Maleate hydratase and use thereof

By performing error-prone PCR and directed evolution on LeuC, a high-activity maleic acid hydratase mutant was screened out, which solved the problems of insufficient optical purity and enzyme activity in the production of D-malic acid under high substrate concentrations, and realized the industrial prospect of efficient catalytic production of high optical purity D-malic acid.

CN119823974BActive Publication Date: 2025-12-09ZHEJIANG HUARUI BIOTECHNOLOGY CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202311322297.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-13
Publication Date
2025-12-09
Estimated Expiration
2043-10-13

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve the industrial production of high-optical-purity D-malic acid at high substrate concentrations, and the enzyme activity and stereoselectivity of maleic acid hydratase are insufficient.

Method used

By randomly mutagenizing and directed evolution of the large subunit LeuC of isopropyl malate/citric acid isomerase from Methanococcus japonicus using error-prone PCR, maleic acid hydratase mutants with high enzyme activity and stereoselectivity were screened out. Recombinant plasmids were constructed and expressed in hosts such as Escherichia coli to achieve efficient catalysis of maleic acid hydration reaction.

Benefits of technology

The efficient synthesis of D-malic acid at substrate concentrations up to 300 g/L was achieved, with the product having an optical purity of over 99%, demonstrating potential for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004491376000000011
    Figure BDA0004491376000000011
  • Figure BDA0004491376000000051
    Figure BDA0004491376000000051
  • Figure HDA0004491376010000011
    Figure HDA0004491376010000011
Patent Text Reader

Abstract

The application discloses a maleic acid hydratase mutant SEQ ID NO:7 which can efficiently catalyze the hydration conversion of a substrate to generate D-malic acid with high optical purity in a reaction system with a maleic acid concentration of up to 300 g / L, and has an industrial application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological catalysis, and particularly relates to a maleate hydratase and application thereof in preparing D-malic acid. BACKGROUND

[0002] D-malic acid, also known as 2-hydroxybutanedioic acid, is a rare organic acid in nature. Its enantiomer L-malic acid, however, exists in large quantities, and common fruits such as apples and pears contain L-malic acid.

[0003] D-malic acid has a wide range of applications in the chemical and pharmaceutical industries, mainly in three aspects: 1. As a precursor for the synthesis of various important compounds, such as chiral drugs, antibiotics, D,L-carnitine, pheromones, etc. 2. Application in chiral resolution reagents, D-malic acid can resolve some neuroleptic drugs and muscle relaxants. 3. Used as a ligand in asymmetric synthesis.

[0004] The main methods for preparing D-malic acid are chemical synthesis, microbial fermentation, and enzyme catalysis. The chemical method uses (2R, 3R)-tartaric acid or D-aspartic acid as raw material to synthesize D-malic acid, but the cost of raw materials is high, and the production efficiency is low, and there is no report on industrial production. The concentration of malic acid in the fermentation broth of the microbial fermentation method is low, and there is no report on industrial production. The enzyme catalysis method mainly uses maleate hydratase to synthesize and produce D-malic acid, which can complete the production of malic acid in one step using cheap substrate maleic acid, and the theoretical yield is 100%.

[0005] In the previous research work, the inventors reported in CN110747190A that the mutant of fumC from Rhodopseudomonas capsulata-derived fumarate hydratase obtained by directed evolution can catalyze the hydration reaction of maleic acid to generate D-malic acid, and the concentration of substrate in the reaction system reaches 100 g / L, but there is still a certain gap from industrial application. It is also disclosed that fumaric acid and maleic acid are both butenedioic acids, and the difference between them lies in the stereostructure. Fumaric acid is trans-butenedioic acid, which is in trans structure; maleic acid is cis-butenedioic acid, which is in cis structure, and their acidities are different. Maleic acid is also known as anhydromalic acid.

