Double-gene-deleted bovine-derived A-type pasteurella multocida as well as construction method and application thereof

Abstract

The invention discloses double-gene-deleted bovine-derived A-type pasteurella multocida as well as a construction method and application thereof, and relates to the technical field of animal epidemic disease prevention and control, and nucleotide sequences of bacterial strain deleted genes are shown as SEQ ID NO1 and SEQ ID NO2. According to the invention, a cpxA gene and a cpxR gene in bovine-derived A-type pasteurella multocida PmCQ2 are knocked out, and the obtained double-gene deleted strain delta cpxA delta cpxR is prepared into a vaccine which can be used for simultaneously immunizing and protecting bovine-derived A-type pasteurella multocida, bovine-derived A-type pasteurella multocida and bovine-derived F-type pasteurella multocida. And the compound has the advantages of weak toxicity and good stability.

Description

Technical Field

[0001] The invention relates to the technical field of animal disease prevention and control, and in particular to a bovine type A Pasteurella multocida with double gene deletion, a construction method and an application thereof. Background Art

[0002] Pasteurella multocida (Pm) is a zoonotic pathogen that can infect humans and all livestock and poultry, as well as a variety of wild animals such as tigers and chimpanzees. It can cause a variety of diseases such as fowl cholera, porcine atrophic rhinitis, porcine cattle and sheep pneumonia, and hemorrhagic septicemia, causing huge economic losses to the breeding industry. According to its capsular antigen typing, Pm can be divided into five serotypes: A, B, D, E, and F. The main types of Pm prevalent in my country's cattle are capsular type A and B. However, my country currently has no independently developed commercial vaccine for capsular type A Pm. All related vaccines are imported vaccines, and their immune protection effect is not ideal. Therefore, the development of a more effective broad-spectrum Pm vaccine is the key to preventing and controlling Pm disease. Summary of the invention

[0003] In view of the above-mentioned deficiencies in the prior art, the present invention provides a bovine type A Pasteurella multocida with double gene deletion, a construction method and an application thereof.

[0004] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0005] Provided is a bovine type A Pasteurella multocida with double gene deletion, the strain is a bovine type A Pasteurella multocida PmCQ2 isolated from the respiratory tract of a bovine, in which the cpxA gene and the cpxR gene are knocked out to obtain a double gene deletion strain ΔcpxAΔcpxR; the nucleic acid sequences of the deleted genes are shown in SEQ ID NO1 and SEQ ID NO2.

[0006] The present invention also provides the use of the above-mentioned double-gene-deficient bovine type A Pasteurella multocida in the preparation of a cross-immunity vaccine for simultaneous immune protection of bovine type A, bovine type A and bovine type F Pasteurella multocida.

[0007] Furthermore, the content of bovine type A Pasteurella multocida ΔcpxAΔcpxR in the cross-immunization vaccine was 5×10 9 CFU / mL.

[0008] The present invention also provides the use of the above-mentioned bovine type A Pasteurella multocida with double gene deletion in the preparation of a bovine type A Pasteurella multocida attenuated live vaccine.

[0009] Furthermore, the content of bovine type A Pasteurella multocida ΔcpxAΔcpxR in the bovine type A Pasteurella multocida attenuated live vaccine is 5×109 CFU / mL.

[0010] The present invention also provides a method for constructing the above-mentioned double-gene-deficient bovine type A Pasteurella multocida, comprising the following specific steps:

[0011] S1: Using the genomic DNA of bovine type A Pasteurella multocida PmCQ2 as a template, primers cpxA-Up-F and cpxA-Up-R were used to amplify the upstream homology arm of the cpxA gene, and primers cpxA-Down-F and cpxA-Down-R were used to amplify the downstream homology arm of the cpxA gene; and primers cpxA-Up-F and cpxA-Down-R were used to connect the upstream and downstream homology arms to obtain the insert fragment ΔcpxA up+down ;

[0012] The primer sequences are as follows:

[0013] cpxA-Up-F is represented by SEQ ID NO3: GACCATGATTACGCCAAGCTTATGCC ATTTGCGAAAGAAAG;

[0014] cpxA-Up-R is shown in SEQ ID NO4: AATCACAATCCAAACACTTTTTTCAA AGGT;

[0015] cpxA-Down-F is represented by SEQ ID NO5: AAAGTGTTTGGATTGTGATTGATG ATAATG;

[0016] cpxA-Down-R is shown in SEQ ID NO6: TTTATCGGTACCCGGGGATCCTTAACTGGTAATCCAAAGCG;

[0017] S2: Insert fragment ΔcpxA up+down Ligated to linear vector pUC19oriKan R The gene-deleted recombinant plasmid pUC19oriKan was obtained R -ΔcpxA up+down ;

[0018] S3: Using the gene-deleted recombinant plasmid pUC19oriKan R -ΔcpxA up+down PmCQ2 competent cells were electroporated to screen and obtain the cpxA gene knockout strain ΔcpxA;

[0019] S4: Using the genomic DNA of bovine type A Pasteurella multocida PmCQ2 as a template, primers cpxR-Up-F and cpxR-Up-R were used to amplify the upstream homology arm of the cpxR gene, and primers cpxR-Down-F and cpxR-Down-R were used to amplify the downstream homology arm of the cpxR gene; and primers cpxR-Up-F and cpxR-Down-R were used to connect the upstream and downstream homology arms to obtain the insert fragment ΔcpxR up+down ;

