Escherichia coli recombinant bacterium for whole-cell catalytic synthesis of rebaudioside M as well as construction method and application of escherichia coli recombinant bacterium

Abstract

The invention discloses an escherichia coli recombinant bacterium for whole-cell catalytic synthesis of rebaudioside M as well as a construction method and application of the escherichia coli recombinant bacterium. The Escherichia coli recombinant bacterium for the whole-cell catalytic synthesis of the rebaudioside M, which is constructed by the invention, contains a glycosyl transferase UGT76G1 coding gene mutant, a glycosyl transferase UGT91C1 coding gene mutant, a sucrose synthase atSuS1 gene and a polyphosphoglucokinase cgPPGK gene; a glucose-1-phosphate uridine transferase galU gene, a nucleoside diphosphate kinase ndk gene and a nucleoside diphosphate kinase ndk gene are over-expressed; meanwhile, an encoding gene araA gene of L-arabinose isomerase and an encoding gene ushA gene of 5 '-nucleotidase / UDG hydrolase are knocked out. According to the recombinant escherichia coli constructed by the invention, Reb D is prevented from being directly used as a synthetic substrate, so that the raw materials are easier to obtain, and the conversion rate of the substrate and the synthetic rate and yield of rebaudioside M are remarkably improved.

Description

Technical Field

[0001] The present invention relates to the technical field of biosynthesis, and in particular to a recombinant Escherichia coli strain for whole-cell catalytic synthesis of rebaudioside M, and a construction method and application thereof. Background Art

[0002] With the rapid economic development and continuous social progress, people's living standards have improved significantly. This improvement is not only reflected in the enrichment of material life, but also in people's pursuit of quality of life. A healthy diet and lifestyle have become an important goal pursued by people. However, excessive intake of high-calorie sugars, such as sucrose and fructose, may cause health problems such as obesity and diabetes. Therefore, finding a natural sweetener with high sweetness, low calories and safety has become the focus of people's attention.

[0003] Rebaudioside M (Reb M) is a natural sweetener that stands out among many natural sweeteners due to its high sweetness, low aftertaste and sucrose-like taste. Reb M is derived from Stevia rebaudiana Bertoni, a South American shrub native to the alpine meadows on the border between Paraguay and Brazil, belonging to the genus Eupatorium of the Asteraceae family, also known as "Paraguay grass". Locally, the use of stevia leaves as a natural sweetener has a history of hundreds of years. Initially, Reb M was mainly extracted from the plant stevia, but because its content in dry leaves was less than 1%, this method was costly and difficult to meet market demand. Therefore, the development of an efficient and low-cost synthesis method has become a research hotspot. At present, the synthesis methods of Reb M mainly include chemical method, fermentation method and bio-enzyme method. However, the chemical synthesis steps are cumbersome and the conditions are complex; the fermentation method has the disadvantages of long cycle, low substrate conversion rate and complex purification process; although the enzyme synthesis is more efficient, the workload is large and the enzyme separation and purification is cumbersome.

[0004] Based on the protein structure of UGT76G1, GUO et al. analyzed the amino acid residues that may interact with Reb D through molecular docking, and selected these amino acid residue sites and used UGT76G1-T284S as the starting enzyme for alanine scanning, site-directed saturation mutagenesis and combined mutagenesis. They obtained the mutant UGT76G1-T284S / M88L / L200A with a catalytic activity 2.38 times that of UGT76G1-T284S. They used the mutant enzyme UGT76G1-T284S / M88L / L200A to construct a cascade reaction with the sucrose synthase AtSuSy from Arabidopsis thaliana, and achieved the preparation of 23.37 g / L RebM with a yield of 90.5% by optimizing the cascade reaction. WANG et al. studied the whole-cell catalytic synthesis of Reb M in Pichia pastoris and investigated the effects of enzyme catalysis, mixed enzyme reaction and mixed cell reaction on the synthesis. The results showed that mixed enzyme catalysis had the best effect and 0.24 mM Reb M could be synthesized with a conversion rate of 95% within 96 h.

