Bacillus velezensis for promoting tomato growth and preventing and controlling tomato fusarium wilt and application of bacillus velezensis

Abstract

The invention discloses bacillus velezensis for promoting tomato growth and preventing and controlling tomato fusarium wilt and application of the bacillus velezensis. The bacillus velezensis SD-3 and the bacillus subtilis Bs-6 are compounded and have a growth promoting effect on tomato plants and root systems. The plant height, stem diameter, plant fresh weight and plant dry weight are obviously improved, and the root length, root node number, root tip number and root surface area are increased. The photosynthetic efficiency and the light energy conversion rate of the plant are improved. The bacillus velezensis SD-3 and bacillus subtilis Bs-6 compound fungicide synergistically act to improve the control effect of the tomatoes on the fusarium wilt, and the control effect can reach 78.63%.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a Velez subspecies of Bacillus for promoting tomato growth and preventing and controlling tomato wilt disease and an application thereof. Background Art

[0002] Tomato wilt is a serious fungal disease in tomato production. The pathogen is Fusarium oxysporum f.sp. / ycopersici FO L. The occurrence of wilt will cause a decrease in tomato yield and quality, causing economic losses to the development of the tomato industry. At present, tomato wilt is mostly controlled by chemical control. Although chemical control methods are effective quickly, long-term use of chemical agents to control plant diseases will cause a series of problems such as high residues and drug resistance. It will also cause environmental pollution or imbalance of microbial populations in the soil, and reduce the number of beneficial microorganisms.

[0003] Biological control uses the interaction between antagonistic microorganisms and secondary metabolites to prevent and control the infection of pathogens, so that plants can develop strong resistance and reduce the proliferation of pathogens. It is efficient, environmentally friendly and sustainable. Screening out better biocontrol strains and developing microbial agents with better biocontrol effects are the best choices for preventing and controlling the spread of plant diseases. Among the types of microorganisms, Bacillus has the characteristics of fast reproduction and strong disease resistance, and has a certain application space for biocontrol agents. Summary of the invention

[0004] The present invention provides a Velez subsp. velezensis which has a growth-promoting effect on tomatoes, can prevent and control various diseases such as tomato wilt, has a broad antibacterial spectrum and a long biocontrol lasting period, and uses thereof.

[0005] In order to achieve the above-mentioned purpose, the present invention provides a strain of Bacillus velezensis SD-3, which is deposited in the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration, the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, the deposit date is September 12, 2024, and the deposit number is CG MCC No.31955.

[0006] The morphological characteristics of Bacillus velezensis SD-3 (hereinafter referred to as SD-3) are as follows: the colony is milky white, with wrinkles on the surface and edges, and an opaque depression in the center; under a microscope, the strain SD-3 is dark purple and rod-shaped after Gram staining, and is a Gram-positive bacterium; under a scanning electron microscope, the bacterial morphology is found to be rod-shaped with oval ends. Physiological and biochemical characteristics of Bacillus velezensis SD-3: aerobic bacteria, methyl red (MR) reaction, VP test are negative, glucose O / F type, catalase reaction, nitrate reduction reaction, gelatin liquefaction, starch hydrolysis test are positive. The growth temperature range is 15-42℃, and the optimal growth temperature is 28℃.

[0007] The molecular biological identification results of Bacillus velezensis SD-3: The 16SrDNA sequence of strain SD-3 was submitted to the gene library of NCB1 for Blast comparison. After 1000 repetitions, MEGA11 software used the Neighbor-Joining method to construct the phylogenetic tree of SD-3 strain and model strain. The results showed that the strain with the highest homology between SD-3 strain and Bacillus velezensis strain PT4 (CP117857) was 99%. The identification primers are shown in Table 2.

[0008] Bacillus Velez SD-3 has a broad spectrum of antibacterial activity, and has a good inhibitory effect on tomato wilt pathogen (F.oxysporumf.sp.lycopersici), melon wilt (F.oxysporumf.sp.melonis), tomato wilt (V.dahliae), tomato early blight (A.solani), tomato gray mold (B.cinerea), corn stalk rot pathogen (F.graminearum), pseudo-verticillioides (F.verticillioides) and sunflower sclerotinia (S.sclerotiorum). The width of the inhibition zone of SD-3 against each pathogen is shown in Table 3.