[0020] The primer sequences are as follows:

[0021] cpxR-Up-F is represented by SEQ ID NO 7: GACCATGATTACGCCAAGCTTATGCG GAGAAGAGTGCCTCA;

[0022] cpxR-Up-R is represented by SEQ ID NO 8: GTGCTATTGATAACGTCTCAACCCCA TTGA;

[0023] cpxR-Down-F is represented by SEQ ID NO 9: TGAGACGTTAGTGCTATTGATATGC ATATG;

[0024] cpxR-Down-R is represented by SEQ ID NO10: TTTATCGGTACCCGGGGATCCCAGAATAAATGCGAGAATCA;

[0025] S5: Insert the fragment ΔcpxR up+down Ligated to linear vector pUC19oriKan R The gene-deleted recombinant plasmid pUC19oriKan was obtained R -ΔcpxR up+down ;

[0026] S6: Using the gene-deleted recombinant plasmid pUC19oriKan R -ΔcpxA up+down Competent cells of the strain ΔcpxA were electrotransformed; and bovine type A Pasteurella multocida ΔcpxAΔcpxR with cpxA gene and cpxR gene knocked out were obtained through screening.

[0027] Furthermore, the screening of strain ΔcpxA in step S3 was performed using primers dcpxA-F and dcpxA-R, and the sequence of primer dcpxA-F is shown in SEQ ID NO11: GTGATGATAAAGGCTATTAT;

[0028] The sequence of primer dcpxA-R is shown in SEQ ID NO 12: TGGCATTTTTCTAACACGCT.

[0029] Furthermore, the screening of strain ΔcpxAΔcpxR in step S6 was performed using primers dcpxR-F and dcpxR-R, and the sequence of primer dcpxR-F is shown in SEQ ID NO13: AGTAAGCCTGCAATTAACAA;

[0030] The sequence of primer dcpxR-R is shown in SEQ ID NO 14: ATAGAAGTGATAATTTCTTG.

[0031] The beneficial effects of the present invention are:

[0032] The present invention knocks out the cpxA gene and the cpxR gene in bovine type A Pasteurella multocida PmCQ2 by homologous recombination, successfully constructs a double gene deletion strain ΔcpxAΔcpxR, and confirms for the first time that the deletion strain has acid resistance, reduced capsule production and reduced virulence. The deletion strain is prepared into a vaccine that can simultaneously have a good immune protection effect on bovine type A, bovine type A and bovine type F Pasteurella multocida, and has good application prospects as a vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 PCR identification diagram of ΔcpxA and ΔcpxAΔcpxR;

[0034] Figure 2 This is the PCR identification diagram of the in vivo genetic stability of ΔcpxA and ΔcpxAΔcpxR;

[0035] Figure 3 This is the PCR identification diagram of the in vitro genetic stability of ΔcpxA and ΔcpxAΔcpxR;

[0036] Figure 4 It is a comparison chart of the capsule content of ΔcpxA and ΔcpxAΔcpxR;

[0037] Figure 5 This is a comparison chart of the cross-immunity protection evaluation of ΔcpxA and ΔcpxAΔcpxR inactivated vaccines;

[0038] Figure 6 It is the growth curve of ΔcpxA and ΔcpxAΔcpxR under hypertonic environment;

[0039] Figure 7 This is the growth curve of ΔcpxA and ΔcpxAΔcpxR under acid-base stress. DETAILED DESCRIPTION

[0040] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0041] The virulent strain of bovine type A Pasteurella multocida PmCQ2 in the embodiment of the present invention was isolated and identified by the Beef Cattle Disease Prevention and Control Research Laboratory of the School of Veterinary Medicine of Southwest University; the plasmid pUC19 was purchased and stored by the laboratory of the School of Veterinary Medicine of Southwest University, and was modified in the laboratory in the early stage, and the Kan expression core and the temperature-sensitive replication start site of Pasteurella multocida were inserted between the endonuclease sites KpnⅠ and EcoRⅠ of the plasmid. The modified knockout plasmid vector pUC19oriKan R Store in a -80℃ refrigerator in the laboratory.

[0042] The mice used in the embodiments of the present invention are Kunming mice (female, 18-22g, 6-8 weeks old) purchased from Hunan Slake Jingda Experimental Animal Co., Ltd.; the sources of the instruments involved are shown in Table 6 below;

