IncRNA inhibitor and application thereof in preparation of medicine for treating glaucoma

Abstract

The invention relates to the technical field of biological medicine, and discloses an lncRNA inhibitor and application thereof in preparation of a medicine for treating glaucoma, and the target sequence of the lncRNA inhibitor is shown as SEQ ID NO: 6. The lncRNA inhibitor obtained by the invention can be used for successfully treating glaucoma.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a lncRNA inhibitor and an application thereof in preparing a drug for treating glaucoma. Background Art

[0002] Glaucoma is a disease caused by pathological increase in intraocular pressure, which seriously threatens and damages the visual function of the optic nerve and can lead to permanent vision loss. It has become the second leading cause of blindness in the world and the world's first irreversible blinding eye disease. Primary open-angle glaucoma (POAG) is the most common type of glaucoma, and its pathogenesis is still unknown. Lowering intraocular pressure is an effective method to delay and control the development of glaucoma as clearly pointed out in the glaucoma diagnosis and treatment guidelines of various countries. POAG patients prefer drug treatment, and most of them need lifelong medication after diagnosis. However, neither drugs nor surgery can guarantee complete and effective control of intraocular pressure and avoid optic nerve damage. Therefore, seeking an economical, safe and effective drug treatment method has become a hot issue in medicine. Summary of the invention

[0003] In order to solve the above technical problems, the present invention provides a lncRNA inhibitor and use thereof in the preparation of a drug for treating glaucoma. The lncRNA inhibitor obtained by the present invention can successfully treat glaucoma.

[0004] The present invention provides an application of a lncRNA inhibitor in preparing a drug for treating glaucoma, wherein the target sequence of the lncRNA inhibitor is shown in SEQ ID NO:6.

[0005] Furthermore, the lncRNA inhibitor includes antisense nucleic acid, siRNA, miRNA or shRNA; the target sequence of the antisense nucleic acid, siRNA, miRNA or shRNA is shown in SEQ ID NO:6.

[0006] Furthermore, the SEQ ID NO:6 is TTCGGGAAGGGAGGCTGCTTTGA.

[0007] Furthermore, the sense strand of the siRNA is shown as SEQ ID NO:1; and the antisense strand of the siRNA is shown as SEQ ID NO:2.

[0008] Furthermore, the SEQ ID NO: 1 is AAAGCAGCCUCCCUUCCCGAA.

[0009] Furthermore, the SEQ ID NO: 2 is CGGGAAGGGAGGCUGCUUUGA.

[0010] Furthermore, the shRNA is constructed from siRNA targeting lncRNA, the sense strand of the siRNA is shown as SEQ ID NO: 1; the antisense strand of the siRNA is shown as SEQ ID NO: 2.

[0011] The present invention also provides a lncRNA inhibitor, which comprises a lncRNA inhibitor and a pharmaceutically acceptable carrier in the preparation of a pharmaceutical composition for treating glaucoma; The sequence of the lncRNA is shown in SEQ ID NO:3; the lncRNA inhibitor refers to a molecule that has an inhibitory effect on lncRNA, and the inhibitor is selected from antisense nucleic acid, siRNA, miRNA or shRNA, and the target sequence of the antisense nucleic acid, siRNA, miRNA or shRNA is shown in SEQ ID NO:6.

[0012] Furthermore, the pharmaceutically acceptable carrier includes one of a lentivirus and a vesicle.

[0013]

[0014] The embodiments of the present invention have the following technical effects: The present invention successfully inhibits the expression of lncRNA, thereby inhibiting the expression of the TGF-β2 signaling pathway, ultimately reducing the deposition of extracellular matrix in human trabecular meshwork cells (HTMCs), lowering intraocular pressure, and achieving the effect of treating glaucoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1 It is a microscopic picture of the vesicle provided by the embodiment of the present invention.

[0017] Figure 2 It is the expression of the vesicle-produced protein in the present invention.

[0018] Figure 3 It is the effect of siRAN inhibitor on the expression of TGF-β2 pathway proteins.

[0019] Figure 4 It is the effect of siRNA inhibitor on the RNA expression of TGF-β2 pathway.