[0009] Bacillus Velez SD-3 has the ability to produce biofilm, but not HCN, and can produce amylase, protease, siderophore and cellulase.

[0010] Bacillus Velezii SD-3 can produce antibacterial substances. The supernatant of SD-3 was extracted with ethyl acetate, and the antibacterial active substances were obtained after rotary evaporation concentration, which can inhibit the growth of wilt bacteria. LC-MS detection confirmed that SD-3 can secrete difficidin, tropolone, benzothiazole, 2,4-di-t-butylphenol, stearic acid, cyclodipeptide Cyclo (Leu-Trp), hexadecanoic acid, and salicylaldehyde.

[0011] Bacillus subtilis Bs-6 is deposited in the General Microbiology Center of the China Microorganism Culture Collection (CGMCC), with the deposit address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The deposit date is June 15, 2022, and the deposit number is CGMCC No. 25087. It is a publicly available strain.

[0012] The beneficial effects of the present invention are as follows: (1) the composite bacterial agent is composed of Bacillus Velez SD-3 and Bacillus subtilis Bs-6, SD-3 and Bs-6 are compatible, both have the ability to secrete IAA-producing auxin, and can promote plant growth.

[0013] (2) SD-3 original bacterial solution (concentration 1.0×10 8 cfu / m L) diluted 100 times and the original Bs-6 solution diluted 300 times can significantly increase the germination rate and radicle length of tomato seeds.

[0014] (3) Dilute SD-3 100 times (1.0×10 6 cfu / mL) and Bs-6 diluted 300 times (3.0×10 5 cfu / mL) has a growth-promoting effect on tomato plants and roots. It significantly increases plant height, stem thickness, plant fresh weight, plant dry weight, root length, root node number, root tip number and root surface area. It also improves the photosynthetic efficiency and light energy conversion rate of the plant.

[0015] (4) The synergistic effect of the mixed bacterial agent of Bacillus Velez SD-3 and Bacillus subtilis Bs-6 improved the control effect of tomatoes against Fusarium wilt, and the control effect could reach 78.63%. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solution of the embodiment of the present invention, the following briefly introduces the drawings required for describing the embodiment, wherein:

[0017] Figure 1 This is the morphological observation of strain SD-3;

[0018] Figure 2 Phylogenetic tree of 16S rDNA sequence of strain SD-3;

[0019] Figure 3 The strain SD-3 has a broad-spectrum antibacterial effect;

[0020] Figure 4 IAA activity detection of strain SD-3;

[0021] Figure 5 Detection of biofilm formation ability of strain SD-3;

[0022] Figure 6 Extracellular enzyme secretion ability of strain SD-3;

[0023] Figure 7 Detection of antibacterial active substances extracted by ethyl acetate;

[0024] Figure 8 Targeted analysis of strain SD-3 by quadrupole time-of-flight tandem mass spectrometry;

[0025] Fig. 9 Compatibility test of biocontrol strains SD-3 and Bs-6;

[0026] Fig.10 Effects of different dilution multiples on tomato seed germination rate;

[0027] Fig.11 The radicle growth morphology of tomato seeds after the treatment of compound combination ratio;

[0028] Fig.12 Morphological indexes of tomato seedlings treated with biocontrol agents;

[0029] Fig.13 Root indexes of tomato seedlings treated with biocontrol agents;

[0030] Fig.14 Plate confrontation of different treatments against tomato wilt pathogen;

[0031] Fig.15 The efficacy of different treatments on detached leaves of tomato Fusarium wilt;

[0032] Fig.16 Pot control efficacy of different treatments against Fusarium wilt in tomato plants. DETAILED DESCRIPTION

[0033] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0034] Embodiment 1:

[0035] Screening and identification of SD-3 strain:

[0036] The strains were isolated from the rhizosphere soil of plants by dilution gradient plate spreading method, and the strains were purified by plate streak culture method. The tomato wilt pathogen was used as the target bacteria, and the SD-3 strain was obtained by plate confrontation method.

