SiRNA for inhibiting circular RNA circABCA1 and application

Abstract

The invention provides siRNA for inhibiting circular RNA circABCA1 and application, the siRNA comprises an antisense strand and a sense strand with the same sequence as that of a target region, the antisense strand is complementary to circABCA1, the length of the sense strand is 17 nt to 25 nt, and the length of the antisense strand is 16 nt to 31 nt. The siRNA provided by the invention can effectively inhibit the growth and metastasis of in-vivo and in-vitro renal clear cell carcinoma, and has wide application potential.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to siRNA molecules that inhibit circular RNA circABCA1, and use of siRNA molecules in preparing drugs for treating renal clear cell carcinoma. Background Art

[0002] Renal cell carcinoma (RCC) is a malignant tumor originating from renal epithelial cells, accounting for 80%-90% of the total number of renal malignant tumors. According to statistics, there are about 400,000 new cases worldwide each year, accounting for 8% of all tumor diagnosis cases, and the incidence rate increases at a rate of 2% per year. According to the classification standards of the World Health Organization (WHO), RCC is subdivided into subtypes such as clear cell carcinoma, papillary cell carcinoma, chromophobe cell carcinoma and collecting duct carcinoma based on the origin of tumor cells and genetic mutation characteristics. Among them, renal clear cell carcinoma (ccRCC) is the most common renal malignancy, accounting for up to 70% of RCC. Currently, surgical resection is an effective means of treating ccRCC, however, about one-third of patients have distant metastasis at the time of diagnosis. In addition, even with surgical treatment, 20% to 40% of patients are still at risk of recurrence and may further develop into metastatic ccRCC. Unfortunately, metastatic ccRCC is not responsive to traditional radiotherapy and chemotherapy, resulting in poor prognosis for patients.

[0003] Circular RNA is a special type of non-coding RNA with a covalently closed structure, without a polyadenylic acid tail at the 3' end or a cap structure at the 5' end. This unique structure enables circRNA to resist degradation by exonucleases and has a longer half-life than the parent mRNA. With the widespread application of high-throughput sequencing technology, more and more circRNAs have been found to play a key role in the occurrence and development of diseases, especially in the progression of malignant tumors. CircRNA affects the occurrence and development of cancer through a variety of mechanisms, including adsorption as a microRNA sponge, interaction with RNA-binding proteins, and participation in protein translation. However, although circRNA has shown great potential in cancer treatment, its application in the treatment of renal clear cell carcinoma still needs further in-depth research and exploration. Summary of the invention

[0004] The present invention screened out differentially expressed circRNAs by performing ceRNA microarray analysis on 4 pairs of ccRCC patient specimens and combining bioinformatics analysis. Among them, circABCA1 (hsa_circ_0087805) is located on chromosome 9 chr9:107555451-107562865, and its sequence is: SEQ ID NO:1. It is composed of exons 35, 36, 37, 38, 39, 40, and 41 of its parent gene ABCA1, with a total length of 938bp. Testing of ccRCC tissue samples found that circABCA1 was significantly highly expressed in ccRCC tissues. The siRNA designed for circABCA1 in the present invention can significantly inhibit the proliferation and metastasis of ccRCC cells, showing its potential as a potential therapeutic drug for ccRCC.

[0005] The present invention first provides a siRNA, which comprises an antisense strand and a sense strand complementary to the antisense strand, wherein the antisense strand is complementary to the circABCA1 sequence; wherein the length of the sense strand is 17-25 nt, and the length of the antisense strand is 16-31 nt; preferably, the length of the antisense strand is 19 nt-25 nt.

[0006] In one embodiment of the present invention, the nucleotide sequence of circABCA1 is SEQ ID NO:1.

[0007] In one embodiment according to the present invention, the nucleotide sequence of the antisense strand is SEQ ID NO:3.

[0008] In one embodiment according to the present invention, when the nucleotide sequence of the antisense strand is SEQ ID NO:3, the nucleotide sequence of the sense strand is SEQ ID NO:2.

[0009] In one embodiment according to the present invention, the sense strand or antisense strand is modified with a phosphate group, a lipophilic compound or a cell penetrating peptide.

[0010] In one embodiment according to the present invention, a lipophilic compound is bound to the phosphate groups at the 5' ends of the sense and antisense strands of the siRNA.

[0011] In one embodiment according to the present invention, the lipophilic compound is selected from cholesterol, palmitic acid, tocopherol, docosahexaenoic acid DHA and long-chain fatty acids with more than 10 carbon atoms; preferably cholesterol; the antisense chain sequence of the siRNA modified with cholesterol is SEQ ID NO: 5 and the sense chain sequence is SEQ ID NO: 4.

[0012] The present invention also provides use of the above siRNA in preparing a drug for treating renal cell carcinoma (RCC).

[0013] In one embodiment of the present invention, the renal cell carcinoma (RCC) is clear cell renal cell carcinoma (ccRCC).