[0043] Table 6

[0044] name Manufacturer PCR instrument BIO-RAD Refrigerated centrifuge Eppendorf DYY-6C electrophoresis apparatus Beijing Liuyi Instrument Factory DYCO-33B electrophoresis tank Beijing Liuyi Instrument Factory Gel Imager Shanghai Tianneng Technology Co., Ltd. Meiling Commercial Ice Maker Changhong Meiling Co., Ltd. MILLI-Q Ultrapure Water Machine Milipore -80℃ Ultra Low Temperature Refrigerator Thermo 4℃ refrigerator Haier Co., Ltd. Waterproof constant temperature incubator Shanghai Yiheng Technology Co., Ltd. Biological Safety Cabinets Chongqing Tairui Instrument Co., Ltd. Nucleic acid protein analyzer BIO-RAD Shaking incubator Jintan Fuhua Instrument Co., Ltd. High Pressure Steam Sterilizer TOMY Autoclave Zhiwei (Xiamen) Instrument Co., Ltd. Electroporator Eppendorf Heating and cooling metal bath Kayoudi Biotechnology Co., Ltd. ELISA reader Thermo Fisher Scientific Fluorescence quantitative PCR instrument Bio-Medical Shanghai Co., Ltd. FA2004 Precision Electronic Balance Chongqing Ruili Electronic Instrument Equipment Co., Ltd. Spectrophotometer Shanghai Jinghua Company AFM full membrane terminal filtration IVC purification cage Suzhou New District Fengqiao Experimental Animal Cage Factory Acidity meter Beijing Sartorius Scientific Instruments Co., Ltd.

[0045] Example 1 Screening and preparation of strain ΔcpxA

[0046] The screening and preparation of strain ΔcpxA includes the following specific steps:

[0047] A1: Acquisition of the whole genome of PmCQ2: Take out the PmCQ2 strain stored in the -80℃ refrigerator in the laboratory, dip the PmCQ2 strain with a sterile inoculation loop, streak it on Martin solid medium, and incubate it upside down in a 37℃ constant temperature incubator for 24-30h. Pick a single colony and put it in 5mL Martin liquid medium, and culture it in a 37℃ shaking incubator for 12h. Extract the whole genome according to the steps in the instructions of the bacterial genomic DNA extraction kit, and store the obtained whole genome in a -20℃ refrigerator after measuring the concentration.

[0048] A2: Amplification and purification of the upper and lower homologous arms of the cpxA gene: The upper and lower homologous arms of the cpxA gene were amplified using primers cpxAUp-F, cpxAUp-R and cpxADown-F, cpxADown-R. The PCR reaction system is shown in Table 1 below.

[0049] Table 1

[0050] Components Volume / μL 2×Taq Master PCR Mix 25 Forward primer (20μM) 2 Reverse primer (20 μM) 2 PmCQ2 whole genome 2 <![CDATA[ddH2O]]> up to 50

[0051] After the PCR reaction was completed, the 1% agarose gel electrophoresis method was used for detection, the target band was cut and recovered, and the upper homology arm and the lower homology arm obtained were measured for concentration and then stored in a -20°C refrigerator.

[0052] A3: Connection of the upstream and downstream homology arms of the cpxA gene: Use primers cpxA-Up-F and cpxA-Down-R to connect the upstream and downstream homology arms of the cpxA gene. The PCR reaction system is shown in Table 2 below.

[0053] Table 2

[0054] Components Volume / μL 2×Taq Master PCR Mix 25 cpxA-Up-F (20 μM) 2 cpxA-Down-R (20μM) 2 cpxA-Up arm 2 cpxA-Down arm 2 <![CDATA[ddH2O]]> up to 50

[0055] After the PCR reaction was completed, the target band was cut and recovered by 1% agarose gel electrophoresis. up+down After measuring the concentration, store it in a -20℃ refrigerator.

[0056] A4: Linear vector pUC19oriKan R and cpxA upper and lower homology arms ΔcpxA up+down Connection: Take out the competent cells DH5α from the -80℃ refrigerator in the laboratory, and then follow the steps of the Taq Master PCR Mix kit purchased from Tiangen Bioengineering Co., Ltd. up+down Add to competent cells DH5α, flick the tube wall to mix, place on ice for 30 minutes, heat shock for 45 seconds, immediately place on ice for 2-3 minutes, add appropriate amount of LB liquid medium, culture in a 30℃ shaking incubator for 1 hour, centrifuge at 5000r / min for 5 minutes, resuspend the bacterial precipitate with appropriate amount of medium, apply it to LB solid medium containing Kan, and invert and culture in a 30℃ constant temperature incubator for 12-16 hours. Identify the colonies grown on the culture medium, and the PCR reaction system is shown in Table 3.

[0057] Table 3

[0058] Components Volume / μL 2×Taq Master PCR Mix 10 cpxA-Up-F (20 μM) 1 cpxA-Down-R (20μM) 1 Single colony / <![CDATA[ddH2O]]> up to 20

[0059] The verified colony was picked into 5 mL of LB liquid medium containing Kan, and cultured in a 30°C shaking incubator for 12 hours. The plasmid was extracted according to the instructions of the plasmid small-scale extraction kit. The extracted plasmid was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing, using the unidirectional primer M13-48. The concentration of the sequenced plasmid was determined and pUC19oriKan was obtained. R -ΔcpxA up+down , stored in the laboratory refrigerator at -20℃.