[0020] Figure 5 It is the effect of lnc-BMPR2-AS1 gene overexpression on the expression of TGF-β2 pathway proteins.

[0021] Figure 6 It is the effect of lnc-BMPR2-AS1 gene overexpression on the RNA expression of TGF-β2 pathway.

[0022] Figure 7 It is the effect of vesicles on the expression of TGF-β2 pathway proteins.

[0023] Figure 8 It is the effect of vesicles on the RNA expression of TGF-β2 pathway.

[0024] Fig. 9 It is the effect of lnc-BMPR2-AS1 gene overexpression on the expression of ECM gene-related proteins.

[0025] Fig.10 The effect of lnc-BMPR2-AS1 gene overexpression on ECM gene-related RNA expression.

[0026] Fig.11 It is the effect of vesicles on the expression of ECM gene-related proteins in cell experiments.

[0027] Fig.12 It is the effect of vesicles on the expression of RNA related to ECM genes in cell experiments.

[0028] Fig.13 This is the result of animal experiment test.

[0029] Fig.14 This is the test result of the targeting of siRNA to lncRNA sequence in the present invention. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0031] In a first aspect, some embodiments of the present invention provide a use of a lncRNA inhibitor in the preparation of a drug for treating glaucoma, wherein the target sequence of the lncRNA inhibitor is shown in SEQ ID NO:6.

[0032] In some embodiments, the lncRNA inhibitor comprises antisense nucleic acid, siRNA, miRNA or shRNA; the target sequence of the antisense nucleic acid, siRNA, miRNA or shRNA is shown in SEQ ID NO:6.

[0033] In some embodiments, the SEQ ID NO: 6 is TTCGGGAAGGGAGGCTGCTTTGA.

[0034] In some embodiments, the sense strand of the siRNA is shown as SEQ ID NO:1; and the antisense strand of the siRNA is shown as SEQ ID NO:2.

[0035] In some embodiments, the SEQ ID NO: 1 is AAAGCAGCCUCCCUUCCCGAA.

[0036] In some embodiments, the SEQ ID NO: 2 is CGGGAAGGGAGGCUGCUUUGA.

[0037] In some embodiments, the shRNA is constructed from siRNA targeting lncRNA, the sense strand of the siRNA is shown in SEQ ID NO: 1; the antisense strand of the siRNA is shown in SEQ ID NO: 2.

[0038] In a second aspect, some embodiments of the present invention further provide a lncRNA inhibitor, which comprises a lncRNA inhibitor and a pharmaceutically acceptable carrier in the preparation of a pharmaceutical composition for treating glaucoma; The sequence of the lncRNA is shown in SEQ ID NO:3; the lncRNA inhibitor refers to a molecule that has an inhibitory effect on lncRNA, and the inhibitor is selected from antisense nucleic acid, siRNA, miRNA or shRNA, and the target sequence of the antisense nucleic acid, siRNA, miRNA or shRNA is shown in SEQ ID NO:6.

[0039] In some embodiments, the pharmaceutically acceptable carrier comprises one of a lentivirus and a vesicle.

[0040]

[0041] The following is described in conjunction with specific embodiments: Embodiment 1: (1) We established H2O2 as an oxidative stress model, extracted total RNA from human trabecular meshwork cells for lncRNA and mRNA sequencing, and found that lncRNA and mRNA subpopulations closely related to TGF-β2 signaling were differentially regulated in human trabecular meshwork cells under oxidative stress. Therefore, we constructed a network of lncRNAs co-localized and co-expressed with TGF-β2 to study the effects and regulatory mechanisms of potential lncRNAs on extracellular matrix (ECM) deposition in human trabecular meshwork cells. Through gain-of-function and loss-of-function experiments, we screened out a lncRNA, as shown in SEQ ID NO:3 (lncRNA ID: TCONS_00079729, named lnc-BMPR2-AS1). The lncRNA showed negative feedback with the target gene BMPR2. In the prior art, BMPR2 is associated with extracellular ECM deposition (in the absence of BMPR2, the expression of extracellular matrix proteins is significantly upregulated, leading to abnormal ECM deposition). Inhibiting the expression of lnc-BMPR2-AS1 can alleviate the excessive deposition of extracellular matrix caused by BMPR2 deficiency, so lnc-BMPR2-AS1 may be a potential therapeutic target for glaucoma.