[0006]

[0007] Patent document CN109402184A discloses that Escherichia coli is used as a host bacterium to co-express size subunits aHbzI and PaHbzJ of maleate hydratase derived from Pseudomonas alcaligenes, and an engineering bacterium DHIJ co-expressing size subunits PaHbzI and PaHbzJ of maleate hydratase is obtained, which can catalyze maleic acid to synthesize D-malic acid in whole cells, wherein the concentration of substrate maleic acid can reach 1.5 mol / L, i.e. 174 g / L. However, since the engineering bacterium expresses two proteins aHbzI and PaHbzJ used in combination, it cannot provide maleate hydratase alone for catalysis, but can only perform whole-cell catalysis. The patent document also does not report the optical purity of the product D-malic acid. SUMMARY

[0008] In order to provide maleate hydratase capable of realizing industrial application for catalyzing the hydration reaction of high-substrate-concentration maleic acid to generate high-optical-purity D-malic acid, the inventors, in addition to further attempting to improve the enzyme activity of the maleate hydratase mutant reported in CN110747190A, also strive to develop other microbial sources of maleate hydratase with high enzyme activity and high stereoselectivity. Based on bioinformatics data, it is found that the multifunctional enzyme (isopropylmalate / citramalate isomerase large subunit) LeuC (UniprotKB P81291, amino acid sequence: SEQ ID NO:1) derived from Methanocaldococcus jannaschii has the function of maleate hydratase, and experiments have confirmed that it can catalyze the hydration reaction of maleic acid to generate optically pure D-malic acid alone.

[0009] Random mutation by error-prone PCR, combined with high-throughput screening of mutant libraries, and modeling based on the amino acid sequence of LeuC for maleate hydration, and selecting part of the sites in the active center region for directed evolution, a mutant with significantly improved enzyme activity is screened, realizing the efficient synthesis of D-malic acid. Specifically, the present application includes the following technical solutions.

[0010] The first aspect of the present application provides a maleate hydratase, which is a mutant of the isopropylmalate / citramalate isomerase large subunit (isopropylmalate / citramalate isomerase large subunit) LeuC amino acid sequence SEQ ID NO:1 derived from Methanocaldococcus jannaschii, wherein one or more, preferably two or more, more preferably three or more of the following sites are mutated: I226, E247, F85, K294, and the maleate hydratase has the function of catalyzing the conversion of maleic acid to D-malic acid.

[0011] Preferably, the mutation is selected from I226T, E247G, F85S and K294R.

[0012] Herein, LeuC can be referred to as a "wild maleate hydratase" in order to highlight the maleate hydratase function it has.

[0013] In one embodiment, the maleate hydratase has an amino acid sequence of SEQ ID NO: 3, which is a mutant of the wild maleate hydratase LeuC (UniprotKB P81291) with an amino acid sequence of SEQ ID NO: 1 with I226T and E247G mutations; or an amino acid sequence of SEQ ID NO: 5, which is a mutant of the wild maleate hydratase LeuC (UniprotKB P81291) with an amino acid sequence of SEQ ID NO: 1 with I226T, E247G and F85S mutations; or an amino acid sequence of SEQ ID NO: 7, which is a mutant of the wild maleate hydratase LeuC (UniprotKB P81291) with an amino acid sequence of SEQ ID NO: 1 with I226T, E247G, F85S and K294R mutations.

[0014] The second aspect of the present application provides a DNA molecule comprising a gene encoding the maleate hydratase.

[0015] In one embodiment, the nucleotide sequence of the gene encoding the maleate hydratase with the amino acid sequence of SEQ ID NO: 3 is SEQ ID NO: 4; the nucleotide sequence of the gene encoding the maleate hydratase with the amino acid sequence of SEQ ID NO: 5 is SEQ ID NO: 6; and the nucleotide sequence of the gene encoding the maleate hydratase with the amino acid sequence of SEQ ID NO: 7 is SEQ ID NO: 8.

[0016] Correspondingly, the present application also provides a recombinant plasmid comprising the DNA molecule described above. For example, the gene sequence of SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8 is cloned on the recombinant plasmid.

[0017] The plasmid vector of the plasmid described above can be selected from the pMAL series, the pGEX series, the pET series (e.g. pET22b, pET24a, pET28a), the pQE series, the pBAD series, the pCAl series, the pSH series, the pRSFDuet series or other vectors.

[0018] A third aspect of the present invention provides a microorganism transformed with the above-mentioned recombinant plasmid, namely a transformant (transformant) transformed with the above-mentioned recombinant plasmid, which is an engineered bacterium expressing the above-mentioned maleic acid hydratase.

[0019] The microbial hosts of the above transformants are selected from Escherichia coli, Bacillus subtilis, Pichia pastoris, and Saccharomyces cerevisiae. Preferably, the microbial host is Escherichia coli BL21(DE3).

[0020] A fourth aspect of the invention provides the use of the maleic acid hydratase or the microorganisms described above in the production of D-malic acid.

[0021] Specifically, the above-mentioned uses involve producing D-malic acid using maleic acid as a reaction substrate and maleic acid hydratase or microorganisms as catalysts.