[0037] The morphology, culture characteristics, and physiological and biochemical characteristics of SD-3 were identified in the following steps:

[0038] Streak the biocontrol bacteria SD-3 on the plate and culture at 28℃ for 48h to observe the characteristics of single colonies. After Gram staining, observe the shape, size and growth of the vegetative body and spores under a microscope, and use a scanning electron microscope to observe the specific morphology. Figure 2 The physiological and biochemical characteristics of the biocontrol strain SD-3 were identified by measuring the glucose O / F test, gelatin liquefaction test, methyl red reaction test, acetylmethylcarbinol test (VP test), catalase test, and aerobic and anaerobic tests.

[0039] The strain was identified by extracting SD-3 genomic DNA, using the genomic DNA as a template, and using universal primers (27F and 1492R) to amplify 16S rDNA. The PCR product was detected by 1.0% agarose gel detection and purified. The purified product was sent to Huada Technology for sequencing. The sequencing results were compared by NCBI-Blast on the NCBI website. The phylogenetic tree of strain SD-3 was constructed on MEGA11 software using the Neighbor-Joining method to determine the species of the strain. It can be seen from the constructed phylogenetic tree that the SD-3 strain has a higher homology with the strain Bacillus velezensis strain PT4 (CP117857), with a similarity of 99%. It was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, with the deposit number CGMCC No.31955.

[0040] Embodiment 2:

[0041] Determination of the antibacterial spectrum of SD-3 strain:

[0042] The pathogen was inoculated into a culture dish containing PDA and activated in a constant temperature incubator at 28°C for 7 days. A hole (Φ=5mm) was punched on the activated pathogen, and the pathogen cake was picked up and placed in the center of the PDA solid culture medium. The biocontrol strain was inoculated around 5 cm at equal intervals, and cultured in a constant temperature incubator at 28°C for 7 days. The width of the transparent inhibition zone was observed and measured. The results showed that Bacillus Velez SD-3 has a broad-spectrum antibacterial activity and has an inhibitory effect on tomato wilt pathogen (F.oxysporumf.sp.lycopersici), melon wilt (F.oxysporum f.sp.melonis), tomato verticillium wilt (V.dahliae), tomato early blight (A.solani), tomato gray mold (B.cinerea), corn stalk rot pathogen (F.graminearum), pseudo-verticillioides (F.verticillioides) and sunflower sclerotinia (S.sclerotiorum). Figure 3 ).

[0043] Embodiment 3:

[0044] Determination of IAA activity and biofilm and HCN production capacity of SD-3 strain:

[0045] The biocontrol bacteria were inoculated into LB liquid culture medium and cultured on a shaker at 28°C and 200 r / min for 48 h for determination.

[0046] (1) IAA activity assay: Place the bacterial fermentation broth in a 1.5 mL centrifuge tube and centrifuge at 10,000 r / min for 20 min. Place 1 mL of the supernatant in a test tube, add 2 mL of Salkowaski reagent and two drops of orthophosphoric acid (phosphoric acid), place in a 28°C water bath for 2 h, and observe the color change of the solution. If the solution turns red, IAA is produced, otherwise not.

[0047] (2) Determination of biofilm production ability: Add 6 mL of bacterial solution to a sterile test tube and incubate at 28°C for 48 h. Pour out the bacterial solution in the test tube, wash the inner wall of the test tube with distilled water several times, then add 1% crystal violet dye solution until the bacterial solution in the test tube is submerged, incubate at 28°C for 15 min, discard the crystal violet dye solution, and wash with sterile water 2 to 3 times. If a blue-purple ring mark is produced on the inner wall of the test tube, it means that the strain can produce biofilm.

[0048] (3) Determination of HCN production capacity: Take 5 mL of bacterial solution and place it in a sterile culture dish. Add 1 to 2 drops of concentrated sulfuric acid and shake to mix well. Then use a pipette to take an appropriate amount of bacterial solution from the culture dish with concentrated sulfuric acid and completely soak the HCN sensitive test paper. After 20 minutes, observe the HCN sensitive test paper. If the color of the test paper turns blue, HCN is produced. Otherwise, HCN is not produced.

[0049] The results showed that SD-3 had IAA activity and the ability to produce biofilm, but did not have the ability to produce HCN.