[0042] Table 1 Information of lncRNA of the present invention

[0043] (1) Vesicle isolation: Sample pretreatment: After culturing in serum-free medium for 48 hours, the cell culture medium was collected and centrifuged at 300 g for 10 minutes at 4°C to remove suspended cells and obtain cell supernatant.

[0044] (2) Use differential centrifugation: Low-speed centrifugation (to remove cell debris): Centrifuge at 2000 g for 15 minutes at 4°C to remove cell debris and large particulate matter, and collect the supernatant.

[0045] Medium-speed centrifugation (to remove large particles and microvesicles): Centrifuge at 10,000 g for 30 minutes at 4°C to remove organelle remnants (such as mitochondria) and larger vesicles, and retain the supernatant.

[0046] High-speed centrifugation (enrichment of small extracellular vesicles): at 4°C, 100,000 g centrifugal force, for 90 min, collect the precipitate after centrifugation, which contains small extracellular vesicles (exosomes).

[0047] (3) Washing the precipitate: The precipitate was resuspended in 1 mL of PBS buffer and centrifuged again at 100,000 g for 60 minutes at 4°C to remove contaminants. The final precipitate was collected and resuspended in an appropriate amount of PBS buffer solution and stored at -80°C for later use. Figure 1 shown.

[0048] (4) We designed siRNA targeting lncRNA, denoted as si-lnc-BMPR2-AS1-1, with the following sense strand sequence: AAAGCAGCCUCCCUUCCCGAA, and the following antisense strand sequence: CGGGAAGGGAGGCUGCUUUGA; the si-lnc-BMPR2-AS1-1 targeted position was the 2912-2934 interval in the lncRNA sequence. We then commissioned Shanghai Jima Pharmaceutical Technology Co., Ltd. to synthesize the siRNA. We also prepared and synthesized other siRNAs for comparison, denoted as si-lnc-BMPR2-AS1-2, with the following sense strand sequence (SEQ ID NO:4): UCUUCAAAUGGCUUUACCCUC, and the following antisense strand sequence (SEQ ID NO:5): GGGUAAAGCCAUUUGAAGAAU.

[0049] (5) Experiments using vesicles encapsulating the siRNA of the present invention to treat human trabecular meshwork cells under oxidative stress: A plasmid ring containing the siRNA sequence (si-lnc-BMPR2-AS1-1) (denoted as: pcDNA3.1+si-lnc-BMPR2-AS1) or an empty vector (denoted as: pcDNA3.1+si-NC) was transfected into human trabecular meshwork cells, and a plasmid ring overexpressing the lnc-BMPR2-AS1 gene (denoted as: pcDNA3.1+lnc-BMPR2-AS1) was used as a control.

[0050] (7) Detection of RNA levels by qRT-PCR: RNA levels of lnc-BMPR2-AS1, COL1α1 (collagen type I α1 chain), COL4α1 (collagen type IV α1 chain), MMP2 (matrix metalloproteinase 2), and VIM (vimentin) were detected using quantitative real-time polymerase chain reaction (qRT-PCR), a technique that can quantify gene expression levels. GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as an internal control to normalize the data and ensure that any changes in gene expression were not due to changes in RNA loading or reverse transcription efficiency.

[0051] (8) Detect protein levels by Western blot: Western blot analysis was used to detect the protein levels of Collagen1 (COL1A1 is Collagen1, which is mainly composed of COL1A1 and COL1A2, with COL1A1 being the main component), MMP2, and VIM, and GAPDH was used as an internal control again to ensure consistent protein loading in all samples.

[0052] (9) Extraction of si-lnc-BMPR2-AS1-1 and construction of vesicle vectors. Extracellular vesicles were separated by differential centrifugation, and siRNA was loaded into the vesicles by incubation.

[0053] Cell culture: Trabecular meshwork cells were seeded in 6-well or 24-well plates and cultured to 70%-80% confluence. Antibiotic-free culture medium was used to ensure that the cells were in good condition.