[0022] Optionally, the concentration of the substrate maleic acid in the reaction system can be above 200 g / L, preferably above 250 g / L, for example above 300 g / L.

[0023] In one application, when using the aforementioned microorganism expressing maleic acid hydratase as a catalyst to catalyze the hydration reaction of a substrate, the microorganism is added to the reaction system in the form of bacterial cells or its cell fragments. The cell fragments are, for example, autoclaved bacterial cells or products of ultrasonic cell disruption.

[0024] The pH value of the above reaction system is pH 7.0-8.0, for example, around pH 7.5.

[0025] In the above reaction system, the reaction temperature is 20-40℃, preferably 25-35℃, for example, room temperature of about 30℃.

[0026] It should be understood that in this article, when describing numerical characteristics, the terms "approximately" or "around" mean that the expressed number may have an error range or fluctuation range of ±10%, ±9%, ±8%, ±7%, ±6%, or ±5%.

[0027] This invention screened out the multifunctional enzyme LeuC with maleic acid hydratase function. After genetic engineering mutation, some mutants with significantly improved enzyme activity and still maintaining stereoselectivity were obtained. For example, when the maleic acid hydratase shown in amino acid sequence SEQ ID NO:7 catalyzes the hydration reaction of maleic acid, the substrate concentration can reach up to 300 g / L, the product D-malic acid concentration can reach 299.31 g / L, the conversion rate is 99.767%, and the optical purity reaches 99.8%, which has already shown feasibility for industrial application. Attached Figure Description

[0028] Figure 1is a structural schematic diagram of the plasmid pET24a-leuC constructed by the present application for expressing wild-type enzyme LeuC.

[0029] Figure 2 is an HPLC detection spectrum of maleate hydratase catalyzing the hydration reaction of maleic acid, wherein the amino acid sequence is SEQ ID NO: 7. DETAILED DESCRIPTION

[0030] Extreme environment microorganisms are an important source for researching and developing new enzymes. In view of the research interest in exploring new varieties of maleate hydratase or isozyme with unique characteristics, based on bioinformatics data analysis, it is speculated that the isopropyl malate / citramalate isomerase large subunit LeuC (UniprotKB P81291) from Methanocaldococcus jannaschii collected from the East Pacific Rise hydrothermal vent is a multifunctional enzyme, which not only has high heat stability in a hot environment, but also has the function of maleate hydratase. The speculation is verified by experiments. Therefore, the LeuC is also a new wild-type maleate hydratase. The experiments also verify that it has high stereoselectivity, which is a favorable feature for the synthesis of D-malic acid. However, due to its low enzyme activity, it cannot be used in actual production practice.

[0031] The way to improve the enzyme activity of the wild-type enzyme LeuC is to mutate its amino acid sequence, change the properties or microenvironment of its active center and / or pocket channel. Therefore, the inventors randomly mutate by error-prone PCR, combine high-throughput screening of the mutant library, and according to the computer-simulated 3D model of the protein sequence, through rational analysis and semi-rational design, select the amino acid sites around the active pocket for site-directed saturation mutation. Through high-throughput screening, some mutants with significantly improved enzyme activity are obtained, so as to be used for efficient catalysis of maleic acid hydration reaction to generate D-malic acid.

[0032] In this text, the terms "wild (type)", "wild (maleate hydrating) enzyme" mean the same, which refer to the multifunctional enzyme LeuC (UniprotKB P81291) with the amino acid sequence of SEQ ID NO: 1. Correspondingly, the terms "mutant", "mutant enzyme", "maleate hydratase mutant" mean the same, which refer to the enzyme with the same catalytic reaction characteristics after the amino acid sequence of the wild-type enzyme LeuC is modified, especially the enzyme with improved enzyme activity and / or enhanced enzyme activity stability, such as the mutants with the amino acid sequences of SEQ ID NO: 3, 5 and 7. For the convenience of expression, the wild-type maleate hydratase and its mutants can be collectively referred to as "maleate hydratase" in this text.

[0033] As used herein, the term "increase" (or "enhancement" or "improvement") in the context of enzyme activity means an increase of at least 100% compared to a reference level (e.g., the enzyme activity of LeuC), for example, an increase of at least 1-fold, at least 2-fold, or at least 3-fold, or at least 5-fold, or at least 10-fold, or at least 20-fold compared to a reference level.