[0014] The present invention also provides a pharmaceutical composition for treating renal cell carcinoma (RCC), comprising the above siRNA and pharmaceutically acceptable excipients.

[0015] The beneficial effects of the above technical solution of the present invention are as follows: The siRNA provided by the present invention has an interference efficiency of greater than 50%, can effectively reduce the expression level of circABCA1 in ccRCC cells, and thereby inhibit the proliferation and metastasis ability of ccRCC in vitro, including the inhibition of ccRCC tumor growth and liver metastasis in vivo, and is expected to be used to treat ccRCC. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the summary diagram of the instruction manual

[0017] Figure 2 Figure 1 is a schematic diagram of the structure of circABCA1 and a diagram of sequencing results; A is a schematic diagram of the structure of circABCA1 and a schematic diagram of the circularization of circABCA1 verified by Sanger sequencing; B is a diagram of the verification of circABCA1 primers;

[0018] Figure 3 The results of the circABCA1 circularization are shown in Figure 1. A shows the results of the Caki-1 and 786-O Ribonuclease R (RNase R) digestion experiment, B shows the results of the Oligo dT primer reverse transcription experiment, C shows the results of the genome amplification experiment, and D shows the results of the actinomycin D experiment to identify the circABCA1 circularization.

[0019] Figure 4 The expression of circABCA1 in ccRCC tissues and related clinical analysis maps;

[0020] Figure 5 The interference efficiency results of the primers designed according to the structure of circABCA1 were verified by fluorescence quantitative PCR, and the interference efficiency of the siRNA designed for circABCA1 in Caki-1 and 786-O cells was verified;

[0021] Figure 6 The results of cell proliferation and metastasis after interfering with circABCA1 are shown in Figure 1. A to C are the effects of siRNA interfering with circABCA1 on ccRCC cell proliferation and metastasis after transfection of ccRCC tumor cells into siRNA.

[0022] Figure 7 Figure 3 is a graph showing the effects of interfering with circABCA1 on tumor growth and metastasis in vivo; A and B are graphs showing the effects of interfering with circABCA1 siRNA on tumor growth in ccRCC tumor-bearing mice and the effects of stable interfering with circABCA1 on liver metastasis in mice with a liver metastasis model constructed by intrasplenic injection. DETAILED DESCRIPTION

[0023] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0024] Reagents and Materials Reagent Name Commercial Source Trizol Invitrogen, Carlsbad, CA, USA Actinomycin D MedChemExpress, Shanghai, China Universal Genomic DNA Kit CWBIO, Jiangsu, China Ribonuclease R, E. coli Epicenter Premix ex taqTM Takara, Beijing, China PrimeScript™ RT reagent Kit Takara, Beijing, China 2×SP qPCR Mix BIOGROUND,Chongqing,China circABCA1 forward primer Tsingke Biotechnology, Beijing, China circABCA1 reverse primer Tsingke Biotechnology, Beijing, China linearABCA1 forward primer Tsingke Biotechnology, Beijing, China linearABCA1 reverse primer Tsingke Biotechnology, Beijing, China GAPDH forward primer Tsingke Biotechnology, Beijing, China GAPDH reverse primer Tsingke Biotechnology, Beijing, China DMEM / HIGH GLUCOSE HyClone, Logan, UT, USA RPMI 1640 medium HyClone, Logan, UT, USA MCcoys 5A HyClone, Logan, UT, USA Lipo 8000 Beyotime, Beijing, China Cell Counting kit 8 Dojindo Laboratories, Japan OPTI-MEM reduced-serum medium Thermo Scientific, Beijing, China si-NC Tsingke Biotechnology, Beijing, China si-circABCA1 Tsingke Biotechnology, Beijing, China sh-NC Hanbio Biotechnology,Shanghai,China sh-circABCA1 Hanbio Biotechnology,Shanghai,China Puromycin Sigma-Aldrich, St Louis, MO, USA Polybrene Sigma-Aldrich, St Louis, MO, USA

[0025] Example 1 Establishment of a fluorescent quantitative PCR system for detecting circABCA1 and verification of circABCA1 circularization by Sanger sequencing

[0026] Design primers for circABCA1, the primer sequences are: Forward primer: GATTCTTCATCAGGCCCAGGACA (SEQ ID NO: 6); Reverse primer: CAGCCCTTGTTATTGAACCAC (SEQ ID NO: 7)

[0027] Design linear ABCA1 primers, the primer sequences are: Forward primer: GCTCTTTGCACTAGGATGGCA (SEQ ID NO: 8); Reverse primer: TCGCTTTTTGCTCTGGGAGA (SEQ ID NO: 9)

[0028] Ordinary PCR and agarose gel electrophoresis were used to verify the primer specificity and annealing temperature. The specific steps are as follows: Ordinary PCR: 10µL system, r Taq (2×) 5.0µL, Forward primer (10 µM) 0.2µL, Reverse primer (10 µM) 0.2µL, ddH2O 3.6µL, cDNAs 1.0µL. Reaction conditions: 95℃, 5min; 39 cycles at 95℃, 30 s; 65℃-55℃ (temperature gradient), 30 s; 72℃, 30 s, 39 cycles, 72℃, 10min, 4℃, 5min. Put it at 4℃ for use.

