Recombinant escherichia coli containing PDRN sequence and preparation method thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to recombinant escherichia coli containing a PDRN sequence and a preparation method thereof, and the preparation method comprises the following steps: S1, preparing a PDRN solution; s2, complementing the double strands of the PDRN into blunt ends; s3, constructing a recombinant plasmid; s4, carrying out mixed culture on a product obtained in the step S3 and escherichia coli DH5alpha; s5, screening the recombinants; s6, carrying out PCR (Polymerase Chain Reaction) amplification, and recording a strain from a fragment with the length of more than 200bp; s7, preparing a seed solution by adopting the strain prepared in the step S6; s8, strain fermentation; and S9, centrifugally collecting thalli. The method comprises the following steps: constructing a recombinant plasmid containing a PDRN fragment, introducing the recombinant plasmid into Escherichia coli, subsequently culturing the recombinant Escherichia coli to copy DNA in the Escherichia coli, extracting a purified exogenous gene fragment to obtain a strain containing a single fragment PDRN sequence, and getting rid of dependence on raw materials during subsequent extraction.

Description

Technical Field

[0001] The invention relates to a recombinant Escherichia coli containing a PDRN sequence and a preparation method thereof, and belongs to the technical field of microorganisms. Background Art

[0002] Existing PDRN (polydeoxyribonucleotide) is mainly extracted from fish germ cells, especially sperm cells of trout and salmon, which are the main source of PDRN extraction due to their rich nucleic acid content. Since the extraction of PDRN is limited by the raw material (fish testes), it is expensive and scarce, and it is difficult to control the distribution range of the product molecular weight during the degradation process, it is difficult to obtain satisfactory PDRN fragments. In addition, high temperature may be required in the process conditions, which is prone to Maillard reaction, causing the product color to turn yellow and affecting product quality. Summary of the invention

[0003] In view of the above problems of the prior art, the present invention provides a recombinant Escherichia coli containing a PDRN sequence and a preparation method thereof.

[0004] The technical solution of the present invention to solve the above technical problems is as follows: One of the purposes of the present invention is to provide a method for preparing a recombinant Escherichia coli containing a PDRN sequence, comprising the following steps: S1. Prepare PDRN solution; S2, double-strand completion: complete the double-strand of PDRN to a blunt end; S3, plasmid construction: connect the product of step S2 into the plasmid to construct a recombinant plasmid; S4, E. coli culture: the product of step S3 is mixed and cultured with competent E. coli DH5α; S5. Recombinant screening: centrifuge the product of step S4, retain the culture medium, mix the culture medium with Escherichia coli DH5α, culture on a plate for 12h-16h, select the white monoclonal strain on the plate, and expand the culture; S6, PCR amplification: taking the bacterial solution in step S5 as a template, performing PCR amplification with a primer pair, and recording the strains from which the fragments longer than 200 bp are derived; S7, preparing seed solution: using the strain prepared in step S6 to prepare seed solution; S8, strain fermentation: using the seed solution prepared in step S7 to mix with the E. coli culture solution, and stopping the fermentation when the bacterial growth enters a stable phase; S9, collecting recombinant E. coli: The fermented bacterial liquid in step S8 is centrifuged using a centrifuge to collect the bacterial cells.

[0005] On the basis of the above technical solution, the present invention can also make the following improvements: Furthermore, in step S3, the pLB plasmid is used to construct a recombinant plasmid, and the product of step S2 is connected into the pLB plasmid using a rapid cloning kit.

[0006] Further, in step S6, the primer pair is: pLBF:CGACTCACTATAGGGAGAGCGGC; pLBR: AAGAACATCGATTTTCCATGGCAG.

[0007] Furthermore, in step S3, the Hieff plasmid is used to construct a recombinant plasmid, and the product of step S2 is connected into the Hieff plasmid using a rapid cloning kit.

[0008] Further, in step S6, the primer pair is: M13R-48:AGCGGATAACAATTTCACACAGGA; M13F-47:CGCCAGGGTTTTCCCAGTCACGAC.