[0054] Add siRNA to vesicles: Add siRNA-loaded vesicles according to the plate specifications: 6-well plate: vesicle mass concentration 100µg / mL, add 2mL antibiotic-free medium (500mL cell basal medium, plus 10mL fetal bovine serum (FBS; Gibco, Gaithersburg, MD) and 5mL TM cell growth supplement (Cat. No. 6592, ScienCell)). Incubate at 37℃ for 24-48 hours.

[0055] Negative control group: vesicles without siRNA were added.

[0056] DBA / 2J hereditary glaucoma mouse model was purchased, 9 months old, 10 males and 5 females were injected with vesicles loaded with the siRNA of the present invention by the tail, and the rest served as a control group.

[0057] (10) Testing of siRNA targeting lncRNA sequence: A glaucoma model was established, and a siRNA targeting lncRNA (si-lnc-BMPR2-AS1-1) and another siRNA si-lnc-BMPR2-AS1-2 were set up. A control group (si-NC) was also set up. The control group did not add siRNA. PCR was used to test the RNA expression levels of NG_085727.1 sequence, lnc-BMPR2-AS1 sequence and TGF-β2. The test results are as follows: Fig.14 shown.

[0058] Results and Analysis: exist Figure 2 In the present invention, the expression of the exosome markers CD9 protein and CD63 protein produced by the vesicles obtained in Example 1 was identified, proving that the target vesicles were successfully obtained in the present invention.

[0059] In order to further evaluate the effect of lncRNA on the TGF-β2 signaling pathway in the present invention, two siRNAs were used in the present invention for comparison, one of which was the siRNA targeting lncRNA according to the present invention (si-lnc-BMPR2-AS1-1), and the other siRNA was si-lnc-BMPR2-AS1-2, to verify whether the expression of TGF-β2 signal was inhibited; a control group (si-NC) was also provided, and the control group was not added with siRNA. TGF-β2 is the most common TGF-β subtype associated with the eye. It promotes the expression of a variety of ECM proteins (extracellular matrix proteins), which can promote the occurrence of extracellular matrix, thereby increasing the resistance of aqueous humor outflow through TM (trabecular meshwork) and causing intraocular pressure. Therefore, the protein expression levels and RNA levels of TGF-β2, pSMAD2 / 3 and SMAD2 / 3 were detected in the present invention, and the results are as follows: Figure 3 and Figure 4 As shown. Figure 3 The results showed that after siRNA successfully inhibited the expression of lnc-BMPR2-AS1 gene, the RNA and protein levels of TGF-β2 decreased significantly, inhibiting the expression of TGF-β2 signal, while SMAD2 / 3 did not decrease. In addition, immunoblot analysis showed that the phosphorylation level of SMAD2 / 3 was reduced after inhibiting the expression of lnc-BMPR2-AS1 gene. Figure 4 In this study, the expression of RNA of related proteins was verified, and the results were consistent with Figure 3 Consistently, siRNA inhibited the expression of TGF-β2 signaling by suppressing the expression of lnc-BMPR2-AS1 gene.

[0060] The effect of siRNA was further verified by overexpression of lnc-BMPR2-AS1 gene. One group was added with lnc-BMPR2-AS1 gene (denoted as: pc-lnc-BMPR2-AS1), and the other group was a blank control group without adding lnc-BMPR2-AS1 gene (denoted as: pcDNA3.1). The results are shown in Figure 5 and Figure 6 As shown. Figure 5 and Figure 6 The results showed that when the lnc-BMPR2-AS1 gene was overexpressed, it significantly upregulated the expression of TGF-β2 but not SMAD2 / 3, and promoted the phosphorylation of SMAD2 / 3, further verifying that lncRNA affects glaucoma by affecting the expression level of TGF-β2.