[0029] Agarose gel electrophoresis: Prepare 2% agarose gel, mix according to the ratio of agarose: TAE = 2g: 100mL, and heat in a microwave until the solution is clear. Add the nucleic acid dye working solution concentration (1x), mix well, and pour the mixture into the mold. After the liquid cools and solidifies, take out the gel and place it in a horizontal electrophoresis instrument. Take the above common PCR product, add 1uL10x Loading buffer to each well, mix well, load the sample, and electrophoresed at 120V for 35min. After the electrophoresis is completed, take out the gel and develop it on the machine.

[0030] Fluorescence quantitative PCR to verify primer specificity: Fluorescence quantitative PCR: 10µL system, 2×SP qPCR Mix 5.0µL, Forward primer (10 µM) 0.2µL, Reverse primer (10 µM) 0.2µL, cDNAs 1.0µL, ddH2O3.6µL. Reaction conditions: 95℃, 30s; 40 cycles at 95℃, 10s; 62℃, 10s; 72℃, 10s, fluorescence was collected at 72℃. Melting curves were collected, and the temperature increased by 0.5℃ each cycle from 60℃ to 95℃, for a total of 71 cycles.

[0031] Sanger sequencing identified circABCA1 ring

[0032] Extract total RNA from Caki-1 and 786-O cells by Trizol method: Wash the collected cells twice with PBS, collect the cell pellet by centrifugation, and add 500 μL Trizol liquid. Add 100 μL chloroform and mix vigorously. Let stand at room temperature for 5 minutes. If the solution is in a stratified state, it is normal; otherwise, add more chloroform to adjust the situation. Centrifuge at 4℃, 12000 g, 15min. Collect the supernatant. According to the volume of the collected supernatant, add isopropanol in a 1:1 ratio, mix gently to avoid RNA breakage, and let stand for 10min. Centrifuge at 4℃, 12000 g, 10 min. Discard the supernatant, add 1mL 75% ethanol, and mix gently. Centrifuge at 7000 g / min, 5min, 4℃, discard the supernatant, add 1mL 75% ethanol, and mix gently. Centrifuge at 7000 g / min, 5min, 4℃, discard the supernatant, centrifuge instantly, absorb the excess alcohol with a pipette tip, and put it in a fume hood to evaporate the alcohol. Heat the enzyme-free water in a 65°C metal bath, add the preheated water to the precipitate to dissolve the precipitated RNA and form an RNA solution.

[0033] Tissue or cell RNA quality and concentration identification: Turn on the NanoDrop One ultra-micro-volume spectrophotometer instrument, wait for the machine self-check to complete, and click on the nucleic acid concentration determination (RNA determination). After a blank test with nuclease-free water, take 1 μL of each sample for determination. Observe and record the RNA concentration and A260 / 280, A260 / 230 ratios. After the measurement, wash the instrument with nuclease-free water, exit the measurement interface, and turn off the instrument.

[0034] RNA was reverse transcribed according to the following system: reverse transcription system: 5× PrimeScript buffer 2μL, Random 6mers (100 µM) 2.5μL, Enzyme 0.5μL, H2O up to 10μL; 40 µL DEPC water was added to the reverse transcription product for dilution. The expression of related genes was quantitatively detected according to the following system: 10µL system, 2×SP qPCR Mix 5.0µL, Forward primer (10 µM) 0.2µL, Reverse primer (10 µM) 0.2µL, ddH2O 3.6µL, cDNAs1.0µL. Reaction conditions: 95℃, 30s; 39 cycles at 95℃, 10 s; 62℃, 10 s; 72℃, 10 s, and fluorescence was collected at 72℃. Melting curves were collected, and the temperature increased by 0.5℃ each cycle from 60℃ to 95℃, for a total of 71 cycles. The obtained products were stored at 4°C. The final PCR products using cDNA as template obtained after reverse transcription with random primers were subjected to Sanger sequencing.

[0035] Results: By Figure 2 It can be seen that the primers designed according to the structure of circABCA1, agarose gel electrophoresis showed that the size of circABCA1 product was between 100bp and 150bp, consistent with the expected 117bp, and Sanger sequencing results confirmed the circularization of circABCA1.