[0034] It is to be understood that the term "mutation" as used herein includes, but is not limited to, substitution, deletion, insertion, chemical modification of an amino acid residue, preferably a mutation which is a positive mutation, i.e. an increase in enzyme activity. The substitution can be a non-conservative substitution, a conservative substitution or a combination of non-conservative and conservative substitutions. A "conservative" amino acid substitution or mutation refers to the interchangeability of residues having similar side chains and thus generally includes the substitution of an amino acid in a polypeptide with an amino acid of the same or similar class. However, as used herein, a conservative mutation does not include a substitution of hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing, or small residue to small residue if the conservative mutation can alternatively be an aliphatic to aliphatic, non-polar to non-polar, polar to polar, acidic to acidic, basic to basic, aromatic to aromatic, or a restricted residue to restricted residue substitution. It is well known in the art that common instances of conservative substitutions include: interchanges among the aromatic amino acids F, W, Y; interchanges among the hydrophobic amino acids L, I, V; interchanges among the polar amino acids Q, N; interchanges among the basic amino acids K, R, H; interchanges among the acidic amino acids D, E; interchanges among the hydroxyl amino acids S, T. In addition, A, V, L, or I can be conservatively mutated to another aliphatic residue or another non-polar residue. Exemplary conservative substitutions can be made, for example, according to the following table, where amino acids in the second column can be substituted for one another in the same block, and in preferred cases, amino acids in the same row of the third column can be substituted for one another:

[0035]

[0036] A "non-conservative substitution" refers to a substitution or mutation of an amino acid in a polypeptide with an amino acid having significantly different side chain properties. A non-conservative substitution can use amino acids from the groups listed above, but outside of the groups, rather than within. In one embodiment, a non-conservative mutation affects (a) the structure of the peptide backbone in the region of the substitution (e.g., a proline in place of glycine), (b) the charge or hydrophobicity, or (c) the bulk of the side chain.

[0037] A "deletion" refers to a modification made to a polypeptide by removing one or more amino acids from a reference polypeptide. A deletion can include removal of 1 or more amino acids, 2 or more amino acids, 5 or more amino acids, 10 or more amino acids, 15 or more amino acids, or 20 or more amino acids, up to 10% of the total number of amino acids comprising the reference enzyme, while retaining enzyme activity and / or retaining the improved properties of the engineered maleate hydratase. Deletions can be to the interior and / or the ends of the polypeptide. In various embodiments, deletions can comprise contiguous segments or can be non-contiguous.

[0038] An "insertion" refers to a modification made to a polypeptide by adding one or more amino acids to a reference polypeptide. In some embodiments, the improved engineered maleate hydratase includes one or more amino acids inserted into a naturally occurring maleate hydratase and one or more amino acids inserted into other improved maleate hydratase polypeptides. The insertion can be internal to the polypeptide, or carboxy terminal or amino terminal. Insertions as used herein include fusion proteins as known in the art. The insertion can be a contiguous segment of amino acids or separated by one or more amino acids in the naturally occurring polypeptide.

[0039] By random mutation through multiple rounds of error-prone PCR, some mutants were screened, and the effective mutation sites include: F85, I226, E247 and K294. Among them, the mutant with the following site mutations has the best enzyme activity and stability: F85S, I226T, E247G and K294R, and the amino acid sequence of the mutant is SEQ ID NO: 7.

[0040] The amino acid sequence of the maleate hydratase mutant of the present application is clear, so that the encoding gene, the expression cassette and plasmid containing the gene, and the transformant containing the plasmid of the present application can be easily obtained by those skilled in the art.

[0041] In order to optimally express the maleate hydratase or its mutant in Escherichia coli which is most commonly used in genetic engineering, the expression genes of these enzymes can be codon-optimized.

[0042] Codon optimization is a technique that can be used to maximize protein expression in an organism by increasing the efficiency of translation of a gene of interest. Different organisms typically show a particular bias for one of the codons that encodes the same amino acid due to mutation tendencies and natural selection. For example, in fast-growing microorganisms such as Escherichia coli, the optimized codons reflect the composition of their respective genomic tRNA pools. Therefore, in fast-growing microorganisms, low-frequency codons of an amino acid can be replaced with a higher frequency codon for the same amino acid. Thus, the expression of the optimized DNA sequence is improved in fast-growing microorganisms.

[0043] For example, for expressing maleic acid hydratase in E. coli, the coding gene of the codon-optimized amino acid sequence SEQ ID NO: 7 can be SEQ ID NO: 8.