[0005] Although a whole-cell catalytic method for preparing Reb M was established in the above studies, there are problems with the conversion efficiency, synthesis rate and yield of Reb M synthesis, which are still difficult to meet the needs of industrial production. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention provides a recombinant Escherichia coli strain for whole-cell catalytic synthesis of rebaudioside M and its construction method and application. The whole-cell catalytic method adopted in the present invention is a biocatalytic technology that combines the advantages of fermentation and enzymatic methods. The enzyme accumulates in the chassis cells, and then the bacteria are collected for catalysis, which eliminates the cumbersome enzyme purification steps and is more controllable than the chemical method.

[0007] The technical solution of the present invention is as follows:

[0008] A recombinant Escherichia coli strain for whole-cell catalytic synthesis of rebaudioside M contains a glycosyltransferase UGT76G1 encoding gene mutant, a glycosyltransferase UGT91C1 encoding gene mutant, a sucrose synthase atSuS1 gene, and a polyphosphate glucose kinase cgPPGK gene; overexpresses a glucose-1-phosphate uridyltransferase galU gene, a nucleoside diphosphate kinase ndk gene, and; and simultaneously knocks out an L-arabinose isomerase encoding gene araA gene and a 5'-nucleotidase / UDG hydrolase encoding gene ushA gene.

[0009] Furthermore, the glycosyltransferase UGT76G1 encoding gene mutant is obtained by introducing T284S, M88L and L200A mutation sites on the basis of the sequence of gene number GenBank: 6KVI_A, and the nucleotide sequence of the glycosyltransferase UGT76G1 encoding gene mutant is as shown in SEQ ID NO.1; the UGT91C1 encoding gene mutant is obtained by introducing F208M and F379A mutation sites on the basis of the sequence of gene number GenBank: 7ERX_A, and the nucleotide sequence of the UGT91C1 encoding gene mutant is as shown in SEQ ID NO.2; the nucleotide sequence of the atSuS1 gene is as shown in SEQ ID NO.3.

[0010] Furthermore, the nucleotide sequence of the cgPPGK gene is shown in SEQ ID NO.4; the nucleotide sequence of the galU gene is shown in SEQ ID NO.5; and the nucleotide sequence of the ndk gene is shown in SEQ ID NO.6.

[0011] Furthermore, the glycosyltransferase UGT76G1 encoding gene mutant is fused with a xxa solubility-promoting tag; the glycosyltransferase UGT91C1 encoding gene mutant is fused with a xxa solubility-promoting tag.

[0012] Furthermore, the galU gene and the ndk gene are overexpressed by constructing a plasmid expression vector and transferring it into Escherichia coli.

[0013] Furthermore, the deposit number of the recombinant Escherichia coli is CCTCC M 2025427.

[0014] A method for constructing a recombinant Escherichia coli, the method comprising the following steps:

[0015] The araA gene and ushA gene in Escherichia coli BL21 (DE3) were knocked out by homologous recombination technology; then UGT91C1 containing a fusion xxa solubility tag was constructed. F208M-F379A expression cassette, UGT76G1 fused with xxa lytic tag T284S -M88L-L200A A three-gene expression plasmid vector containing an expression cassette of and an expression cassette of atSUS1; an overexpression plasmid vector containing galU gene, ndk gene and cgPPGK gene is constructed; and the constructed three-gene expression plasmid vector and the overexpression plasmid vector are transformed into competent cells of Escherichia coli BL21 (DE3) in which the araA gene and the ushA gene are knocked out to obtain the recombinant Escherichia coli bacteria.

[0016] Furthermore, the process of knocking out the araA gene in Escherichia coli BL21 (DE3) is as follows:

[0017] (1) Using the pKIKO plasmid as a template, primers DaraA-F and DaraA-R were designed and PCR amplified to obtain a fragment containing the araA gene knockout;

[0018] The nucleotide sequence of DaraA-F is shown in SEQ ID NO.7; the nucleotide sequence of DaraA-R is shown in SEQ ID NO.8;

[0019] (2) The pKD46 plasmid was transformed into competent cells of Escherichia coli BL21 (DE3), and then transformed into competent cells again by adding L-arabinose for induction. Then, the araA gene knockout fragment to be transformed obtained in step (1) was added, and colony PCR verification was performed to obtain Escherichia coli BL21 (DE3) in which the araA gene was knocked out.