[0036] Example 2 Identification of circular RNA characteristics of circABCA1

[0037] Ribonuclease R (RNase R) digestion to identify circABCA1 circularization: According to a method similar to Example 1, total RNA from Caki-1 and 786-O cells was extracted by Trizol method and then digested according to the following system: 1) mock group: 10×buffer 1.5 μL, RNA 5 μg, ddH2O up to 15 μL; 2) RNase R group: 10×buffer 1.5 μL, RNA 5 μg, RNase R6 ul, ddH2O up to 15 μL. Reaction conditions: 37°C, 10 min; 85°C, 5 s; stored at 4°C. After digestion, 5 μL of the product was subjected to 1% agarose gel electrophoresis.

[0038] Agarose gel electrophoresis: Prepare 1% agarose gel, mix according to the ratio of agarose: TAE = 1g: 100mL, and heat in a microwave until the solution is clear. Add nucleic acid dye (10000x), the concentration of nucleic acid dye working solution is 1x, mix well and pour the mixture into the mold, wait for the liquid to cool and solidify, then take it out and place it in the electrophoresis instrument. Take the above common PCR product, add 1uL 10x Loading buffer to each well, mix well and load the sample, and perform electrophoresis at 120V for 40min. After the electrophoresis, take out the gel for development.

[0039] Quantitative PCR was used to detect the expression levels of circABCA1, linear ABCA1 and GAPDH after digestion. Take 5 μL of the digested product and perform reverse transcription according to the following system: 10 μL system, 5× PrimeScript buffer 2μL, Random 6mers (100 μM) 2.5μL, Enzyme 0.5μL, RNA 5μL. Reaction conditions: 37℃, 15 min; 85℃, 5 s; stored at 4℃.

[0040] After adding 40 µL of nuclease-free water to the reverse transcription product for dilution, the expression of circABCA1, linear ABCA1 and GAPDH was quantitatively detected according to the following system, with three replicates per group. 10 µL system, 2×SP qPCR Mix 5.0 µL, Forward primer (10 µM) 0.2 µL, Reverse primer (10 µM) 0.2 µL, ddH2O 3.6 µL, cDNAs 1.0 µL. Reaction conditions: 95°C, 30 s; 39 cycles at 95°C, 10 s; 62°C, 10 s; 72°C, 10 s, and fluorescence was collected at 72°C during the cycle.

[0041] Oligo dT primer reverse transcription to identify circABCA1 circularization: 1) The same RNA samples were reverse transcribed in the following groups (10uL system): Group 1: 5× PrimeScript buffer 2μL, Random 6 mers (100 μM) 2.5μL, Enzyme 0.5μL, H2O up to 10μL; Group 2: 5× PrimeScript buffer 2μL, Oligo dT Primer (50 μM) 2.5μL, Enzyme 0.5μL, H2O up to 10μL. Reaction conditions: 37℃, 15 min; 85℃, 5 s; 4℃ storage.

[0042] Genome amplification experiments to identify circABCA1 ring:

[0043] DNA Extraction Kit (spin column type) (Qingke Bio) Extract gDNA from Caki-1 and 786-O cells: 1) Digest Caki-1 and 786-O cells with trypsin, wash and centrifuge at 1000 g for 5 min and discard the supernatant; add 200 μl GTL and mix thoroughly. Oscillate until the sample is completely suspended; if RNA needs to be removed, add 4 μl 100 mg / ml RNase A solution after the above steps, vortex for 15 seconds, and leave at room temperature for 2 minutes. 2) Add 20 μl Proteinase K and 200 μl Buffer GL, vortex and mix thoroughly, and place in a 56℃ water bath for 10 minutes. 3) Centrifuge briefly to remove water droplets on the inner wall of the tube cap. Add 200 μl anhydrous ethanol and vortex and mix thoroughly. Centrifuge briefly. Vortex and mix immediately after adding Buffer GL and anhydrous ethanol. White precipitate may be produced after adding Buffer GL and anhydrous ethanol, which will not affect subsequent experiments. Some tissues may form a sol-like product after adding Buffer GL and anhydrous ethanol. In this case, vigorous shaking or vortexing is recommended. 4) Add all the solution obtained in the previous step to the adsorption column (Spin Columns DM) in the collection tube. If the solution cannot be added in one time, it can be transferred in multiple times. Centrifuge at 12,000 rpm (~13,400 × g) for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube. 5) Add 500 μl Buffer GW1 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube. 6) Add 500 μl Buffer GW2 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Note: If you need to further improve the purity of DNA, repeat step 7.7) Centrifuge at 12,000 rpm for 2 minutes and discard the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes to dry thoroughly. 8) Place the adsorption column in a new centrifuge tube (self-prepared), add 50-200 μl Buffer GE or sterile water to the middle of the adsorption column, place it at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute, and collect the DNA solution, which is the total DNA of Caki-1 and RCC-JF cells. Store DNA at -20℃. 9) ​​Use NanoDropOne to determine the concentration and quality of DNA. Perform conventional PCR according to the following reaction system: 10μL system, r Taq 5.0μL, Forward primer (10 μM) 0.2μL, Reverse primer (10 μM) 0.2μL, ddH2O 3.6μL, cDNAs1.0μL.Reaction conditions: 95°C, 5 min; 40 cycles at 95°C, 30 s; 62°C, 30 s; 72°C, 1 min; 72°C, 10 min; 4°C, 5 min. The above PCR products were subjected to 2% agarose gel electrophoresis.