[0050] Embodiment 4:

[0051] Detection of extracellular enzyme secretion ability of SD-3 strain:

[0052] (1) Protease production capacity test: Place a 5 mm diameter sterile filter paper in the center of the prepared sterile protease test medium plate, add 5 μL of bacterial solution, and culture in a 28°C incubator for 3 days to observe whether there is a transparent circle around the colony.

[0053] (2) Siderophore production ability test: Place a 5 mm diameter sterile filter paper in the center of a prepared sterile siderophore culture medium plate, add 5 μL of bacterial solution, and culture in a 30°C incubator for 2 weeks to observe whether an orange halo is formed around the colony.

[0054] (3) Amylase production capacity test: Place a 5 mm diameter sterile filter paper in the center of the prepared sterile amylase test medium plate, add 5 μL of bacterial solution, and culture in a 30°C incubator for 3 days. After colonies grow, add iodine solution and observe whether a transparent halo is formed around the colonies.

[0055] (4) Cellulase capacity test: Place a 5 mm diameter sterile filter paper in the center of the prepared sterile cellulose test medium plate, add 5 μL of bacterial solution, and culture in a 30°C incubator for 3 to 5 days to observe whether there is a transparent halo around the colony.

[0056] The results showed that Bacillus Velezii could produce amylase, protease, siderophore and cellulase.

[0057] Embodiment 5:

[0058] Detection of antibacterial substances in SD-3 strain:

[0059] The purified SD-3 strain was inoculated into LB liquid medium and cultured at 28℃ and 200r / min for 48h to obtain the fermentation broth. The supernatant was obtained by centrifugation at 4℃ and 8000r / min for 30min. 200mL of the fermentation supernatant was taken and an equal amount of ethyl acetate was added for extraction. The mixture was stirred with a magnetic stirrer for 24h. The upper layer of liquid was collected with a separatory funnel and concentrated to 2mL by rotary evaporation. Antibacterial activity detection and LC-MS detection were performed. Peakview software was used to perform LC-MS targeted analysis on the antifungal compounds extracted from ethyl acetate. The results showed that Bacillus Velezii SD-3 can produce antibacterial substances. The supernatant of SD-3 was extracted with ethyl acetate, and the antibacterial active substances were obtained after rotary evaporation concentration, which can inhibit the growth of Fusarium wilt. LC-MS detection determined that SD-3 can secrete Difficidin, Tropolone, Benzothiazole, 2,4-di-t-butylphenol, Stearic Acid, Cyclodipeptide Leu-Trp, Hexadecanoic acid, and Salicylaldehyde.

[0060] Embodiment 6:

[0061] Preparation of Bacillus Velez SD-3 compound bacterial agent:

[0062] The compound bacterial agent is composed of Bacillus Velez SD-3 and Bacillus subtilis Bs-6. The compatibility of the two strains is determined by double cross streaking. The growth of the two biocontrol bacteria at the intersection is observed at 28℃ for 48h. It shows that SD-3 and Bs-6 are compatible.

[0063] The biocontrol strain SD-3 and Bacillus subtilis Bs-6 were inoculated into sterile LB liquid medium at 28°C and 200 r / min. The original bacterial liquids of SD-3 and Bs-6 were inoculated at 1.0×10 8 Two treatment groups were set up at the same concentration of cfu / mL. The first group was the original bacterial solution SD-3 (1.0×10 8 cfu / mL), sterile water diluted 100 times, 300 times, 500 times, 800 times, 1000 times and sterile water blank control; the second group was the original bacterial solution Bs-6 (1.0×10 8cfu / mL), 100 times, 300 times, 500 times, 800 times, 1000 times diluted with sterile water and a sterile water blank control; prepare the above bacterial solutions and sterile water with different dilution multiples for later use. Select 20 seeds for each treatment group, put the selected 20 tomato seeds into a 2mL centrifuge tube, inject 1.5mL of bacterial solution with different dilution multiples into each treatment group, inject 1.5mL of distilled water into the sterile water control group, soak for about 12h, filter the soaked seeds with three layers of gauze, put the seeds into a seed bag, inject about 2-3mL of distilled water into the seed bag, record the seed germination rate after 48h and 72h, analyze the effects of different treatment groups on tomato seed germination, and determine the dilution multiples of SD-3 and Bs-6. Treating tomato seeds with 100 times dilution of SD-3 original bacterial solution and 300 times dilution of Bs-6 original bacterial solution can significantly improve the germination rate of tomato seeds. See Fig.10 .