[0061] exist Figure 7In the cell experiment, the siRNA of the present invention (si-lnc-BMPR2-AS1-1) and other siRNAs (si-lnc-BMPR2-AS1-2) were used to inhibit the expression of TGF-β2 signal. A control group (si-NC) was also set up, in which no siRNA was added. The expression levels of MMP2 protein and VIM protein were successfully inhibited by siRNA. Figure 8 In the experiment, we further studied whether the use of vesicles as carriers in the present invention would affect the effect of siRNA, and used vesicles as carriers for the siRNA of the present invention (recorded as: si-lnc-BMPR2-AS1-sEVs). The three groups also tested the expression levels of RNAs related to extracellular matrix proteins such as lnc-BMPR2-AS1, COL1ɑ1, COL4ɑ1, MMP2 and VIM. Figure 8 The results showed that the protein expression levels of lnc-BMPR2-AS1, COL1ɑ1, COL4ɑ1, MMP2 and VIM RNA were successfully inhibited by adding siRNA, indicating that inhibiting the expression of lnc-BMPR2-AS1 gene reduced the expression of related ECM genes. It also verified that using vesicles as carriers for encapsulating inhibitors would not affect the function of the inhibitors.

[0062] The RNA and protein levels of ECM genes such as lnc-BMPR2-AS1, COL1ɑ1, COL4ɑ1, MMP2, and VIM were further detected by overexpression of the lnc-BMPR2-AS1 gene. Fig. 9 and Fig.10 As shown. It can be found that when the lnc-BMPR2-AS1 gene is overexpressed, the expression of related ECM genes will be upregulated. It can be seen that the expression of lnc-BMPR2-AS1 will promote the occurrence and development of glaucoma.

[0063] The siRNA of the present invention was encapsulated in vesicles and subjected to cell experiments. The results are as follows: Fig.11 and Fig.12 As shown. pcDNA3.1+si-NC was used as the control group (plasmid ring without lnc-BMPR2-AS1), pcDNA3.1+lnc-BMPR2-AS1 (plasmid ring containing lnc-BMPR2-AS1), pcDNA3.1+si-lnc-BMPR2-AS1 (plasmid ring containing the siRNA of the present invention), pcDNA3.1+si-lnc-BMPR2-AS1-sEVs (vesicles coated with plasmid ring containing the siRNA of the present invention). Fig.11 Fig.12 The results showed that the vesicles did not affect the inhibitory effect of siRNA on the target site, and siRNA successfully inhibited the target site.

[0064] The obtained vesicle-encapsulated siRNA was used in animal experiments, and the results were as follows Fig.13 As shown, it can be found that the inhibitor of the present invention can successfully reduce the intraocular pressure of mice, which shows that the inhibitor of the present invention can successfully treat glaucoma.

[0065] exist Fig.14 It was found that the siRNA (si-lnc-BMPR2-AS1-1) of the present invention has good targeting and can successfully act on the 2912-2934 sites in the lncRNA sequence, thereby reducing the expression of the lnc-BMPR2-AS1 sequence.

[0066] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the technical solutions of the embodiments of the present invention.

Claims

1. Use of a lncRNA inhibitor in the preparation of a drug for treating glaucoma, characterized in that: The target sequence of the lncRNA inhibitor is shown in SEQ ID NO:

6.

2. The use according to claim 1, characterized in that: The lncRNA inhibitor includes antisense nucleic acid, siRNA, miRNA or shRNA; The target sequence of the antisense nucleic acid, siRNA, miRNA or shRNA is shown in SEQ ID NO:

6.

3. The use according to claim 2, characterized in that: The sense strand of the siRNA is shown in SEQ ID NO: 1; the antisense strand of the siRNA is shown in SEQ ID NO:

2.

4. The use according to claim 3, characterized in that: The shRNA is constructed from siRNA targeting lncRNA, the sense strand of the siRNA is shown in SEQ ID NO: 1; the antisense strand of the siRNA is shown in SEQ ID NO:

2.

5. A lncRNA inhibitor, characterized in that The preparation of a pharmaceutical composition for treating glaucoma includes a lncRNA inhibitor and a pharmaceutically acceptable carrier; The sequence of the lncRNA is shown in SEQ ID NO:3; the lncRNA inhibitor refers to a molecule that has an inhibitory effect on lncRNA, and the inhibitor is selected from antisense nucleic acid, siRNA, miRNA or shRNA, and the target sequence of the antisense nucleic acid, siRNA, miRNA or shRNA is shown in SEQ ID NO:

6.

6. The lncRNA inhibitor according to claim 5, characterized in that The pharmaceutically acceptable carrier includes one of a lentivirus and a vesicle.

Images