[0044] Effect of actinomycin on the stability of circABCA1: 1) Caki-1 and 786-O cells in good condition were plated in 12-well plates, and 1.5×10 5 2) After overnight culture, when the cells adhered to the wall and the cell density reached about 60%, actinomycin (2 μg / mL) was added, and the same volume of DMSO was added to the control group and culture continued. 3) After 2h, 4h, 6h, 8h, and 10h of actinomycin treatment, total cell RNA was extracted and qRT-PCR was used to detect the expression of circABCA1 and linearABCA1.

[0045] Results: By Figure 3 It can be seen that after RNase R digestion, circABCA1 is more resistant to RNase R digestion than its parent gene linearABCA1, which proves that circABCA1 is more stable; Oligo dT primer reverse transcription experiment proves that Oligo dT can reverse transcribe the linearABCA1 gene but cannot reverse circABCA1, which proves that circABCA1 lacks the poLyA tail compared with linearABCA1, so circABCA1 cannot be detected in the Oligo dT reverse transcription product; the genome amplification experiment further illustrates the circularization of circABCA1, so the product cannot be amplified using the primers of circABCA1 in genomic DNA; the actinomycin D experiment confirms that circABCA1 is more stable than linearABCA1.

[0046] Example 3 circABCA1 is significantly overexpressed in ccRCC tumor tissues and is associated with tumor grade. 1. Extract total RNA from tissues: 1) Carefully remove tumor tissues and paracancerous tissues from liquid nitrogen or -80 °C, chop them into pieces, and place them in a lysate tube containing 1 mL Trizol. Mark them and precool them on ice. Note: Use lysate A for ccRCC tissues. 2) Place the precooled lysate tube into a disruptor and set the disruptor program. The lysate A program is "5m / s 20s, 2 cycles" 3) Place the disrupted lysate tube into a low-temperature centrifuge and centrifuge at 12,000 g for 10 min. Take the supernatant, add chloroform at a ratio of 5:1, vortex mix for 30s or mix vigorously manually for 15s. Let stand at room temperature for 5 min. It is normal if the solution is in a stratified state; otherwise, add more chloroform to adjust the situation. 4) Centrifuge at 4 °C, 12,000 g, 15 min. 5) Collect the supernatant. According to the volume of collected supernatant, add isopropanol in a 1:1 ratio, mix gently to avoid RNA breakage, and let stand for 10 min. 6) Centrifuge at 4℃, 12000 g, 10 min. 7) Discard supernatant, add 1mL 75% DEPC ethanol, and mix gently. 8) Centrifuge at 7000 g / min, 5min, 4℃. 9) ​​Discard supernatant, add 1mL 75% DEPC ethanol, and mix gently. 10) Centrifuge at 7000 g / min, 5min, 4℃. 11) Discard supernatant, centrifuge briefly, use a pipette to absorb excess alcohol, and place in a fume hood to evaporate the alcohol. 12) Heat enzyme-free water in a 55℃ metal bath, add preheated water to the precipitate, dissolve the precipitated RNA, and form an RNA solution. Store at -80℃.

[0047] Tissue or cell RNA quality and concentration identification: 1) Turn on the NanoDrop One ultra-micro-volume spectrophotometer instrument, wait for the machine self-check to complete, and click on the nucleic acid concentration determination (RNA determination). 2) After the blank test with nuclease-free water, take 1μL of each sample for determination. Observe and record the RNA concentration and A260 / 280, RNA ratio is close to 2), A260 / 230 ratio, the ratio is greater than 2. 3) After the measurement, wash the instrument with nuclease-free water, exit the measurement interface, and turn off the instrument. Tissue RNA mRNA reverse transcription is performed according to the following system: 10 µL system, 5×PrimeScript buffer 2 µL, Oligo dT Primer (50 µM) 0.5µL, Random 6 mers (100 µM) 0.5 µL, Enzyme 0.5µL, RNA 500ng, ddH2O up to 10 µL. Reaction conditions: 37℃, 15 min; 85℃, 5 s; 4℃ storage. Add 40 µL of DEPC water to the reverse transcription product for dilution. Quantitative detection of related gene expression was performed according to the following system: 10µL system, 2×SP qPCR Mix 5.0µL, Forwardprimer (10 µM) 0.2µL, Reverse primer (10 µM) 0.2µL, ddH2O 3.6µL, cDNAs 1.0µL. Reaction conditions: 95℃, 30s; 39 cycles at 95℃, 10 s; 62℃, 10 s; 72℃, 10 s, and fluorescence was collected at 72℃ during the cycle.