[0064] The total concentration of bacterial solution in each group of experiments was controlled to 1.0×10 6 cfu / mL, the following experimental groups were set up: single bacterial agent SD-3, single bacterial agent Bs-6, compound combination 1 (colony number ratio SD-3: Bs-6 = 1: 1), compound combination 2 (SD-3: Bs-6 = 1: 2), compound combination 3 (SD-3: Bs-6 = 2: 1) and sterile water blank control group, a total of six groups were treated to screen the effects of compound bacterial combinations on tomato seed germination rate and radicle length. After treatment with compound bacterial agents, the germination rate and radicle length of tomato seeds were higher than those of the sterile water control group. Compound combination 1 (SD-3: Bs-6 = 1: 1) was the best, and the germination rate and radicle length were 1.35 times and 1.62 times that of the control group, respectively. See Fig.11 .

[0065] Embodiment 7:

[0066] Growth-promoting effect of Bacillus Velez SD-3 compound agent on tomato:

[0067] The total concentration of bacterial solution in each group of experiments was controlled to 1.0×10 6cfu / mL, the following experimental groups were set up: single bacterial agent SD-3, single bacterial agent Bs-6, compound combination 1 (colony number ratio SD-3: Bs-6 = 1: 1), compound combination 2 (SD-3: Bs-6 = 1: 2), compound combination 3 (SD-3: Bs-6 = 2: 1) and sterile water blank control, and tomato seedlings were treated respectively. Tomato seeds were sown in plug trays, and transplanted into nutrient pots when the seedlings grew to three leaves and one heart (about 25 days). After 20 days, the corresponding bacterial solution was injected into the soil 2 cm below the root of the plant according to the treatment group, and sterile water was injected into the soil 2 cm below the root of the plant in the control group, 9 mL per plant, and the experiment was repeated 3 times. After 2 weeks, the morphological indicators and root indicators of the tomato seedlings such as dry weight, fresh weight, plant height, stem thickness, etc. were measured. The above tomato seedlings were treated in the dark for 30 minutes, and the chlorophyll fluorescence parameters of the six treatment groups were measured using the FluorCam chlorophyll imaging system. Results The surface compound combination has a growth-promoting effect on tomato plants and roots, among which the compound combination SD-3: Bs-6 = 1: 1 has the best effect, which can significantly increase plant height, stem diameter, plant fresh weight, plant dry weight, increase root length, root node number, root tip number and root surface area, and improve the photosynthetic efficiency and light energy conversion rate of the plant.

[0068] Embodiment 8:

[0069] Study on the efficacy of the mixed bacterial agent of Bacillus Velez SD-3 against tomato wilt:

[0070] (1) Effect of compound microbial agents against tomato wilt pathogen (F.oxysporum f.sp.lycopersici):

[0071] After 7 days of co-cultivation, the plate confrontation test was used to observe whether there was a transparent antibacterial zone in the culture medium, and the antibacterial width was measured and recorded, indicating that the compound bacterial agent could inhibit the growth of tomato wilt pathogen. The Oxford Cup plate confrontation test showed that the antibacterial effect of single biocontrol agents was SD-3>Bs-6>CK, and the measured antibacterial width was 0.73cm>0.70cm>Ocm; in the combination of compound bacterial agents, combination 3 (SD-3:Bs-6=2:1) ​​had the best antibacterial effect, and its antibacterial width was 1.15cm, which was significantly higher than the other two groups of compound bacterial agents and single bacterial agents. This shows that the antibacterial effect of a single biocontrol agent can be effectively improved by the combination of two biocontrol agents, as shown in Table 5.

[0072] (2) Effect of compound bacterial agent on detached leaves of tomato wilt

[0073] The preparation concentration is about 1.0×10 7 cfu / mL of tomato wilt pathogen spore suspension, the suspension is light purple in color.