[0020] Furthermore, the process of knocking out the ushA gene in Escherichia coli BL21 (DE3) is as follows:

[0021] (1) Using the pKIKO plasmid as a template, primers DushA-F and DushA-R were designed and PCR amplified to obtain a fragment containing the ushA gene knockout;

[0022] The nucleotide sequence of DushA-F is shown in SEQ ID NO.9; the nucleotide sequence of DushA-R is shown in SEQ ID NO.10;

[0023] (2) The pKD46 plasmid was transformed into competent cells of Escherichia coli BL21 (DE3) in which the araA gene was knocked out, and then induced by adding L-arabinose and transformed into competent cells again, and then the ushA gene knockout fragment to be transformed obtained in step (1) was added, and colony PCR verification was performed to obtain Escherichia coli BL21 (DE3) in which the araA gene and the ushA gene were knocked out.

[0024] An application of the recombinant Escherichia coli bacteria, the application specifically comprising: using rebaudioside A as a substrate and the recombinant Escherichia coli bacteria as a catalyst to obtain rebaudioside M through fed-batch fermentation.

[0025] The beneficial technical effects of the present invention are:

[0026] The present invention introduces glycosyltransferases UGT76G1 and UGT91C1 to build an in vitro multi-enzyme cascade reaction system, and screens and determines the best solubility-promoting tags for expressing the two key enzymes, thereby greatly improving the solubility of the two proteins, increasing the protein expression amount and the conversion rate of the product, so that the relatively cheap rebaudioside A is first catalyzed by UGT91C1 to rebaudioside D, and then catalyzed by UGT76G1 to produce rebaudioside M, avoiding the direct use of expensive and rare Reb D as a substrate for synthesizing rebaudioside M, making the raw materials easier to obtain. At the same time, in the process of catalytic synthesis of rebaudioside M, the UDP-UDPG cycle reaction mediated by atSUS1 can avoid the direct addition of expensive glycosyl donor UDPG, which not only improves the synthesis efficiency and reduces the cost to a certain extent, but also provides a new idea for the production of natural sweeteners. In addition, knocking out the L-arabinose isomerase encoding gene araA and the 5'-nucleotidase / UDG hydrolase encoding gene ushA, overexpressing the glucose-1-phosphate uridyltransferase encoding gene galU and nucleoside diphosphate kinase ndk, further increased the accumulation of cofactors. In addition, by expressing the polyphosphoglucokinase cgPPGK of Corynebacterium glutamicum, while synthesizing the cofactor UDPG, the inhibition of the byproduct fructose on atuSUS1 was reduced, which was also beneficial to the metabolic cycle of UDPG, thereby increasing the synthesis rate, substrate conversion rate and yield of Reb M. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 pET28a-xxa-UGT76G1 constructed for the present invention T284S-M88L-L200A -xxa-UGT91C1 F208M-F379A -atSUS1 plasmid map.

[0028] Figure 2 The plasmid map of pBAD(p15A)-galU-ndk constructed in the present invention.

[0029] Figure 3 The plasmid map of pBAD(p15A)-atSUS1-cgPPGK constructed in the present invention.

[0030] Figure 4 This is the protein electrophoresis diagram of the glycosyltransferase in the Reb M synthesis pathway expressed in Escherichia coli.

[0031] In the figure: a is a prestained protein marker; b is a protein electrophoresis diagram of the control recombinant bacteria B16 and recombinant bacteria B11, B12, B13, B14, and B15 constructed in Example 2 of the present invention; c is a protein electrophoresis diagram of the control recombinant bacteria B16 and recombinant bacteria B06, B07, B08, B09, and B10 constructed in Example 2 of the present invention.

[0032] Figure 5 Schematic diagram of UDP-glucose metabolic pathway engineering in Escherichia coli.

[0033] Figure 6 This is a graph showing the yield of Reb M synthesized by whole cells of E. coli recombinant bacteria B01, B02, B03, B04, and B05 in Example 4 of the present invention.