[0009] The advantages of using the above pLB plasmids and Hieff plasmids compared to traditional plasmids are: ① They have all been linearized and do not require enzyme cutting to construct an opening before use; ② They contain a screening gene at the opening. When the plasmid is not inserted with an exogenous gene fragment, self-cyclization will cause the gene to be expressed, making it impossible for unqualified bacteria to grow, thereby avoiding the problem of excessive colony growth and affecting bacterial selection when using a more complex culture medium and other plasmids in the subsequent strain isolation; ③ The ligation reaction takes a short time, only a few minutes, while the traditional plasmid (for example: PUC19 plasmid) requires a reaction time of at least 1 hour and at most overnight for the ligation reaction; ④ The two plasmids have the same restriction endonuclease recognition sites on both sides of the interface, of which the sites on both sides of the interface of the TIANGEN brand pLB plasmid are BglII, and the sites on both sides of the interface of the YISEN brand Hieff plasmid (Clone ® The sites on both sides of the interface of the Plus OneStep Cloning Kit are EcoRI and EcoRV, which means that only one restriction endonuclease instead of two can be used in the subsequent enzyme digestion of the plasmids to separate the exogenous fragments, thereby reducing costs.

[0010] Further, step S4 specifically includes the following operations: The product of step S3 was mixed with competent Escherichia coli DH5α, placed in an ice bath for 15 min-25 min, then heat-shocked for 30 s-50 s, placed in an ice bath again for 1 min-2 min, and then sterile LB liquid culture medium was added and shaken for 1 h.

[0011] Further, step S5 specifically includes the following operations: The product of step S4 was centrifuged at 3000 g for 3 min-5 min, and the excess culture medium was removed, and 90 μL-110 μL of the culture medium was retained. The retained culture medium was remixed with Escherichia coli and spread on a solid LB culture plate containing ampicillin sodium, and cultured at 37°C for 12 h-16 h. When the growth of single colonies was observed and the culture was stopped before they adhered to each other, the white monoclonal strains on the plate were selected for expansion culture.

[0012] Further, in step S1, powdered PDRN is added to pure water for dilution to obtain a PDRN solution, wherein the pure water used is sterile ultrapure water, and the concentration of the diluted PDRN solution is 10 ng / μL-2000 ng / μL; In step S2, DNA polymerase and dNTP are added to treat the product of step S1 to complete the double-stranded ends of PDRN into blunt ends, and the DNA polymerase used is a high-fidelity DNA polymerase; In step S7, a liquid LB medium containing ampicillin sodium is added with the strain prepared in step S6 to prepare a seed solution.

[0013] Further, in step S8, the Escherichia coli culture solution comes from any one of LB medium, MSM medium, and M9 medium, and the volume ratio of the seed solution to the Escherichia coli culture solution is 1:99-1:4.

[0014] The second object of the present invention is to provide a recombinant Escherichia coli containing a PDRN sequence prepared by the preparation method described above.

[0015] The beneficial effects of the present invention are as follows: the present invention adopts PDRN to construct a recombinant plasmid containing a PDRN fragment, and then introduces the recombinant plasmid into Escherichia coli, and subsequently cultivates the recombinant Escherichia coli to replicate the DNA in the Escherichia coli, and extracts and purifies the exogenous gene fragment, so as to obtain a strain containing a single fragment PDRN sequence, which can get rid of the dependence on the raw material (salmon sperm cells) in the subsequent extraction, and the preparation process is simple and easy to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The electrophoretogram of the powdered PDRN product of the four fragments used in Example 1; Figure 2 This is a photo of the white monoclonal strain on the solid LB culture plate of Example 1; Figure 3 The electrophoresis diagram of the recombinant plasmid extracted from the recombinant Escherichia coli in Example 1; Figure 4 This is the electrophoresis diagram of the recombinant plasmid of Example 1 after enzyme digestion; Figure 5 This is a photo of a white monoclonal strain on a solid LB culture plate of a comparative example; Figure 6 This is the electrophoresis diagram of the PCR results of white colonies in the control plate, with the same markers on the left and right sides; Figure 7 This is the electrophoresis diagram of the PCR results of the white colonies in the plate of Example 2, with the same markers on the left and right sides. DETAILED DESCRIPTION