[0060] A5: Recombinant plasmid pUC19oriKan R -ΔcpxA up+down Electroporation of competent cells PmCQ2: Thaw competent cells PmCQ2 on ice, add 5-10 μL of recombinant plasmid pUC19oriKanR-ΔcpxA to competent cells PmCQ2 up+down , tap the tube wall to mix, and let it stand on ice for 10 minutes; wash the electric shock cup twice with 75% alcohol, then treat it with 95% alcohol for 5 minutes, pour out the alcohol and put it in a 65℃ oven to dry, and put it in a -20℃ refrigerator for precooling; transfer the liquid to the electric shock cup, wipe the water droplets on the outer wall, and shock for 5ms under the conditions of voltage 2,500V and resistance 500Ω; immediately add 900μL BHI liquid culture medium, mix well and transfer to a 1.5mL centrifuge tube, and culture in a 30℃ shaking incubator for 2h; centrifuge at 5000r / min for 5min, discard the supernatant, add 100-200μL Martin liquid culture medium to resuspend the bacteria, spread on Martin solid culture medium containing Kan, and culture in a 30℃ constant temperature incubator for 30-48h.

[0061] A6: All colonies grown in the above screening medium were identified using primers dcpxA-F and dcpxA-R. The PCR reaction system is shown in Table 4.

[0062] The sequence of primer dcpxA-F is GTGATGATAAAGGCTATTAT; the sequence of primer dcpxA-R is TGGCATTTTTCTAACACGCT;

[0063] Table 4

[0064] Components Volume / μL 2×Taq Master PCR Mix 10 Forward primer (20μM) 1 Reverse primer (20 μM) 1 Single colony / <![CDATA[ddH2O]]> up to 20

[0065] The colonies that have undergone single exchange (two target bands were detected by 1% agarose gel electrophoresis: one is the band of amplified upper homology arm + target gene + lower homology arm, and the other is the band of amplified upper and downstream homology arms only) were picked up to 900 μL of physiological saline, and after corresponding gradient dilution, they were spread on Martin solid medium and cultured in a 37°C constant temperature incubator for 30-40 hours. On the other hand, they were inoculated in 5 mL of Martin liquid medium containing Kan, cultured in a 37°C shaking incubator for 12 hours, and stored in a -80°C refrigerator.

[0066] Repeat the above steps until a colony that has undergone double exchange (the target band is detected by 1% agarose gel electrophoresis: only the bands of the upstream and downstream homologous arms are amplified) is screened. The colony is picked into 5 mL of Martin liquid medium, cultured in a 37°C shaking incubator for 12 hours, and stored in a -80°C refrigerator.

[0067] The above colonies were identified using primers pUC19-F and pUC19-R. The PCR reaction system is shown in Table 3.11.

[0068] The sequence of primer pUC19-F is GAGCGGATAACAATTTCACAC; the sequence of primer pUC19-R is ATTTAAGAATACCTTGCCGC;

[0069] The colonies that did not amplify the target band (the recombinant plasmid was lost during the screening process) were picked up and placed in 5 mL of Martin liquid medium, cultured in a 37°C shaking incubator for 12 h, and 100 μL of the bacterial solution was transferred to 5 mL of Martin liquid medium containing Kan, and cultured in a 37°C shaking incubator for 48 h to confirm that the resistance was completely eliminated.

[0070] The bacterial solution that completely eliminated resistance was diluted in gradients and spread on Martin solid medium. The obtained single colonies were identified using primers dcpxA-F and dcpxA-R. The PCR reaction system is shown in Table 5.

[0071] Table 5

[0072] Components Volume / μL 2×Taq Master PCR Mix 25 dcpxA-F (20 μM) 2 dcpxA-R (20μM) 2 Single colony / <![CDATA[ddH2O]]> up to 50

[0073] The PCR product was sent to Shanghai Shenggong Biotechnology Co., Ltd. for bidirectional sequencing, using primers dcpxA-F and dcpxA-R. The correctly sequenced colony was expanded and cultured to obtain strain ΔcpxA, which was stored in a -80°C refrigerator.

[0074] Example 2 Screening and preparation of strain ΔcpxAΔcpxR

[0075] B1: Amplification and purification of the upper and lower homologous arms of the cpxR gene: The upper and lower homologous arms of the cpxR gene were amplified using primers cpxRUp-F, cpxRUp-R and cpxRDown-F, cpxRDown-R, respectively. up+down The PCR reaction system is shown in Table 1. The verified correct bands were recovered and stored in a -20°C refrigerator after the concentration was determined;

[0076] B2: Using the method of step A4 in Example 1, the linear vector pUC19oriKan R and cpxR up+down The recombinant plasmid pUC19oriKanR-ΔcpxR was obtained by ligation. up+down ;

[0077] B3: Preparation of competent cells of strain ΔcpxA: Transfer strain ΔcpxA to 5 mL Martin liquid medium and culture in a 37°C shaking incubator for 12 h. Transfer 100 μL of bacterial solution to 2 tubes of 5 mL Martin liquid medium and culture in a 37°C shaking incubator for 4.5 h. OD 600 The cell suspension was about 0.6; 1-3 μL hyaluronidase was added to each tube, and the cells were cultured in a 37°C shaking incubator for 30 min; the cells were placed on ice for 30 min; the bacterial solution was divided into 1.5 mL centrifuge tubes, centrifuged at 13400 r / min for 4 min, the supernatant was discarded, and the cell pellet was resuspended in sterile 10% glycerol. The cell pellet was centrifuged at 10,000 r / min for 90 s, the supernatant was discarded, and the cell pellet was washed 3 times with 10% glycerol. Finally, 100 μL 10% glycerol was added to resuspend the cell pellet. The ΔcpxA competent cells were prepared, and the cells were quickly frozen in liquid nitrogen and stored in a -80°C refrigerator.