[0034] Figure 7 This is a growth curve of the continuous fed-batch fermentation of the recombinant Escherichia coli B05 in Example 5 of the present invention in a 3L fermenter.

[0035] Figure 8 This is a graph showing the yield of Reb M synthesized by whole-cell catalysis of the recombinant Escherichia coli B05 in Example 5 of the present invention in a 3L fermenter. DETAILED DESCRIPTION

[0036] The present invention is described in detail below in conjunction with the accompanying drawings and embodiments.

[0037] Figure 5 The schematic diagram of the UDP-glucose metabolic pathway engineering in Escherichia coli of the present invention is shown in Figure 2. UDPG is an important cofactor in the synthesis pathway of rebaudioside M, and the gene used to synthesize UDPG cited in this study is induced by L-arabinose. Since the bacteria can utilize L-arabinose itself, the arabinose utilization pathway can be blocked by knocking out the L-arabinose isomerase encoding gene araA, which can keep the arabinose concentration at a high level and enhance the induction effect. Escherichia coli itself has a UDPG cycle, and overexpression of glucose-1-phosphate uridyltransferase galU and nucleoside diphosphate kinase ndk, while knocking out 5'-nucleotidase / UDP sugar hydrolase ushA, may enhance this cycle.

[0038] Sucrose hydrolysis leads to the accumulation of fructose as a byproduct, thereby reducing the utilization of sucrose and inhibiting the in situ UDP cycle. Therefore, in the present invention, by introducing the cgPPGK gene, the expression of polyphosphate-dependent glucokinase can convert fructose into fructose-6-phosphate without relying on expensive ATP, and then enter the metabolic circulation system, thereby accelerating sucrose hydrolysis and UDP cycle.

[0039] The gene synthesis, primer synthesis and sequencing in the present invention were all commissioned to Wuxi Tianlin Biotechnology Co., Ltd.

[0040] The experimental methods used in the examples of the present invention, including plasmid construction, enzyme digestion, preparation of competent cells, transformation, etc., are all conventional methods unless otherwise specified, and the specific experimental conditions can be determined by simple experiments when necessary.

[0041] Unless otherwise specified, the materials, reagents, etc. used in the examples of the present invention can be obtained from commercial sources.

[0042] The original strain Escherichia coli BL21 (DE3) involved in the present invention was previously preserved in this laboratory and can also be purchased through commercial channels.

[0043] The recombinant Escherichia coli B05 constructed by the present invention is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Bayi Road, Hongshan District, Wuhan City, Hubei Province, the deposit number is CCTCC M 2025427, and the deposit date is March 10, 2025.

[0044] The plasmids involved in the present invention include pKIKO, pET28a, pBAD (p15A), and pKD46, which were previously preserved in this laboratory and can be purchased through commercial channels.

[0045] The gene involved in the present invention includes a glycosyltransferase mutant UGT76G1 from Stevia rebaudiana T284S-M88L-L200A , the nucleotide sequence is shown in SEQ ID NO.1; glycosyltransferase mutant UGT91C1 from rice (Oryza sativa) F208M-F379A , the nucleotide sequence is shown in SEQ ID NO.2; the sucrose synthase atSUS1 from Arabidopsis thalianan, the nucleotide sequence is shown in SEQ ID NO.3; the polyphosphate glucose kinase cgPPGK from Corynebacterium glutamicum, the nucleotide sequence is shown in SEQ ID NO.4; all are synthesized after codon optimization. In addition, the nucleotide sequence of the glucose-1-phosphate uridyltransferase galU gene from Escherichia coli is shown in SEQ ID NO.5; the nucleotide sequence of the nucleoside diphosphate kinase ndk gene from Escherichia coli is shown in SEQ ID NO.6.