[0044] These genes, expression cassettes, plasmids, transformants can be obtained by genetic engineering methods well known to those skilled in the art.

[0045] The transformant host can be any microorganism suitable for expressing maleic acid hydratase, including bacteria and fungi. The preferred microorganism is Bacillus subtilis, Pichia pastoris, Saccharomyces cerevisiae, or E. coli, preferably E. coli, more preferably E. coli BL21 (DE3).

[0046] When used as a biocatalyst, the maleic acid hydratase of the present application can be added to the reaction system in the form of an enzyme or in the form of a bacterial cell. The enzyme form includes free enzyme, immobilized enzyme, including purified enzyme, crude enzyme, fermentation broth, carrier immobilized enzyme, etc.; the bacterial cell form includes viable bacterial cells, dead bacterial cells, immobilized bacterial cells, etc.

[0047] When microorganisms such as Bacillus subtilis, Pichia pastoris, Saccharomyces cerevisiae, or E. coli are no longer used for fermentation proliferation, but are used for enzyme catalysis, they are a natural immobilized enzyme by themselves, and do not need to be broken down, even extracted and purified, and can be directly used as an enzyme preparation for catalysis. Since the reaction substrate and the reaction product are both small molecule compounds, they can easily pass through the biological barrier of the bacterial cell membrane, so the bacterial cells do not need to be broken down, which is economically advantageous.

[0048] The present application is further described in detail below in conjunction with specific examples. It should be understood that the following examples are for illustration only and are not intended to limit the scope of the present application.

[0049] Examples

[0050] In this text, the addition amount, content and concentration of various substances are mentioned, and the percentage content mentioned herein refers to the mass percentage content, unless otherwise specified.

[0051] Materials and Methods

[0052] The whole gene synthesis, primer synthesis and sequencing in the examples were completed by Anshengda Biotechnology Co., Ltd.

[0053] The molecular biology experiments in the examples include plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, medium preparation, etc., which are mainly performed according to the Molecular Cloning: A Laboratory Manual, Third Edition (J. Sambrook, D. W. Russell (USA) editors, Huang Peitang et al. translation, Science Press, Beijing, 2002). The specific experimental conditions can be determined by simple tests if necessary.

[0054] The PCR amplification experiments are performed according to the reaction conditions or kit instructions provided by the plasmid or DNA template supplier. The specific experimental conditions can be adjusted by simple tests if necessary.

[0055] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2. (LB solid medium additionally adds 20 g / L agar powder.)

[0056] TB medium: 24 g / L yeast extract, 12 g / L tryptone, 16.43 g / L K2HPO4.3H2O, 2.31 g / L KH2PO4, 5 g / L glycerol, pH 7.0-7.5. (TB solid medium additionally adds 20 g / L agar powder.)

[0057] HPLC detection conditions of the substrate maleic acid and the product D-malic acid:

[0058] Agilent high performance liquid chromatograph 1260 (or the same type); chromatographic column: Agilent SB-Aq, 4.6 mm x 250 mm, 5 μm; mobile phase: 0.1% perchloric acid: acetonitrile = 95:5; flow rate: 1.0 mL / min; column temperature: 30°C; wavelength: 214 nm.

[0059] Optical instrument model: Rudolph Autopol V.

[0060] It should be noted that for the sake of convenience of description, in the examples, the strain number, plasmid number, enzyme number, and enzyme-encoding gene number can share a number, which is easily understood by those skilled in the art, i.e., the same number can refer to different biological forms in different environments.

[0061] Example 1: Cloning and codon optimization of wild-type enzyme leuC

[0062] According to the amino acid sequence SEQ ID NO: 1 of the multifunctional enzyme LeuC (UniprotKB P81291) derived from Methanocaldococcus jannaschii, the coding gene SEQ ID NO: 2 was designed by E. coli preferred codon expression optimization. The full gene sequence was synthesized by Anshida Biotechnology Co., Ltd., and the restriction enzyme sites NdeI and XhoI were designed at both ends of the gene, and subcloned into the pET24a plasmid to obtain the expression vector pET24a-leuC for expressing the wild-type enzyme LeuC (see Figure 1 ).

[0063] The amplification of the LeuC gene used the following primer pair:

[0064] Forward primer leuC-F:

[0065] CATATGATGGGCATGACTATCGTGGAAAAAATCCTG (SEQ ID NO: 9),

[0066] Reverse primer leuC-R:

[0067] CTCGAGCAGGTCGCGCGGGTCGACCAGTTCG (SEQ ID NO: 10).