[0048] Results: By Figure 4 It can be seen that circABCA1 is significantly highly expressed in ccRCC tissues. According to the clinical information of ccRCC tissues, it can be seen that circABCA1 is related to tumor grade and distant metastasis. The higher the tumor grade and the more distant metastases, the higher the expression of circABCA1.

[0049] Example 4 Designing siRNA molecules to inhibit circABCA1 expression and detecting the inhibition efficiency

[0050] The sequences of the designed siRNA for circABCA1 were (siRNA was synthesized by Qingke Biotechnology) siRNA sense strand: GCCCAGGACAGUUCUGCAGAUTT (SEQ ID NO: 2); antisense strand: AUCUGCAGAACUGUCCUGGGCTT (SEQ ID NO: 3)

[0051] Cell transfection experiment: 1) Plating: Caki-1 and 786-O in good condition were plated at 2.5×10 per well (6-well plate).5 1) siRNA transfection: after 24 h of adherent culture, mix the transfection reagents according to the following system: A: 300 μL opti-MEM + 9 μL Lipo 8000 + 15ul NC siRNA; B: 300 μL opti-MEM + 9 μL Lipo 8000 + 15 μL siRNA-1; C: 300 μL opti-MEM + 9 μL Lipo 8000 + 15 μL siRNA-2; A, B, C systems are mixed and allowed to stand for 15 minutes; 3) discard the culture medium in the 6-well plate, add 1.9mL of new complete culture medium to each well; add 100μL of the above mixed liquid to each well; 4) after mixing the culture medium, place the 6-well plate in a 37°C, 5% CO2 cell culture incubator for sterile culture, and extract the RNA of the cells by Trizol method after 48 hours;

[0052] Total cellular RNA was extracted using a method similar to that in Example 1.

[0053] The quality and concentration of tissue or cell RNA were identified using a method similar to that in Example 1.

[0054] Tissue RNA was reverse transcribed using the following system: 10µL system, 5×PrimeScript buffer 2µL, Oligo dT Primer (50 µM) 0.5µL, Random 6 mers (100 µM) 0.5µL, Enzyme 0.5µL, RNA 500ng, ddH2O up to 10 µL. Reaction conditions: 37℃, 15 min; 85℃, 5 s; 4℃ storage. Add 40 µL DEPC water to the reverse transcription product for dilution. The expression of related genes was quantitatively detected using the following system: 10µL system, 2×SP qPCR Mix 5.0µL, Forward primer (10 µM) 0.2µL, Reverse primer (10 µM) 0.2µL, ddH2O 3.6µL, cDNAs 1.0µL. Reaction conditions: 95°C, 30 s; 39 cycles at 95°C, 10 s; 62°C, 10 s; 72°C, 10 s, with fluorescence collected at 72°C. Melting curves were collected.

[0055] Results: By Figure 5 It can be seen that the primer fluorescence quantitative PCR system designed according to the structure of circABCA1 was successful. The interference efficiency of siRNA designed according to circABCA1 was greater than 50%, confirming that the siRNA of circABCA1 was successfully constructed.

[0056] Example 5 siRNA molecules interfering with circABCA1 significantly inhibited the proliferation and migration of ccRCC cells in vitro.

[0057] Cell transfection experiment: 1) Plating: Caki-1 and 786-O in good condition were plated at 2.5×10 per well (6-well plate). 5 cells for plating; 2) siRNA transfection: after 24 h of adherent culture, mix the transfection reagents according to the following system: A: 300 μL opti-MEM + 9 μL Lipo 8000 + 15ul NC siRNA; B: 300 μL opti-MEM + 9 μL Lipo 8000 + 15 μL siRNA-1; C: 300 μL opti-MEM + 9 μL Lipo 8000 + 15 μL siRNA-2; A, B, C systems are mixed and allowed to stand for 15 minutes; 3) Discard the culture medium in the 6-well plate, add new 1.9mL complete culture medium to each well; add 100μL of the above mixed liquid to each well; 4) After mixing the culture medium, place the 6-well plate in a 37℃, 5% CO2 cell culture incubator for sterile culture, and perform functional experiments after 48 hours.

[0058] Clone formation experiment: 1) Caki-1 and 786-O cells were transfected with si-circABCA1 and negative control si-NC. After 48 hours of transfection, the Caki-1 and 786-O cells with si-circABCA1 and si-NC were digested to obtain cell suspension. The cell amount was set to 3000 cells / well and inoculated in a 6-well plate. 2) Continue to culture until 10 days or until the number of cells in most single clones is greater than 60, change the medium every 2 days and observe the cell status. 3) After the cloning is completed, take pictures of the cells under a microscope, then wash once with PBS, add 1 mL of 4% paraformaldehyde to each well for 15 min, and wash once with PBS. 4) Add 1 ml of crystal violet stain to each well and stain the cells for 15 min. 5) Wash the cells several times with PBS, dry them, and scan them with a scanner.