[0046] SEQ ID NO.1:

[0047] ATGGAAAATAAAACGGAGACAACTGTAAGGCGCAGACGTCGCATCATCCTGTTTCCAGTTCCGTTTCAGGGTCATATTAACCCGATCCTGCAGCTGGCGAATGTTCTGTACAGCAAGGGTTTCAGCATTACCATTTTCCACACCAACTTCAACAAACCGAAAACTTCAAACTACCCGCATTTTACCTTTCGTTTTATCTTAGACAACGATCCACAAGACGAACGCATCTCCAACCTGCCGACCCACGGTCCGCTCGCGGGTCTGCGTATCCCGATTATCAACGAGCACGGCGCGGATGAGTTACGCCGTGAATTGGAGTTGCTGATGCTGGCGTCTGAAGAAGATGAGGAGGTTAGCTGCCTGATCACGGATGCTCTGTGGTATTTCGCGCAGAGCGTTGCAGATAGCTTGAATCTGCGTCGCCTGGTGTTAATGACCAGCTCCCTGTTTAACTTCCATGCACACGTGAGCCTCCCGCAATTCGATGAATTGGGCTATTTGGACCCGGACGATAAAACCCGTCTGGAGGAGCAGGCATCCGGCTTCCCAATGCTGAAGGTCAAGGATATCAAGTCCGCATATAGCAACTGGCAGATTGCGAAAGAGATCCTGGGTAAAATGATTAAGCAGACCAAAGCCAGCTCCGGCGTCATCTGGAATAGCTTCAAAGAATTGGAGGAGTCGGAGCTGGAGACGGTGATTAGAGAAATCCCGGCACCGAGCTTCCTGATTCCGTTGCCCAAGCACCTGACCGCGTCTTCAAGCTCCTTGCTGGACCATGATCGTACGGTTTTTCAGTGGCTGGATCAACAGCCTCCGTCTAGCGTGCTGTACGTGTCCTTCGGCTCGTCTAGTGAGGTTGATGAGAAAGACTTCTTGGAGATCGCCCGTGGCTTGGTTGACAGCAAGCAGAGCTTCCTGTGGGTCGTGCGTCCGGGTTTTGTTAAAGGTAGCACTTGGGTTGAACCGCTGCCGGACGGCTTCCTGGGTGAACGTGGTCGTATCGTAAAGTGGGTGCCGCAACAAGAAGTGCTTGCCCACGGCGCTATAGGCGCGTTTTGGACCCATAGCGGTTGGAACAGCACCCTGGAAAGCGTTTGTGAGGGTGTGCCGATGATCTTTAGCGACTTTGGACTGGACCAGCCGCTGAATGCTCGTTATATGTCTGACGTGCTTAAGGTGGGTGTCTATCTAGAAAACGGTTGGGAACGTGGCGAGATTGCGAATGCGATTCGTCGCGTGATGGTTGACGAGGAAGGTGAATACATCCGCCAGAATGCTCGTGTGTTGAAGCAAAAAGCGGATGTCAGCCTGATGAAAGGCGGTTCCTCTTACGAATCCCTGGAATCTCTGGTTAGCTACATTAGCTCCTTGTAA

[0048] SEQ ID NO.2:

[0049]

[0050] SEQ ID NO.3:

[0051]

[0052] SEQ ID NO.4:

[0053] ATGACCGAAACCGGCTTTGGCATTGATATTGGAGGCAGTGGCATTAAAGGCGCCCGCGTGAACCTGAAAACCGGCGAATTTATTGATGAACGCATTAAAATCGCGACCCCGAAACCGGCGACGCCTGAAGCGGTAGCGGAAGTGGTGGCGGAAATTATTAGCCAGGCGGAATGGGAAGGCCCGGTGGGCATTACCCTGCCGTCAGTTGTGCGCGGTCAGATTGCGCTGAGTGCCGCGAACATTGATAAAAGCTGGATTGGCACCGATGTGCACGAACTGTTTGACCGCCATCTGAACGGCCGTGAAATCACCGTCCTGAATGATGCCGATGCGGCCGGCATTGCCGAAGCCACCTTCGGCAACCCGGCGGCCCGTGAGGGCGCGGTTATTTTGCTGACCCTGGGCACCGGCATTGGCAGCGCGTTTCTGGTTGATGGCCAGCTGTTTCCGAATACCGAACTGGGCCACATGATTGTGGATGGTGAAGAGGCAGAACATCTGGCAGCGGCCAGCGTAAAAGAAAACGAAGACCTGAGCTGGAAAAAATGGGCGAAACATCTGAATAAAGTTCTGAGCGAATATGAAAAACTGTTTAGCCCGAGCGTGTTTATTATTGGCGGCGGCATCAGCCGCAAACATGAAAAATGGCTGCCGCTGATGGAACTGGATACCGATATTGTGCCGGCCGAATTGCGCAACCGTGCGGGCATTGTGGGCGCCGCAATGGCCGTGAACCAGCATCTGACCCCGTAA