[0068] The PCR amplified a fragment of about 1.27 kb, and the PCR reaction system included: 0.3 μM of forward primer and reverse primer, 50 ng of gene template, 1 × KOD Neo plus buffer, 0.2 mM dNTP, 1.5 mM MgSO4, KOD neo plus 1 U, and double-distilled water to a total system of 50 μl.

[0069] PCR conditions: 94℃, 2 min; 98℃ 10 s, 55℃ 30 s, 68℃ 30 s, repeated for 30 cycles; 68℃ 10 min.

[0070] After the PCR reaction, agarose gel electrophoresis was used for identification, and the fragment was recovered by a gel recovery kit.

[0071] The plasmid vector pET24a and the leuC fragment were treated with double digestion of NdeI and XhoI, respectively, and the enzyme digestion system was: pET24a plasmid 37 μl (or leuC fragment 37 μl), 10 × buffer 5 μl, NdeI 1.5 μl, XhoI 1.5 μl.

[0072] After the enzyme digestion, the fragments were recovered by using a gel recovery kit. The PCR enzyme KOD Neo plus was purchased from Tokyo Bose (Shanghai) Biotech Co., Ltd., and the gel recovery kit OMEGA Gel Extraction Kit D2500 was purchased from Guangzhou Feiyang Bioengineering Co., Ltd.

[0073] The recombinant plasmid pET24a-leuC was transformed into an expression host such as E. coli BL21 (DE3) competent cells (Invitrogen Corporation) by electroporation to obtain a recombinant E. coli expressing wild-type maleate hydratase.

[0074] The recombinant plasmid pET24a-leuC can also be transformed into other hosts such as Pichia pastoris, Bacillus subtilis, etc. to express wild-type maleate hydratase LeuC.

[0075] Example 2: Construction of a leuC random mutation point library by error-prone PCR

[0076] A leuC random mutation point library was constructed by error-prone PCR.

[0077] The error-prone PCR primer pair was designed as follows with the gene sequence SEQ ID NO: 2 as a template.

[0078] Forward primer MleuC-F:

[0079] ATGGGCATGACTATCGTGGAAAAAATCCTG (SEQ ID NO: 11),

[0080] Reverse primer MleuC-R:

[0081] CAGGTCGCGCGGGTCGACCAGTTCG (SEQ ID NO: 12).

[0082] The 50 μL error-prone PCR reaction system included: 50 ng of plasmid template pET24a-leuC, 30 pmol of primer pair MleuC-F and MleuC-R, 1X Taq buffer, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, 1 mM dTTP, 7 mM MgCl2, (0 mM, 0.05 mM, 0.1 mM, 0.15 mM, 0.2 mM) MnCl2, 2.5 units of Taq enzyme (Fermentas).

[0083] The PCR reaction conditions were: 95 °C for 5 min; 94 °C for 30 s, 55 °C for 30 s, 72 °C for 2 min / kbp; 30 cycles; 72 °C for 10 min.

[0084] The 2.0 kb random mutant fragment was recovered as a large primer, and KOD-plus DNA polymerase was used for MegaPrimer PCR: 94°C for 5 min; 98°C for 10 s, 60°C for 30 s, 68°C for 2 min / kbp, 25 cycles; 68°C for 10 min. The plasmid template was digested by Dpn I, and E. coli BL21 (DE3) was electrotransformed to obtain a random mutant library of more than 8000 clones.

[0085] Example 3: High-throughput screening of the mutant library

[0086] The transformants in the mutant library were inoculated into 96-well deep well plates containing 700 μL of LB medium containing 100 μg / mL kanamycin, and cultured at 37°C for 6 h. Then, the final concentration of IPTG was added, and the temperature was reduced to 25°C for overnight culture. After centrifugation at 5000 rpm for 10 min, the supernatant was discarded, and the sample was frozen at -70°C for 1 h and thawed at room temperature for 30 min. Then, 200 μL of 50 mM Tris-HCl (pH 7.5) was added to resuspend the bacterial cells, which were used as enzyme solution for determination of maleate hydratase activity.

[0087] The enzyme activity determination reaction system included: 2% v / v bacterial concentration of whole bacteria or broken wall crude enzyme solution, 100 mM maleic acid, 50 mM Tris-HCl, pH 7.5, and reaction at 25°C.