[0078] B4: Using the method of step A5 in Example 1, the recombinant plasmid pUC19oriKanR-ΔcpxR up+down Electrotransformation into ΔcpxA competent cells resulted in bacterial strains;

[0079] B5: The strain obtained in B4 was identified using primers dcpxR-F and dcpxR-R, and the PCR reaction system is shown in Table 4;

[0080] For colonies that have completed double exchange during the first generation culture process (the target band was detected by 1% agarose gel electrophoresis: only the upstream and downstream homologous arms of the cpxR gene were amplified), follow step A6; the colonies grown in Martin medium were identified using primers dcpxR-F and dcpxR-R, and the verified correct colonies were PCR amplified using primers pUC19-F and pUC19-R.

[0081] When all the above-mentioned colonies can amplify bands, pick all the single colonies into 1 mL of Martin liquid medium containing Kan and culture them in a shaking incubator at 37°C for 12 h.

[0082] On the one hand, the corresponding colonies with poor growth were picked into 900 μL of physiological saline, and after corresponding gradient dilution, they were spread on Martin solid medium and cultured in a 37°C constant temperature incubator for 30-40 hours. On the other hand, the corresponding bacterial liquid of the colony was stored in a -80°C refrigerator. All colonies on the solid medium were picked into 1 mL of Martin liquid medium containing Kan, and cultured in a 37°C shaking incubator for 12 hours, and repeated until the colonies that could not grow in Martin liquid medium containing Kan were screened out.

[0083] These colonies are picked up and placed in Martin liquid medium with reduced Kan concentration, and the above steps are repeated, with the Kan concentration in the Martin liquid medium decreasing successively, until colonies that cannot grow in Martin liquid medium containing low Kan concentration are screened out.

[0084] Use primers pUC19-F and pUC19-R to identify colonies. Pick colonies that did not amplify the target band (the recombinant plasmid was lost during the screening process) into 5 mL of Martin liquid medium, culture in a 37°C shaking incubator for 12 hours, grade dilution, spread on Martin solid medium, culture in a 37°C constant temperature incubator for 24-30 hours, and operate according to step A6. The strain ΔcpxAΔcpxR with normal sequencing was stored in a -80°C refrigerator.

[0085] Example 3 Verification of strain gene level

[0086] Using single colonies of PmCQ2, ΔcpxA, and ΔcpxAΔcpxR as templates, PCR amplification was performed using four pairs of primers: KMT-F / R, pUC19-F / R, dcpxA-F / R, and dcpxR-F / R. The results were detected by 1% agarose gel electrophoresis. Figure 1 Lanes 1-3 were amplified with primers KMT-F / R specific for Pasteurella, and amplified bands appeared, indicating that all three strains of bacteria were Pasteurella multocida; Lanes 4-6 were amplified with primers dcpxA-F / R, and the template for lane 6 was PmCQ2, so the amplified fragment was 1480 bp (full length of cpxA gene + part of the non-coding region outside the gene), and the amplified fragments of lanes 4 and 5 were 687 bp (partial deletion of cpxA gene 793 bp); Lanes 7-9 were amplified with primers dcpx R-F / R was used for amplification. The templates of lanes 7 and 9 were ΔcpxA and PmCQ2, so the amplified fragment was 1080bp (full length of cpxR gene + part of the non-coding region outside the gene), and the amplified fragment of lane 8 was 683bp (partial deletion of cpxR gene 397bp); Lanes 10 and 11 were amplified with primers pUC19-F / R, and no fragment was amplified, indicating that the temperature-sensitive plasmid in the deletion strain was deleted. Lanes 12 and 13 used two plasmids as positive controls. In summary, ΔcpxA and ΔcpxAΔcpxR were successfully constructed.

[0087] Example 4 Verification of genetic stability of gene-deficient strains ΔcpxA and ΔcpxAΔcpxR

[0088] It includes in vivo genetic stability verification and in vitro genetic stability verification, among which the specific steps of in vivo genetic stability verification are: aspirate 100 μL of gene-deficient strain bacterial solution, inject it into mouse muscle, dissect the mouse after death, dip the mouse liver section with an inoculation loop, draw three lines on Martin solid culture medium, culture in a 37°C constant temperature incubator for 24-36 hours, pick the obtained single colony into 5 mL of Martin liquid culture medium, culture in a 37°C shaking incubator for 12 hours, and obtain the first generation of in vivo passage bacterial solution.

[0089] The above operation was repeated, and the primers KMT-F, KMT-R, dcpxA-F, dcpxA-R, pUC19-F and pUC19-R were used for verification every five generations. The PCR reaction system was shown in Table 4, and the 20-generation bacterial solution was obtained.