[0054] SEQ ID NO.5:

[0055] ATGGCTGCCATTAATACGAAAGTCAAAAAAGCCGTTATCCCCGTTGCGGGATTAGGAACCAGGATGTTGCCGGCGACGAAAGCCATCCCGAAAGAGATGCTGCCACTTGTCGATAAGCCATTAATTCAATACGTCGTGAATGAATGTATTGCGGCTGGCATTACTGAAATTGTGCTGGTTACACACTCATCTAAAAACTCTATTGAAAACCACTTTGATACCAGTTTTGAACTGGAAGCAATGCTGGAAAAACGTGTAAAACGTCAACTGCTTGATGAAGTGCAGTCTATTTGTCCACCGCACGTGACTATTATGCAAGTTCGTCAGGGTCTGGCGAAAGGCCTGGGACACGCGGTATTGTGTGCTCACCCGGTAGTGGGTGATGAACCGGTAGCTGTTATTTTGCCTGATGTTATTCTGGATGAATATGAATCCGATTTGTCACAGGATAACCTGGCAGAGATGATCCG CCGCTTTGATGAAACGGGTCATAGCCAGATCATGGTTGAACCGGTTGCTGATGTGACCGCATATGGCGTTGTGGATTGCAAAGGCGTTGAATTAGCGCCGGGTGAAAGCGTACCGATGGTTGGTGTGGTAGAAAAACCGAAAGCGGATGTTGCGCCGTCTAATCTCGCTATTGTGGGTCGTTACGTACTTAGCGCGGATATTTGGCCGTTGCTGGCAAAAACCCCTCCGGGAGCTGGTGATGAAATTCAGCTCACCGACGCAATTGATATGCTGATCGAAAAAGAAACGGTGGAAGCCTATCATATGAAAGGGAAGAGCCATGACTGCGGTAATAAATTAGGTTACATGCAGGCCTTCGTTGAATACGGTATTCGTCATAACACCCTTGGCACGGAATTTAAAGCCTGGCTTGAAGAAGAGATGGGCATTAAGAAGTAA

[0056] SEQ ID NO.6:

[0057] ATGGCTATTGAACGTACTTTTTCCATCATCAAACCGAACGCGGTAGCAAAAAACGTCATTGGTAATATCTTTGCGCGCTTTGAAGCTGCAGGGTTTCAAAATTGTTGGCACCAAAATGCTGCACCTGACCGTTGAACAGGCACGTGGCTTTTATGCTGAACACGATGGAAAACCGTTCTTTGATGGTCTGGTTGAATTCATGACCTCTGGCCCGATC GTGGTTTCCGTGCTGGAAGGTGAAAACGCCGTTCAGCGTCACCGCGATCTGCTGGGCGCGACCAATCCGGCAAACGCACTGGCTGGTACTCTGCGCGCTGATTACGCTGACAGCCTGACCGAAAACGGTACCCACGGTTCTGATTCCGTCGAATCTGCCGCTCGCGAAATCGCTTATTTCTTTGGCGAAGGCGAAGTGTGCCCGCGCACCCGTTAA

[0058] The culture medium involved in the present invention includes LB solid culture medium, LB liquid culture medium, SOB culture medium, Riesenberg modified culture medium, batch culture medium, trace metal solution (1000×) and batch culture feed medium, and the formula is as follows:

[0059] LB solid medium: Each liter of culture medium contains 10g / L tryptone, 5g / L yeast extract, 10g / L sodium chloride, and 20g / L agar powder.

[0060] LB liquid medium: Each liter of culture medium contains 10g / L tryptone, 5g / L yeast extract, and 10g / L sodium chloride.