[0059] Cell CCK-8 proliferation assay: Caki-1 and 786-O cells were transfected with si-circABCA1 and negative control si-NC, and the CCK-8 kit was used for the experiment. 1) Caki-1 and 786-O cells with si-circABCA1 and si-NC were digested to obtain cell suspension, and the cell volume was set to 3000 cells / well. They were cultured in a 37℃ incubator for 24h, 48h, 72h, and 96h, respectively. The same sample was repeated 3 times. 2) After 24h, 48h, 72h, and 96h of culture, the original culture medium was discarded from each well. 100uL CCK-8 mixture was added, in which CCK-8: culture medium reagent = 1:9, and then continued to be cultured in a 37℃ cell incubator for 2 hours. 3) Measure the absorbance at 450nm and obtain the corresponding OD value.

[0060] Cell migration assay: Caki-1 and 786-O cells were transfected with si-circABCA1 and negative control si-NC, and the number of cells that could penetrate the membrane after transfection was determined by cell migration analysis. Specific steps: 1) Digest the cells in the cell culture dish using the digestion method and centrifuge. Resuspend Caki-1 and 786-O cells in Mccoys 5A and RPMI1640 culture media without FBS, respectively. The amount of cells added was 3×10 for Caki-1 and 3×10 for 786-O. 4 cell / well, 786-O: 2.5×10 4 cell / well. 2) Add 200 μL of cell suspension to the upper chamber and 500 μL of complete cell culture medium containing 10% FBS to the lower chamber, and culture at 37°C for 24 hours. 3) After the culture is completed, wipe off the non-invasive cells on the upper chamber with a cotton swab, remove the transwells chamber, invert, and air dry. 4) Place the chamber in a 24-well plate with 500 μL of crystal violet staining solution, and immerse the membrane in the culture medium staining solution at 37°C for 10 minutes. 5) Remove the chamber, wash with PBS, take pictures, and count.

[0061] Cell invasion assay: Caki-1 and 786-O cells were transfected with si-circABCA1 and negative control si-NC, respectively, and the number of cells that could penetrate the membrane after transfection was determined by cell migration assay. The specific steps are as follows: 1) Thaw the matrigel stock solution in a 4℃ refrigerator 12h in advance and transfer it to an ice box before the experiment. Pre-cool the 1.5 mL EP tube, pipette tip and cell chamber on ice. 2) Dilute the solution on ice according to the amount of matrigel: serum-free medium = 1:8. 3) Pipette 100µL / well of matrigel dilution on ice and gently add it to the upper chamber of the chamber. Move the pipette tip slowly when adding to ensure that the liquid is spread on the bottom. Place it in a 37℃ incubator for 60min to solidify the gel. 4) Digest the cells in the cell culture dish using the digestion method and centrifuge them. Resuspend the cells of Caki-1 and 786-O in Mccoys 5A and RPMI1640 medium without FBS, respectively. The amount of cells added is 6×10 for Caki-1 and 6×10 for 786-O. 4 cell / well, 786-O is 3×10 4 cell / well. 5) Add 200 μL of cell suspension to the upper chamber and 500 μL of complete cell culture medium containing 10% FBS to the lower chamber, and culture at 37°C for 20-24 hours. 6) After the culture is completed, wipe off the non-invasive cells on the upper chamber with a cotton swab, remove the transwells chamber, invert, and air dry. 7) Place the chamber in a 24-well plate with 500 μL of crystal violet staining solution, and immerse the membrane in the culture medium staining solution at 37°C for 10 minutes. 8) Take out the chamber, wash with PBS, take pictures, and count.

[0062] Cell scratch test: 1) Caki-1 and 786-O cells were transfected with si-circABCA1 and negative control si-NC, respectively. After 36 hours of transfection, the cell culture medium containing 1% FBS was replaced, and the next step was performed after 12 hours. 2) Use a 6-well plate cell rake to evenly draw horizontal lines in a 6-well plate. There are three lines every 0.5~1cm. 3) Wash the cells 3 times with PBS, remove the scratched cells, and add cell culture medium containing 1% FBS. 4) Place in a 37℃ 5% CO2 incubator and culture. Sample at 0 and 24 hours and take pictures.

[0063] Results: According to Figure 6 It can be seen that the proliferation and metastasis ability of cells were significantly reduced after interfering with circABCA1. The above results show that siRNA interfering with circABCA1 significantly inhibited the proliferation and metastasis of ccRCC cells in vitro. Therefore, the circular RNA gene circABCA1 has broad prospects as a therapeutic drug and prognosis for ccRCC patients in the future.

[0064] Example 6 Interference in the expression of circABCA1 significantly inhibited the growth of ccRCC subcutaneous tumors and liver metastasis in vivo.