[0090] The sequence of primer KMT-F is ATCCGCTATTTACCCAGTGG; the sequence of primer KMT-R is GCTGTAAACGAACTCGCCAC;

[0091] Using the single colonies of the 20th generation strains ΔcpxA and ΔcpxAΔcpxR obtained by continuous culture in vivo as templates, PCR verification was performed using primers KMT-F / R, pUC19-F / R, dcpxA-F / R, and dcpxR-F / R4. The results are shown in Figure 2 As shown, lanes 1-3 were amplified with primers KMT-F / R specific for Pasteurella, and amplified bands appeared, indicating that all three strains of bacteria were Pasteurella multocida; lanes 4-6 were amplified with primers dcpxA-F / R, and the template for lane 4 was PmCQ2, so the amplified fragment was 1480 bp (full length of cpxA gene + part of the non-coding region outside the gene), and the amplified fragments of lanes 5 and 6 were 687 bp (partial deletion of cpxA gene 793 bp); lanes 7-9 were amplified with primers dcpxA-F / R, and the template for lane 4 was PmCQ2, so the amplified fragment was 1480 bp (full length of cpxA gene + part of the non-coding region outside the gene), and the amplified fragments of lanes 5 and 6 were 687 bp (partial deletion of cpxA gene 793 bp). The templates of lanes 7 and 8 were PmCQ2 and ΔcpxA, so the amplified fragment was 1080bp (full length of cpxR gene + part of the non-coding region outside the gene), and the amplified fragment of lane 9 was 683bp (partial deletion of cpxR gene 397bp); lanes 10 and 11 were amplified with primers pUC19-F / R, and no fragment was amplified, indicating that the temperature-sensitive plasmid in the deletion strain was missing, and lanes 12 and 13 used two plasmids as positive controls. In summary, after continuous passage in vivo, ΔcpxA cannot amplify the cpxA gene, and ΔcpxAΔcpxR cannot amplify the cpxA gene and cpxR gene, indicating that the experimentally constructed ΔcpxA and ΔcpxAΔcpxR can be stably inherited in vivo.

[0092] The specific steps for in vitro genetic stability verification are as follows: use an inoculation loop to dip the gene-deficient strain culture medium, inoculate it into Martin solid medium, and culture it in a 37°C constant temperature incubator for 24-36 hours. The obtained single colony is picked into 5 mL of Martin liquid medium, and cultured in a 37°C shaking incubator for 12 hours to obtain the first generation of in vitro culture culture medium.

[0093] The above operation was repeated, and the primers KMT-F, KMT-R, dcpxA-F, dcpxA-R, pUC19-F and pUC19-R were used for verification every five generations. The PCR reaction system was shown in Table 4, and 40-generation bacterial liquid was obtained.

[0094] Using single colonies of ΔcpxA and ΔcpxAΔcpxR cultured continuously in vitro for 40 generations as templates, PCR verification was performed using primers KMT-F / R, PUC19-F / R, dcpxA-F / R, and dcpxR-F / R4. The results are shown in Figure 3 As shown, lanes 1-3 were amplified with primers KMT-F / R specific for Pasteurella, and amplified bands appeared, indicating that all three strains of bacteria were Pasteurella multocida; lanes 4-6 were amplified with primers dcpxA-F / R, and the template for lane 4 was PmCQ2, so the amplified fragment was 1480 bp (full length of cpxA gene + part of the non-coding region outside the gene), and the amplified fragments of lanes 5 and 6 were 687 bp (partial deletion of cpxA gene 793 bp); lanes 7-9 were amplified with primers dcpxA-F / R, and the template for lane 4 was PmCQ2, so the amplified fragment was 1480 bp (full length of cpxA gene + part of the non-coding region outside the gene), and the amplified fragments of lanes 5 and 6 were 687 bp (partial deletion of cpxA gene 793 bp). The templates of lanes 7 and 8 were PmCQ2 and ΔcpxA, so the amplified fragment was 1080bp (full length of cpxR gene + part of the non-coding region outside the gene), and the amplified fragment of lane 9 was 683bp (partial deletion of cpxR gene 397bp); lanes 12 and 13 were amplified with primers pUC19-F / R, and no fragment was amplified, indicating that the temperature-sensitive plasmid in the deletion strain was missing, and lanes 10 and 11 used two plasmids as positive controls. In summary, after continuous passage in vitro, ΔcpxA cannot amplify the cpxA gene, and ΔcpxAΔcpxR cannot amplify the cpxA gene and cpxR gene, indicating that the experimentally constructed ΔcpxA and ΔcpxAΔcpxR can be stably inherited in vitro.

[0095] Example 5 Determination of bacterial strain capsule content

[0096] The capsule content of PmCQ2, ΔcpxA, and ΔcpxAΔcpxR strains was determined by the following method:

[0097] (1) Standard curve drawing: dilute the hyaluronic acid standard solution (50 μg / 100 μL) to different concentration gradients (0, 1, 3, 5, 10 μg / 100 μL), pipette 100 μL of the liquid and add it to 900 μL of capsule staining solution. Set 3 replicates for each concentration gradient. After mixing, pipette 200 μL of the liquid and measure the OD 630 The concentration gradient is used as the horizontal axis, and the OD 630 The standard curve was drawn with the average value as the ordinate.