[0017] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0018] Example 1 (1) Add sterile ultrapure water to dissolve the commercially available powdered PDRN product (Regimin, polydeoxyribonucleotide, batch number: 20240327) to obtain a PDRN product dilution with a diluted concentration of 1000 ng / μL.

[0019] The electrophoresis diagram of the powdered PDRN product raw material in this example is shown in Figure 1 , you can see Figure 1 The electrophoretic bands in the sample are diffuse, indicating that the sequence fragment lengths of the PDRN raw material products derived from salmon are inconsistent, and it is not easy to obtain a satisfactory fragment length.

[0020] (2) Treat the product from step (1) with a high-fidelity DNA polymerase and dNTPs to complete the double-stranded DNA into blunt ends.

[0021] (3) Use the TIANGEN brand pLB zero background rapid cloning kit (VT205) to connect the product of step (2) into the plasmid to construct a recombinant pLB plasmid.

[0022] (4) Mix the product of step (3) with competent gene-deficient Escherichia coli DH5α, place on ice for 20 minutes, heat shock for 50 seconds, place on ice again for 2 minutes, and then add sterile LB liquid culture medium and shake and culture for 1 hour.

[0023] (5) Centrifuge the cultured E. coli at 3000 g for 5 min, remove the excess culture medium, retain about 100 μL of culture medium, remix the retained culture medium with the E. coli, and spread it on a pre-prepared solid LB culture plate containing ampicillin sodium. Culture at 37°C for 15 h. Stop culturing when single colony growth is observed and before they adhere to each other. Select the white monoclonal strain on the plate, that is, the E. coli containing the recombinant plasmid with the inserted exogenous fragment, and expand the culture.

[0024] See the picture of white monoclonal strains on solid LB culture plates. Figure 2 .exist Figure 2 In the figure, numbers 1, 2, 3, and 4 correspond to PDRN samples from different sources, and the upper and lower rows correspond to different coating concentrations, where the coating concentration in the upper row is 200 ng / μL, and the coating concentration in the lower row is 1000 ng / μL.

[0025] (6) Using the bacterial solution after the expanded culture in step (5) as a template, amplify the PCR reaction with the primer pair (pLBF: CGACTCACTATAGGGAGAGCGGC and pLBR: AAGAACATCGATTTTCCATGGCAG), record the strains from which the fragments longer than 200 bp are derived, and then sequence them to obtain the gene sequence, and select the strain containing the sequence shown in SEQ ID No. 1 for subsequent experiments.

[0026] The strain has been submitted for biological deposit and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on February 24, 2025. The deposit address is Beijing, China. The deposit number is CGMCC NO.33625, and the classification name is Escherichia coli.

[0027] (7) Use liquid LB medium containing ampicillin sodium and add the strain selected in step (6) to prepare seed solution.

[0028] (8) The seed solution prepared in step (7) was mixed with a common Escherichia coli culture medium at a volume ratio of 10:90, and sodium ampicillin was added to prevent bacterial strain degeneration.

[0029] The components of the culture solution used in this step of the present embodiment are as follows: Fermentation medium (g / L): 20 g / L yeast extract, 10 g / L tryptone, 13.5 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate, 8 g / L glycerol; Feed medium (g / L): 80 g / L yeast extract, 40 g / L tryptone, 13.5 g / L potassium dihydrogen phosphate, 4 g / L magnesium sulfate, 400 g / L glycerol.

[0030] When the bacterial concentration is high (the relative concentration of the bacterial concentration is determined by using a UV spectrophotometer to detect the light absorption value at 600nm), the fermentation is stopped when the bacterial growth enters the stable phase (usually OD 600 to 1.9).