[0088] The enzyme activity unit definition: the amount of enzyme required to catalyze 1 micromole (μmol) of D-malic acid from the substrate maleic acid per minute at pH 7.5 and 25°C was defined as 1 unit (U).

[0089] The determination and screening conditions of high-activity mutants are as follows.

[0090] Substrate reaction solution: 100 mM maleic acid, 50 mM Tris-HCl for pH adjustment.

[0091] Termination reaction solution: 1 M NaOH solution.

[0092] 80 μL of enzyme solution was added to 80 μL of substrate reaction solution, and the reaction was carried out at 25°C for 2 h. Then, 40 μL of termination reaction solution was added, followed by centrifugation at 5000 rpm for 10 min. The supernatant was collected, and HPLC was used to detect the yield of D-malic acid and calculate the enzyme activity.

[0093] About 8000 mutant clones were screened, and strains with significantly improved enzyme activity were selected. The plasmid was extracted, and nucleic acid sequencing was performed by Anshengda Biotechnology Co., Ltd. The maleic acid hydratase related fragment in the genome was compared with SEQ ID NO: 2 to determine the amino acid mutation site. The strain with the highest activity improvement was used as the starting strain for the next round of mutant library construction.

[0094] It was found by sequencing that amino acid substitution at some sites in the wild-type enzyme leuC amino acid sequence SEQ ID NO: 1 can cause significant change in the enzyme activity of the mutant, and in the mutant with significantly improved enzyme activity, the sites with higher mutation frequency include Ile (I) at position 226, Glu (E) at position 247, Phe (F) at position 85, Lys (K) at position 294, etc., suggesting that these sites are located in the important part of the enzyme activity pocket.

[0095] Example 4: Saturation mutation of some sites

[0096] For the four sites F85, I226, E247 and K294 in the wild-type enzyme leuC amino acid sequence SEQ ID NO: 1, site-directed saturation mutation was performed on the wild-type enzyme leuC gene by primer PCR mutagenesis technology. For example of mutation at I226, the error-prone PCR primer pair was designed as follows.

[0097] Forward primer LeuC226-F: CGGTAAAACGGGTNNKATCGAGCCGGACG (SEQ ID NO: 13),

[0098] Reverse primer LeuC226-R: ACCCGTTTTACCGCCCATCTCGATTGC (SEQ ID NO: 14).

[0099] The 50 μL error-prone PCR reaction system includes: 50 ng plasmid template pET24a-leuC, 30 pmol of primer pair LeuC226-F and LeuC226-R, 1X Taq buffer, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, 1 mM dTTP, 7 mM MgCl2, (0 mM, 0.05 mM, 0.1 mM, 0.15 mM, 0.2 mM) MnCl2, 2.5 units of Taq enzyme (Fermentas).

[0100] The PCR reaction conditions are: 95 °C for 5 min; 94 °C for 30 s, 55 °C for 30 s, 72 °C for 2 min / kbp; 30 cycles; 72 °C for 10 min.

[0101] The 2.0 kb random mutation fragment recovered by gel recovery was used as a large primer, and KOD-plus DNA polymerase was used for MegaPrimer PCR: 94 °C for 5 min; 98 °C for 10 s, 60 °C for 30 s, 68 °C for 2 min / kbp, 25 cycles; 68 °C for 10 min. The plasmid template was digested with DpnI, and E. coli BL21 (DE3) was electrotransformed to obtain a random mutant library of more than 130 clones.

[0102] The enzyme activity of each mutant was detected according to the method described in Example 3. Most of the mutant strains with substantially no increase or even decrease in enzyme activity were discarded; the mutant strains with enzyme activity increased by more than 50% were selected, the plasmid was extracted, and gene sequencing and amino acid site comparison were performed, and it was found that the I226T mutation could increase the enzyme activity of the wild-type enzyme leuC by nearly 4 times, which belonged to the best result in positive mutation.

[0103] According to the above method, saturation mutation was performed on the F85, E247 and K294 sites respectively, and the positive mutations of these sites were combined with the I226T mutation to screen a mutant library with greatly increased enzyme activity. The sequencing results of the main positive mutant are shown in Table 1 below.