[0074] Take healthy tomato plant leaves, disinfect them and place them in a petri dish covered with two layers of sterile filter paper. Wrap the tomato petiole with sterile absorbent cotton and use a pipette to inject an appropriate amount of sterile water into the petri dish until the filter paper and absorbent cotton are moistened. Spray the seven treatments evenly in the petri dish containing tomato leaves, and control the total concentration of the bacterial solution in each experimental group to 1.0×10 6 cfu / mL, and set up the following experimental groups: single bacterial agent SD-3, single bacterial agent Bs-6, compound combination 1 (colony number ratio SD-3: Bs-6 = 1: 1), compound combination 2 (SD-3: Bs-6 = 1: 2), compound combination 3 (SD-3: Bs-6 = 2: 1), metalaxyl fungicide and sterile water blank control. After the tomato leaves were dried, they were evenly sprayed with the prepared wilt pathogen spore suspension. 10 leaves were treated each time, cultured at room temperature, and the disease situation was observed and recorded at any time. The chlorosis area of ​​detached tomato leaves was used as the disease level index.

[0075] The disease index of each treatment group was CK>Bs-6>SD-3>metalaxyl>combination 1 (SD-3:Bs-6=1:1)>combination 2 (SD-3:Bs-6=1:2)>combination 3 (SD-3:Bs-6=2:1). The disease index of tomato leaves treated with the commercial drug metalaxyl was lower than that of the single bacterial agents SD-3 and Bs-6. There was no significant difference in the disease index of detached tomato leaves treated with single bacterial agents SD-3 and Bs-6, which were 28.88 and 30.89, respectively. Among the compound bacterial agents, the disease index of combination 3 was the smallest, at 18.88. Compared with the single bacterial agents SD-3, Bs-6 and the control group, the disease index of detached leaf wilt disease decreased by 10.00, 12.01 and 62.45, respectively. Among the three compound combinations, compound combination 3 (SD-3: Bs-6 = 2: 1) had the best control effect on tomato detached leaves, which was 76.78%. Compared with the single bacterial agent, the control effect of combination 3 (SD-3: Bs-6 = 2: 1) was increased by about 14.50%, among which there was no significant difference in the control effect between the single bacterial agents. Combination 3 can significantly reduce the disease index of tomato detached leaves and improve the control effect of tomato wilt on detached leaves, as shown in Table 6.

[0076] (3) The efficacy of compound bacterial agents in preventing tomato plant wilt in greenhouse potted plants

[0077] Tomato seedlings 45 days after sowing were selected for greenhouse potted plant protection study. The following seven groups were treated with a spray bottle (the total concentration of the bacterial solution in each experimental group was controlled to 1.0×10 6 cfu / mL) were sprayed evenly on the leaves, and 24 hours later, the prepared tomato wilt pathogen spore suspension (1.0×10 7cfu / mL), and after culturing in a 28℃ greenhouse for 15 days, the disease index of the plants and the control effect were observed and recorded. The experiment was repeated 3 times. The experimental design is as follows:

[0078] Treatment 1: Spray the spore suspension of Fusarium wilt evenly on the entire tomato plant.

[0079] Treatment 2: Biocontrol agent SD-3 + wilt pathogen spore suspension. First, spray the whole tomato plant evenly with the prepared bacterial solution SD-3, and then evenly spray the wilt pathogen spore suspension after 24 hours.

[0080] Treatment 3: Biocontrol agent Bs-6 + wilt pathogen spore suspension. First, spray the whole tomato plant evenly with the prepared bacterial solution Bs-6, and then evenly spray the wilt pathogen spore suspension after 24 hours.

[0081] Treatment 4: Compound combination 1 (colony number ratio SD-3: Bs-6 = 1:1) + wilt pathogen spore suspension, and the prepared compound combination 1 was used to prepare the bacterial solution (total colony concentration 1.0×10 6 cfu / mL) was evenly sprayed on the whole tomato plant, and 24 hours later, the spore suspension of Fusarium wilt was evenly sprayed.