[0031] (9) Centrifuge the fermented bacterial broth at 10,000 g to 13,000 g to collect the bacterial cells.

[0032] The collected bacteria were then used to extract the recombinant plasmid using the TIANGEN brand plasmid extraction kit, and pure recombinant plasmid bands were visible (see Figure 3 Two electrophoresis lanes can be seen in the figure. The one on the left is the RN-MK5 DNAMarker of Ruibo Xingke Company. The sizes of the bands in the figure from top to bottom are 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. The one on the right is the recombinant plasmid. The sizes of different bacterial species vary slightly, but they are all distributed in the range of 3000bp to 5000bp).

[0033] The recombinant plasmid finally obtained in this example was digested by enzymes to obtain a single fragment (see Figure 4 ), rather than the mixture in the original PDRN sample, which is non-dispersible (see Figure 1 ), it can be seen that the method of the present invention can be used to obtain recombinant Escherichia coli that can purify PDRN fragments with consistent sequence and length.

[0034] Figure 4 In the figure, the three bands from top to bottom in the left lane are all plasmid DNA bands extracted from the recombinant strain (different plasmid morphologies result in different band positions), the two bands in the middle lane are two fragments produced after enzyme digestion of the plasmid, and the right lane is a marker.

[0035] Example 2 In this embodiment, the difference from embodiment 1 is that in step (3) of this embodiment, the recombinant Hieff plasmid is constructed using the Clone®Plus One Step Cloning Kit plasmid of the YISEN brand; and the universal M13 sequencing primer pair must be used for amplification in step (6): M13R-48:AGCGGATAACAATTTCACACAGGA; M13F-47:CGCCAGGGTTTTCCCAGTCACGAC.

[0036] In step (6), a strain containing a fragment longer than 200 bp is obtained, and a strain containing a sequence as shown in SEQ ID No. 2 is selected for subsequent testing.

[0037] The PCR electrophoresis diagram of the white colonies obtained in the plate in step (5) of this example is shown in Figure 7 .

[0038] Comparative Example The plasmid used in this comparative example is the PUC 19 plasmid. Unlike Example 1, the PUC19 plasmid in this comparative example needs to be linearized before use, that is, the following experimental process is performed: ① Select any restriction site in the multiple cloning site region of PUC19, use the corresponding restriction endonuclease for restriction digestion, and inactivate the restriction endonuclease after digestion.

[0039] ②Use high-fidelity DNA polymerase and dNTP raw materials to treat the digested plasmid and perform end completion.

[0040] ③ Use gel recovery technology to recover the linearized plasmid vector after treatment.

[0041] The rest is the same as Example 1.

[0042] This comparative example has the following problems when using the pUC 19 plasmid to construct recombinant E. coli: ① Plasmid linearization must be performed before use, which increases the complexity of the process.

[0043] ② Low ligation efficiency. This is manifested by the fact that during the plate coating process (step S5), there are few colonies growing on the plate and the proportion of blue colonies is too large compared to white colonies (without foreign gene fragments inserted) (see Figure 5 , where the blue circles are blue colonies and the white circles are white colonies).

[0044] ③ The false positive results account for too many. This is manifested by the fact that more false positive colonies are generated during the colony PCR identification process (step S6), see the product fragment electrophoresis diagram ( Figure 6 ), the bands located below 300 bp accounted for about 90%, that is, the false positive clones in the comparative example accounted for about 90% (it is usually hoped that the fragment length of the PDRN raw material sequence is above 300 bp), while the false positive clones in Example 2 of the present invention accounted for about 66% (see Figure 7 ).