[0061] SOB medium: Each liter of medium contains 10g / L peptone, 5g / L yeast powder, 0.58g / L NaCl, 1MM MgCl 2 10 mL, 0.19 g / L KCl, 1 M MgSO 4 10mL.

[0062] Riesenberg modified medium: The batch fermentation medium components are shown in Table 1. The trace metal solution components (1000×) are shown in Table 2. Before inoculation, antibiotics such as kanamycin at a final concentration of 50 mg / L and ampicillin at a final concentration of 100 mg / L were added to the medium.

[0063] Table 1 Composition of batch medium

[0064]

[0065] Table 2 Trace metal solutions (1000×)

[0066]

[0067] (Note: The trace metal solution in Table 2 is a 1000-fold concentrated solution. When used, it needs to be added according to the volume of the fermentation broth. For example, if the fermentation broth is 1000 mL, add 1 mL of the trace metal solution.)

[0068] Table 3 Batch culture feed medium

[0069]

[0070] Example 1 Amplification of genetic elements and preparation of target plasmids

[0071] (1) Preparation of target gene

[0072] UGT76G1 T284S-M88L-L200A Gene: Based on the nucleotide sequence of glycosyltransferase UGT76G1 from Stevia rebaudiana (GenBank: 6KVI_A) provided by NCBI, the mutation sites T284S, M88L and L200A were introduced. After codon optimization, the optimized glycosyltransferase mutant gene UGT76G1 was synthesized by Wuxi Tianlin Biotechnology Co., Ltd. T284S -M88L-L200A , whose nucleotide sequence is shown in SEQ ID NO: 1.

[0073] UGT91C1 F208M-F379A Gene: Based on the nucleotide sequence of rice glycosyltransferase UGT91C1 (GenBank: 7ERX_A) provided by NCBI, the mutation sites F208M and F379A were introduced. After codon optimization, the optimized glycosyltransferase mutant gene UGT91C1 was synthesized by Wuxi Tianlin Biotechnology Co., Ltd. F208M-F379A , whose nucleotide sequence is shown in SEQ ID NO: 2.

[0074] atSuS1 gene: Based on the nucleotide sequence of sucrose synthase atSuS1 from Arabidopsis thaliana (GenBank: NP_001031915.1) provided by NCBI, after codon optimization, Wuxi Tianlin Biotechnology Co., Ltd. was commissioned to synthesize the optimized sucrose synthase gene atSUS1, whose nucleotide sequence is shown in SEQ ID NO: 3.

[0075] cgPPGK gene: Based on the nucleotide sequence of glucopolyphosphate kinase cgPPGK (GenBank: WP_011014747.1) from Corynebacterium glutamicum provided by NCBI, after codon optimization, Wuxi Tianlin Biotechnology Co., Ltd. was commissioned to synthesize the optimized glucopolyphosphate kinase gene cgPPGK, whose nucleotide sequence is shown in SEQ ID NO: 4.

[0076] galU gene: Based on the nucleotide sequence of glucose-1-phosphate uridyltransferase galU from Escherichia coli provided by NCBI (GenBank: NP_415752.1), the galU gene was obtained from the Escherichia coli genome by PCR using primers galU-F and galU-R in Primer Table 4.

[0077] ndk gene: Based on the nucleotide sequence of nucleoside diphosphate kinase ndk from Escherichia coli provided by NCBI (GenBank: NP_415752.1), the ndk gene was obtained from the Escherichia coli genome by PCR using primers ndk-F and ndk-R in Primer Table 4.

[0078] Table 4

[0079]

[0080]

[0081] Note: The homology arms in the sequences at both ends of the primers are underlined.

[0082] (2) Construction of plasmid

[0083] 2.1UGT76G1 T284S-M88L-L200A Construction of plasmid series

[0084] pET28a-UGT76G1 T284S-M88L-L200A Plasmid: The synthesized UGT76G1 T284S-M88L-L200A The gene was digested with NcoI and XhoI restriction endonucleases and ligated with the pET28a vector digested with NcoI and XhoI restriction endonucleases to obtain pET28a-UGT76G1. T284S-M88L-L200A Plasmid.