[0082] Treatment 5: Compound combination 2 (SD-3: Bs-6 = 1:2) + wilt pathogen spore suspension, with the prepared compound combination 2 compound bacterial solution (total colony concentration 1.0×10 6 cfu / mL) was evenly sprayed on the whole tomato plant, and 24 hours later, the spore suspension of Fusarium wilt was evenly sprayed.

[0083] Treatment 6: Compound combination 3 (SD-3: Bs-6 = 2:1) + wilt pathogen spore suspension, with the prepared compound combination 3 compound bacterial solution (total colony concentration 1.0×10 6 cfu / mL) was evenly sprayed on the whole tomato plant, and 24 hours later, the spore suspension of Fusarium wilt was evenly sprayed.

[0084] Treatment 7: Purchase commercial medicine metalaxyl fungicide + wilt pathogen spore suspension, spray the whole tomato plant evenly with metalaxyl fungicide, and then evenly spray the wilt pathogen spore suspension after 24 hours.

[0085] The disease condition of the plants was calculated according to the number of yellowing or wilting tomato leaves, and the disease grade is shown in Table 1.

[0086] The incidence of tomato plants treated with single bacterial agents SD-3, Bs-6 and compound bacterial agents was significantly reduced compared with CK. The reason may be that the biocontrol strains occupied the living space and competed for nutrients, inducing a certain resistance in tomato plants. Among them, in the compound bacterial agent combination, combination 3 (SD-3: Bs-6 = 2: 1) had the best control effect on tomato wilt, which was 78.63%; there was no significant difference compared with metalaxyl and carbendazim, and it was increased by 12.60% and 13.68% respectively compared with the single bacterial agents SD-3 and Bs-6; and among the single bacterial agents, the control effect of SD-3 was slightly higher than that of Bs-6, which were 66.03% and 64.95% respectively. See Table 7. The combination of two single bacterial agents SD-3 and Bs-6 will play a certain synergistic role, which also provides a new control measure for the control of tomato wilt.

[0087] Table 1 Grading standards for tomato wilt

[0088] Disease level Number of leaves turning yellow / wilting Leaf chlorosis area% O 0 0 1 1-2 1-25 2 3-4 26-50 3 5-6 51-75 4 Whole plant 76-100

[0089] The disease index (Dl) of tomato plants and the calculation formula for control effect are as follows:

[0090] Disease index = ∑ (number of diseased plants at each level × representative value at each level) / (total number of plants surveyed × highest representative value) × 100%; prevention effect (%) = (disease index of control group - disease index of treatment group) / disease index of control group × 100%.

[0091] Table 2 Primer information for amplifying 16S rDNA

[0092] Detection fragment Primer name Primer sequences Fragment size Bacterial 16S 27F AGAGTTTGATCCTGGCTCAG 1500bp 1492R TACGGCTACCTTGTTACGACTT

[0093] Table 3 Width of the inhibition zone of strain SD-3

[0094]

[0095]

[0096] Table 4 The inhibition width of different biocontrol bacteria against tomato Fusarium wilt

[0097]

[0098] Table 5 Inhibition zone width of different treatments against tomato wilt pathogen

[0099] deal with Antibacterial zone width / cm CK 0±0d SD-3 0.73±0.01c Bs-6 0.70±0.01c Combination 1 (SD-3: Bs-6 = 1:1) 0.93±0.04b Combination 2 (SD-3: Bs-6 = 1: 2) 0.90±0.01b Combination 3 (SD-3: Bs-6 = 2: 1) 1.15±0.05a

[0100] Table 6 The protective effect of different treatments on tomato wilt in vitro leaves

[0101]

[0102]

[0103] Table 7 Potted plant control effects of different treatments on tomato plant wilt

[0104] deal with Disease index Potted plant protection effect% CK 79.28±0.32a - SD-3 26.93±1.01b 66.03±1.28c Bs-6 27.79±0.54b 64.95±0.68d Combination 1 (SD-3: Bs-6 = 1:1) 18.25±0.28c 76.98±0.35b Combination 2 (SD-3: Bs-6 = 1: 2) 17.73±0.48cd 77.64±0.60ab Combination 3 (SD-3: Bs-6 = 2: 1) 16.94±0.61d 78.63±0.77a Metalaxyl 17.43±0.61cd 78.01±0.77ab