[0098] (2) Pipette 100 μL of PmCQ2, ΔcpxA, and ΔcpxAΔcpxR bacterial suspension and transfer to 5 mL of Martin liquid medium. Incubate in a shaking incubator at 37°C for 6 h. Pipette 1 mL of bacterial suspension into 1.5 mL centrifuge tubes respectively. Set up 3 replicates for each group. Centrifuge at 13400 r / min for 15 min. Discard the supernatant and resuspend the bacteria in 1 mL of sterile PBS. Centrifuge at 13400 r / min for 15 min. Wash twice more and resuspend the bacteria in 1 mL of sterile PBS.

[0099] (3) Place the above liquid in a 42°C metal bath for 1 hour. Pipette 100 μL of the liquid before and after treatment, dilute and plate for counting.

[0100] (4) Centrifuge the remaining liquid at 13,000 r / min for 20 min, and transfer the supernatant to a clean 1.5 mL centrifuge tube.

[0101] (5) Pipette 100 μL of liquid and add it to 900 μL of capsule staining solution. After mixing, pipette 200 μL of liquid to measure OD 630 , and substituted into the standard curve to calculate the content of hyaluronic acid released by dead bacteria.

[0102] The results are as follows Figure 4 As shown, the capsule content of ΔcpxAΔcpxR was significantly reduced compared with PmCQ2 and ΔcpxA, while the capsule content of ΔcpxA was not significantly different from that of PmCQ2.

[0103] Example 6 Determination of cross-immune protection of ΔcpxA and ΔcpxAΔcpxR inactivated vaccines

[0104] Prepare inactivated seedlings: aspirate 1 mL of ΔcpxA and ΔcpxAΔcpxR bacterial solution, transfer to 100 mL of Martin liquid medium, culture in a 37°C shaking incubator for 12 hours, perform dilution plate counting, centrifuge the counted bacterial solution at 13400 r / min for 15 minutes, resuspend the bacteria with an appropriate amount of sterile PBS, and adjust the concentration of the bacterial solution. Add formaldehyde solution to a final concentration of 0.15%, inactivate in a 37°C constant temperature incubator for 24 hours, and vortex every 6 hours. The inactivated bacterial solution and sterile PBS are mixed with 15VG mineral oil adjuvant at a ratio of 4:1 to make 5×10 9 CFU / mLΔcpxA inactivated seedlings, 5×10 9 CFU / mLΔcpxAΔcpxR inactivated vaccine and PBS emulsifier. After safety evaluation, store in a 4°C refrigerator.

[0105] After immunizing mice according to the corresponding immunization program, the bacteria of each strain cultured to the logarithmic growth phase were adjusted to an appropriate concentration, and 100 μL of bacterial solution was injected intramuscularly to infect mice (n=6). The mice were observed at intervals of 12 hours for one week, and the death of the mice was recorded. The survival curve was drawn, as shown in Figure 2. Figure 5 The results showed that compared with the PmCQ2 inactivated vaccine, the ΔcpxA and ΔcpxAΔcpxR inactivated vaccines provided 100% protection against the challenge of bovine type A Pasteurella multocida (PmCQ2) and 50% protection against the challenge of bovine type B (PmB) and type F Pasteurella multocida (PmF).

[0106] Example 7 Determination of Salt Stress Ability of ΔcpxA and ΔcpxAΔcpxR

[0107] 1×10 9 CFU of PmCQ2, ΔcpxA and ΔcpxAΔcpxR bacterial suspension (n=3), OD600 was measured at 2h intervals and plotted as Figure 6 The growth curve shown. Figure 6 It can be seen that there was no significant difference between the three strains in the early growth of Martin medium containing 200mM NaCl solution. Starting from 6h, the two deletion strains grew significantly faster than the wild strain. In the middle and late stages, ΔcpxA grew significantly faster than ΔcpxAΔcpxR. In Martin medium containing 200mM KCl solution, in the middle and late stages of growth, ΔcpxA grew significantly faster than PmCQ2 and ΔcpxAΔcpxR, while there was no significant difference in the growth of PmCQ2 and ΔcpxAΔcpxR. The results showed that the loss of the cpxA gene enhanced the ability of PmCQ2 to cope with hypertonic environments, while the loss of the cpxR gene limited the ability of ΔcpxA to cope with hypertonic environments.

[0108] Example 8 Determination of Acid Stress Capacity of ΔcpxA and ΔcpxAΔcpxR

[0109] Inoculate 1×10 9 CFU bacterial solution was added to Martin liquid medium with pH = 5.5 (n = 3), and the measurement was performed every 1 hour starting from the 8th hour. Figure 7 A shows that in an acidic environment, from the perspective of the entire growth stage, ΔcpxA is significantly faster than PmCQ2 and ΔcpxAΔcpxR, and ΔcpxAΔcpxR is significantly faster than PmCQ2. The results show that the loss of the cpxA gene improves the ability of PmCQ2 to cope with acid stress, and the loss of the cpxR gene limits the ability of ΔcpxA to cope with acid stress.

[0110] Inoculate 1×10 9 CFU bacterial solution was added to Martin liquid medium with pH = 8.5 (n = 3), and OD600 was measured every 2 hours. Figure 7 Growth curve shown in B. In an alkaline environment, there was no significant difference in the growth of PmCQ2 and ΔcpxA. In the early stage of growth, ΔcpxAΔcpxR was significantly faster than PmCQ2 and ΔcpxA. In the middle and late stages of growth, ΔcpxAΔcpxR was significantly slower than PmCQ2 and ΔcpxA. The results showed that the loss of the cpxA gene did not affect the ability of PmCQ2 to cope with alkaline stress, and the cpxR gene could enhance the ability of ΔcpxA to cope with alkaline stress.