[0065] Injection of cholesterol-modified siRNA (Qingke Gene Synthesis): The sequence of cholesterol-modified circABCA1 siRNA was designed as (Qingke Gene Synthesis) si-circABCA1-Chol: positive chain: Cholesterol-GCCCAGGACAGUUCUGCAGAUTT (SEQ ID NO: 4); antisense chain: Cholesterol-AUCUGCAGAACUGUCCUGGGCTT (SEQ ID NO: 5) The cholesterol modification method is: the phosphate group at the 5' end of the siRNA positive chain and antisense chain reacts with the hydroxyl group on the cholesterol modification group, thereby adding a cholesterol modification group to the structure of siRNA: the cholesterol modification site is as follows. In this experiment, ccRCC subcutaneous tumor-bearing NSG mice were purchased from Southern Model Organisms Co., Ltd. The mice were randomly divided into groups according to the size of the tumor, with 5 mice in each group, and cholesterol-modified si-NC and si-circABCA1 were injected respectively. Injections were performed once every two days and at multiple points. The tumor size was recorded every 5 days. After 30 days, the mice were killed, the tumors were dissected, and the tumor size was recorded and the tumor weight was weighed.

[0066] Cholesterol modification sites:

[0067] Establishment of sh-circABCA1 stable ccRCC cell line: 1) Infect 786-O and Caki-1 cells with sh-circABCA1 virus (synthesized by Hanheng Biotechnology) at a ratio of MOI = 1:50, and add Polybrene (7 μg / mL) to 786-O cells and Polybrene (8 μg / mL) to Caki-1 cells. Replace with fresh complete medium 24 hours after infection. 2) After 48 hours of infection, add puromycin for screening. Puromycin screening concentration: 2 μg / mL for 786-O and 3 μg / mL for Caki-1. One screening cycle ends when all wild-type cells that are not infected with the virus die. Then replace the complete medium containing puromycin once every 2-3 days. After 3 generations of continuous screening, freeze the stable cells. 3) Extract total RNA from stable cells and control cells by Trizol method, and perform qRT-PCR to detect the expression of circABCA1 according to the method in Example 1.

[0068] Intrasplenic injection of 786-O stable transfectant with stable interference of circABCA1 expression: When the stable transfectant was cultured to a sufficient level, cells were obtained from the cell culture flask using trypsin digestion. The cells were divided into sh-NC group and sh-circABCA1 group, with 3 mice in each group. 5×10 6 Each group was resuspended with 500 μL PBS buffer solution, and each mouse was injected with 150 μL of cell suspension. The mice were killed and their livers were dissected after 60 days.

[0069] Results: According to Figure 7 As a result, the growth and metastasis of tumors in vivo were significantly reduced after interfering with circABCA1. The above results indicate that siRNA interfering with circABCA1 can inhibit the growth and metastasis of ccRCC in vivo.

[0070] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A siRNA for inhibiting circular RNA circABCA1, characterized in that It comprises an antisense strand and a sense strand identical to the target region sequence, wherein the antisense strand is complementary to circABCA1; wherein the length of the sense strand is 17 nt to 25 nt, and the length of the antisense strand is 16 nt to 31 nt; preferably, the length of the antisense strand is 19 nt to 25 nt.

2. The siRNA according to claim 1, wherein The nucleotide sequence of circABCA1 is SEQ ID NO:

1.

3. The siRNA according to claim 1, wherein The nucleotide sequence of the antisense strand is SEQ ID NO:

3.

4. The siRNA according to claim 3, characterized in that When the nucleotide sequence of the antisense strand is SEQ ID NO:3, the nucleotide sequence of the sense strand is SEQ ID NO:

2.

5. The siRNA according to any one of claims 1 to 4, characterized in that The sense strand or antisense strand is modified with a phosphate group, a lipophilic compound, or a cell penetrating peptide.

6. The siRNA according to claim 5, characterized in that A lipophilic compound is bound to the phosphate groups at the 5' end of the sense and antisense strands.

7. The siRNA according to claim 6, characterized in that The lipophilic compound is selected from cholesterol, tocopherol, docosahexaenoic acid (DHA), palmitic acid and long-chain fatty acids with more than 10 carbon atoms; preferably cholesterol; more preferably, the antisense strand sequence of the siRNA modified with cholesterol is SEQ ID NO: 5 and the sense strand sequence is SEQ ID NO:

4.

8. Use of the siRNA according to any one of claims 1 to 7 in the preparation of a medicament for treating renal cell carcinoma (RCC).

9. The use according to claim 7, characterized in that The renal cell carcinoma (RCC) is clear cell renal cell carcinoma (ccRCC).

10. A pharmaceutical composition for treating renal cell carcinoma (RCC), characterized in that: The method comprises the siRNA according to any one of claims 1 to 6, and a pharmaceutically acceptable excipient.

Images