[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for preparing a recombinant Escherichia coli containing a PDRN sequence, characterized in that: The following steps are involved: S1. Prepare PDRN solution; S2, double-strand completion: complete the double-strand of PDRN to a blunt end; S3, plasmid construction: connect the product of step S2 into the plasmid to construct a recombinant plasmid; S4, E. coli culture: the product of step S3 is mixed and cultured with competent E. coli DH5α; S5. Recombinant screening: centrifuge the product of step S4, retain the culture medium, mix the culture medium with Escherichia coli DH5α, culture on a plate for 12h-16h, select the white monoclonal strain on the plate, and expand the culture; S6, PCR amplification: taking the bacterial solution in step S5 as a template, performing PCR amplification with a primer pair, and recording the strains from which the fragments longer than 200 bp are derived; S7, preparing seed solution: using the strain prepared in step S6 to prepare seed solution; S8, strain fermentation: using the seed solution prepared in step S7 to mix with the E. coli culture solution, and stopping the fermentation when the bacterial growth enters the stable phase; S9, collecting recombinant E. coli: The fermented bacterial liquid in step S8 is centrifuged using a centrifuge to collect the bacterial cells.

2. The method for preparing a recombinant Escherichia coli containing a PDRN sequence according to claim 1, characterized in that: In step S3, the pLB plasmid is used to construct a recombinant plasmid.

3. The method for preparing a recombinant Escherichia coli containing a PDRN sequence according to claim 2, characterized in that: In step S6, the primer pair is: pLBF:CGACTCACTATAGGGAGAGCGGC; pLBR: AAGAACATCGATTTTCCATGGCAG.

4. The method for preparing a recombinant Escherichia coli containing a PDRN sequence according to claim 1, characterized in that: In step S3, Hieff plasmid is used to construct a recombinant plasmid.

5. The method for preparing a recombinant Escherichia coli containing a PDRN sequence according to claim 4, characterized in that: In step S6, the primer pair is: M13R-48:AGCGGATAACAATTTCACACAGGA; M13F-47:CGCCAGGGTTTTCCCAGTCACGAC.

6. The method for preparing a recombinant Escherichia coli containing a PDRN sequence according to any one of claims 1 to 5, characterized in that: Step S4 specifically includes the following operations: The product of step S3 was mixed with competent Escherichia coli DH5α, placed in an ice bath for 15 min-25 min, then heat-shocked for 30 s-50 s, placed in an ice bath again for 1 min-2 min, and then sterile LB liquid culture medium was added and shaken for 1 h.

7. The method for preparing a recombinant Escherichia coli containing a PDRN sequence according to any one of claims 1 to 5, characterized in that: Step S5 specifically includes the following operations: The product of step S4 was centrifuged at 3000 g for 3 min-5 min, and the excess culture medium was removed, and 90 μL-110 μL of the culture medium was retained. The retained culture medium was remixed with E. coli and spread on a solid LB culture plate containing ampicillin sodium, and cultured at 37°C for 12 h-16 h. When the growth of single colonies was observed and the culture was stopped before they adhered to each other, the white monoclonal strain on the plate was selected for expansion culture.

8. The method for preparing a recombinant Escherichia coli containing a PDRN sequence according to any one of claims 1 to 5, characterized in that: In step S1, powdered PDRN is added to pure water for dilution to obtain a PDRN solution, wherein the pure water used is sterile ultrapure water, and the concentration of the diluted PDRN solution is 10 ng / μL-2000 ng / μL; In step S2, DNA polymerase and dNTP are added to treat the product of step S1 to complete the double-stranded ends of PDRN into blunt ends, and the DNA polymerase used is a high-fidelity DNA polymerase; In step S7, a liquid LB medium containing ampicillin sodium is used and the strain prepared in step S6 is added to prepare a seed solution.

9. The method for preparing a recombinant Escherichia coli containing a PDRN sequence according to any one of claims 1 to 5, characterized in that: In step S8, the Escherichia coli culture solution comes from any one of LB medium, MSM medium, and M9 medium, and the volume ratio of the seed solution to the Escherichia coli culture solution is 1:99-1:

4.

10. The recombinant Escherichia coli containing the PDRN sequence prepared by the preparation method as described in any one of claims 1-5.

Images