[0105] In the present invention, Figure 1 For the morphological observation of strain SD-3, Figure 1 In the figure, a: colony morphology, b: Gram staining, c: bacterial morphology. Figure 2 This is the phylogenetic tree of the 16S rDNA sequence of strain SD-3. Figure 3 The broad-spectrum antibacterial effect of strain SD-3. Figure 3 In the figure, a: sunflower sclerotinia disease, b: melon wilt disease, c: corn stalk rot disease, d: fusarium wilt disease, e: botrytis cinerea, f: tomato early blight disease, g: tomato verticillium wilt disease, h: cucumber anthracnose disease, i: tomato wilt disease. Figure 4 This is the IAA activity detection of strain SD-3. Figure 5 To detect the biofilm formation ability of strain SD-3. Figure 6 is the extracellular enzyme secretion capacity of strain SD-3, Figure 6 Among them, a: amylase, b: protease, c: siderophore, d: cellulase. Figure 7 The antibacterial active substances were extracted with ethyl acetate for detection. Figure 8 For the targeted analysis of strain SD-3 by quadrupole time-of-flight tandem mass spectrometry, Figure 8 In the figure, a: total ion current diagram of SD-3 in positive ion mode; b: total ion current diagram of SD-3 in negative ion mode. Fig. 9 To test the compatibility of biocontrol strains SD-3 and Bs-6. Fig.10 The effect of different dilution multiples on the germination rate of tomato seeds. Fig.11 This is the radicle growth morphology of tomato seeds after treatment with compound combination ratios. Fig.12 It is the morphological index of tomato seedlings under the treatment of biocontrol agents. Fig.13 It is the root index of tomato seedlings treated with biocontrol agents. Fig.14 Plates for different treatments against tomato wilt pathogen. Fig.15 The protective effect of different treatments on detached leaves of tomato Fusarium wilt disease. In the figure, a: sterile water + wilt pathogen spore suspension b: single bacterial agent SD-3 + wilt pathogen spore suspension c: single bacterial agent Bs-6 + wilt pathogen spore suspension d: compound combination 1 (SD-3: Bs-6 = 1:1) + wilt pathogen spore suspension e: compound combination 2 (SD-3: Bs-6 = 1:2) + wilt pathogen spore suspension f: compound combination 3 (SD-3: Bs-6 = 2:1) + wilt pathogen spore suspension g: carbendazim + wilt pathogen spore suspension. Fig.16 The potted plant protection effect of different treatments on Fusarium wilt in tomato plants.

[0106] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A Bacillus velezensis for promoting tomato growth and preventing and controlling tomato wilt, characterized in that: The Bacillus Velez is Bacillus Velez SD-3, which is deposited in the General Microbiological Center of China Microorganism Culture Collection Committee (CGMCC) with a deposit number of CGMCC NO.31955.

2. Use of Bacillus velezensis for promoting tomato growth and preventing and controlling tomato wilt according to claim 1 in promoting tomato growth.

3. The use of Bacillus velezensis for promoting tomato growth and preventing and controlling tomato wilt according to claim 1 in antibacterial treatment, characterized in that: The antibacterial agent includes inhibiting sunflower sclerotinia, melon wilt, corn stalk rot, Fusarium wilt, Botrytis cinerea, tomato early blight and tomato Verticillium wilt.

4. Use of the Bacillus velezensis for promoting tomato growth and preventing and controlling tomato wilt according to claim 1 in preventing and controlling tomato wilt.

5. The use according to claim 4, characterized in that: The method also includes compounding the Bacillus Velez SD-3 with Bacillus subtilis to prepare a compound bacterial agent for preventing and controlling tomato wilt.

6. The use according to claim 5, characterized in that: The colony count ratio of the Bacillus Velez SD-3 to the Bacillus subtilis is 1:0.5-2.

7. The use according to any one of claims 4 to 6, characterized in that: The concentration of the composite bacterial agent is 1.0×10 6 cfu / m~1.O×10 8 cfu / mL.

8. The use according to claim 5, characterized in that: The Bacillus subtilis includes Bacillus subtilis Bs-6.

Images