Claims

1. A bovine type A Pasteurella multocida with double gene deletion, characterized in that: The nucleic acid sequences of the genes deleted in the strain are shown in SEQ ID NO1 and SEQ ID NO2.

2. Use of the double-gene-deficient bovine type A Pasteurella multocida described in claim 1 in the preparation of a cross-immunity vaccine for simultaneous immunity protection against bovine type A, bovine type A and bovine type F Pasteurella multocida.

3. The use according to claim 2, characterized in that: The content of bovine type A Pasteurella multocida ΔcpxAΔcpxR in the cross-immunization vaccine was 5×10 9 CFU / mL.

4. Use of the double-gene-deficient bovine type A Pasteurella multocida described in claim 1 in the preparation of a bovine type A Pasteurella multocida attenuated live vaccine.

5. The use according to claim 4, characterized in that: The content of bovine type A Pasteurella multocida ΔcpxAΔcpxR in the bovine type A Pasteurella multocida attenuated live vaccine is 5×10 9 CFU / mL.

6. A method for constructing the double-gene-deficient bovine type A Pasteurella multocida of claim 1, characterized in that: The specific steps include: S1: Using the genomic DNA of bovine type A Pasteurella multocida PmCQ2 as a template, primers cpxA-Up-F and cpxA-Up-R were used to amplify the upstream homology arm of the cpxA gene, and primers cpxA-Down-F and cpxA-Down-R were used to amplify the downstream homology arm of the cpxA gene; and primers cpxA-Up-F and cpxA-Down-R were used to connect the upstream and downstream homology arms to obtain the insert fragment ΔcpxA up+down ; The primer sequences are as follows: cpxA-Up-F is represented by SEQ ID NO3: GACCATGATTACGCCAAGCTTATGCC ATTTGCGAAAGAAAG; cpxA-Up-R is shown in SEQ ID NO4: AATCACAATCCAAACACTTTTTTCAA AGGT; cpxA-Down-F is represented by SEQ ID NO5: AAAGTGTTTGGATTGTGATTGATG ATAATG; cpxA-Down-R is shown in SEQ ID NO6: TTTATCGGTACCCGGGGATCCTTA ACTGGTAATCCAAAGCG; S2: Insert fragment ΔcpxA up+down Ligated to linear vector pUC19oriKan R The gene-deleted recombinant plasmid pUC19oriKan was obtained R -ΔcpxA up+down ; S3: Using the gene-deleted recombinant plasmid pUC19oriKan R -ΔcpxA up+down PmCQ2 competent cells were electroporated to screen and obtain the cpxA gene knockout strain ΔcpxA; S4: Using the genomic DNA of bovine type A Pasteurella multocida PmCQ2 as a template, primers cpxR-Up-F and cpxR-Up-R were used to amplify the upstream homology arm of the cpxR gene, and primers cpxR-Down-F and cpxR-Down-R were used to amplify the downstream homology arm of the cpxR gene; and primers cpxR-Up-F and cpxR-Down-R were used to connect the upstream and downstream homology arms to obtain the insert fragment ΔcpxR up+down ; The primer sequences are as follows: cpxR-Up-F is represented by SEQ ID NO 7: GACCATGATTACGCCAAGCTTATGCG GAGAAGAGTGCCTCA; cpxR-Up-R is represented by SEQ ID NO 8: GTGCTATTGATAACGTCTCAACCCCA TTGA; cpxR-Down-F is represented by SEQ ID NO 9: TGAGACGTTAGTGCTATTGATATGC ATATG; cpxR-Down-R is represented by SEQ ID NO10: TTTATCGGTACCCGGGGATCCCA GAATAAATGCGAGAATCA; S5: Insert the fragment ΔcpxR up+down Ligated to linear vector pUC19oriKan R The gene-deleted recombinant plasmid pUC19oriKan was obtained R -ΔcpxR up+down ; S6: Using the gene-deleted recombinant plasmid pUC19oriKan R -ΔcpxA up+down Competent cells of the strain ΔcpxA were electrotransformed; and bovine type A Pasteurella multocida ΔcpxAΔcpxR with cpxA gene and cpxR gene knocked out were obtained through screening.

7. The construction method according to claim 6, characterized in that: The screening of strain ΔcpxA in step S3 is performed using primers dcpxA-F and dcpxA-R, and the sequence of primer dcpxA-F is shown in SEQ ID NO11: GTGATGATAAAGGCTATTAT; The sequence of primer dcpxA-R is shown in SEQ ID NO 12: TGGCATTTTTCTAACACGCT.

8. The construction method according to claim 6, characterized in that: The screening of the strain ΔcpxAΔcpxR in step S6 is performed using primers dcpxR-F and dcpxR-R, and the sequence of primer dcpxR-F is shown in SEQ ID NO 13: AGTAAGCCTGCAATTAACAA; The sequence of primer dcpxR-R is shown in SEQ ID NO 14: ATAGAAGTGATAATTTCTTG.

Images