalent arsenic; 3) a method for remediating an environment contaminated with arsenic; the environment in (3) is an environment contaminated with arsenic.

8. The method of claim 7, wherein, The sample containing arsenic is treated by administering the Desmodesmus arsenicoxydans, the microbial preparation, or the product.

Images