[0104] Table 1, catalytic maleic acid conversion enzyme activity of various leuC mutants (enzyme specific activity: the ratio of fermentation activity (U / ml) of wild-type enzyme leuC to cell concentration OD (OD / ml) is 100%)

[0105] Strain / enzyme number Amino acid mutation Amino acid sequence Relative activity % leuC None SEQ ID NO: 1 100 leuC-20-B9 I226T, E247G SEQ ID NO: 3 1081 leuC-57-H3 I226T, E247G, F85S SEQ ID NO: 5 5931 leuC-85-C12 I226T, E247G, F85S, K294R SEQ ID NO: 7 8640

[0106] Table 1 shows that these four sites are important sites affecting enzyme activity; after multiple rounds of combined mutation, the maleic acid hydratase enzyme activity of the (I226T, E247G, F85S, K294R) mutant leuC-85-C12 is increased by more than 85 times compared with the wild-type leuC, the enzyme activity of the (I226T, E247G) mutant leuC-20-B9 is increased by nearly 10 times compared with the wild-type leuC, and the enzyme activity of the (I226T, E247G, F85S) mutant leuC-57-H3 is increased by more than 58 times compared with the wild-type leuC. The amino acid sequence of leuC-85-C12 is shown in SEQ ID NO: 7, and the coding gene sequence is shown in SEQ ID NO: 8.

[0107] Example 5: Fermentation and catalytic reaction of engineered strain

[0108] The obtained high-activity strain leuC-85-C12 was activated on an LB plate, single colonies were selected, and inoculated into 5 ml of LB medium and cultured at 37°C; 1% v / v was inoculated into 1000 ml of 100 ml TB medium, and cultured at 37°C and 220 rpm for 4-6 h, and 0.2 mM IPTG was added when the OD600 value reached 1.2-1.5; then the temperature was lowered to 25°C for continued culture for 10-16 h, and the bacterial cells were centrifuged and stored at -80°C for 24 h before use. (50 μg / ml kanamycin was added during the culture of the strain)

[0109] The reaction system of 200 ml, the concentration of substrate maleic acid is 300 g / L, the enzyme amount is 10% v / v, the control temperature is 25℃, the rotation speed is 200 rpm, the pH is 7.5, the reaction time is 5 h, the product D-malic acid can reach 299.31 g / l, the conversion rate is 99.767%, and the optical purity ee value is 99.8%.

[0110] The above experiments show that LeuC (UniprotKB P81291) has the function of maleic acid hydratase, and the mutants SEQ ID NO: 3, 5 and 7 constructed on this basis have obviously improved enzyme activity in catalyzing maleic acid hydration reaction to generate D-malic acid, the substrate concentration can reach more than 300 g / L, and the optical purity ee value of the product is more than 99%, which shows good industrial application prospect.

[0111] The above is only the preferred specific embodiment of the present application, but the protection scope of the present application is not limited to this, any person skilled in the art can easily think of changes or replacements within the technical range disclosed by the present application, which should be covered in the protection scope of the present application.

Claims

1. A maleate hydratase, characterized in that, The amino acid sequence is SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO:

7.

2. A DNA molecule encoding the gene of the maleate hydratase according to claim 1.

3. The DNA molecule of claim 2, wherein, The nucleotide sequence of the gene encoding the maleate hydratase with the amino acid sequence as shown in SEQ ID NO: 3 is SEQ ID NO: 4; the nucleotide sequence of the gene encoding the maleate hydratase with the amino acid sequence as shown in SEQ ID NO: 5 is SEQ ID NO: 6; and the nucleotide sequence of the gene encoding the maleate hydratase with the amino acid sequence as shown in SEQ ID NO: 7 is SEQ ID NO:

8.

4. A recombinant plasmid, characterized by The DNA molecule according to claim 3.

5. A microorganism, characterized in that, The recombinant plasmid according to claim 4.

6. The microorganism of claim 5, wherein, The microbial host is selected from the group consisting of Escherichia coli, Bacillus subtilis, Pichia pastoris and Saccharomyces cerevisiae.

7. The microorganism of claim 6, wherein, The microbial host is Escherichia coli BL21 (DE3).

8. Use of the maleate hydratase according to claim 1 or the microorganism according to claim 5 for the production of D-malic acid.

9. Use according to claim 8, characterized in that, The maleate hydratase according to claim 1 or the microorganism according to claim 5 is used for the catalytic production of D-malic acid from maleic acid as the reaction substrate.

Citation Information

Patent Citations

  • Method for synthesizing D-malic acid through biological enzyme method

    CN109402184A

  • Maleate hydratase mutant and application thereof

    CN110747190A

  • Method for producing (R)-malic acid from maleic acid using microbial maleate hydratase

    US5270190A