[0085] pET28a-xxa-UGT76G1 T284S-M88L-L200A Plasmid: The synthesized xxa-UGT76G1 with the solubility-promoting tag XXA T284S-M88L-L200A The gene was digested with NcoI and XhoI restriction endonucleases and ligated with the pET28a vector digested with NcoI and XhoI restriction endonucleases to obtain pET28a-xxa-UGT76G1. T284S-M88L-L200A Plasmid.

[0086] pET28a-MBP-UGT76G1 T284S-M88L-L200A Plasmid: The synthesized MBP-UGT76G1 with the solubility-promoting tag MBP T284S-M88L-L200A The gene was digested with NcoI and XhoI restriction endonucleases and ligated with the pET28a vector digested with NcoI and XhoI restriction endonucleases to obtain pET28a-MBP-UGT76G1. T284S-M88L-L200A Plasmid.

[0087] pET28a-TrxA-UGT76G1 T284S-M88L-L200A Plasmid: The synthesized TrxA-UGT76G1 with the lytic tag TrxA T284S-M88L-L200A The gene was digested with NcoI and XhoI restriction endonucleases and ligated with the pET28a vector digested with NcoI and XhoI restriction endonucleases to obtain pET28a-TrxA-UGT76G1. T284S-M88L-L200A Plasmid.

[0088] pET28a-SUMO-UGT76G1 T284S-M88L-L200A Plasmid: The synthesized SUMO-UGT76G1 with the soluble SUMO tag T284S-M88L-L200A The gene was digested with NcoI and XhoI restriction endonucleases and ligated with the pET28a vector digested with NcoI and XhoI restriction endonucleases to obtain pET28a-SUMO-UGT76G1. T284S-M88L-L200A Plasmid.

[0089] The specific method of plasmid construction is as follows:

[0090] ① According to the instructions of Takara restriction endonuclease kit, 0.5 μL restriction endonucleases NcoI and XhoI, 10 μL target gene (UGT76G1 T284S-M88L-L200A gene or xxa-UGT76G1 T284S-M88L-L200A MBP-UGT76G1 T284S-M88L-L200A TrxA-UGT76G1 T284S-M88L-L200A Gene or SUMO-UGT76G1 T284S-M88L-L200A gene), 2.0 μL of 10× buffer and 7 μL of sterile water were added to the EP tube, and the reaction was incubated at 37°C for 2 h to obtain the target gene insert fragments;

[0091] ② According to the instructions of the Takara restriction endonuclease kit, add 0.5 μL of restriction endonucleases NcoI and XhoI, 1.0 μg of expression vector pET28a, and 2.0 μL of 10× buffer to the EP tube, then add sterile water to 20 μL, incubate at 37°C for 2 hours, and react to obtain the vector fragment of pET28a;

[0092] ③ Use T4 ligase to connect the target gene insert fragments with the pET28a vector fragments, and then add the ligation products to the EP tube containing 50 μL of E. coli DH5α competent cells, incubate the EP on ice for 30 minutes, then heat shock at 42°C for 45 seconds, and then incubate on ice for 2 minutes, add 1mL LB liquid culture medium, and culture at 37°C and 200rpm for 1 hour; then take 100 μL of the culture solution and spread it on the LB solid culture medium containing 50 μg / mL kanamycin resistance, culture at 37°C, pick a single clone every other day, add the culture medium, and culture at 37°C and 200rpm for 12 hours, collect the bacteria, extract and purify the plasmid, and obtain pET28a-UGT76G1 respectively. T284S-M88L-L200A Plasmid, pET28a-xxa-UGT76G1 T284S-M88L-L200A Plasmid, pET28a-MBP-UGT76G1 T284S-M88L-L200A Plasmid, pET28a-TrxA-UGT76G1 T284S-M88L-L200A Plasmid, pET28a-SUMO-UGT76G1 T284S-M88L-L200A Plasmid.

[0093] 2.2UGT91C1 F208M-F379A Construction of plasmid series

[0094] The same method as 2.1 was used to digest UGT91C1 with NcoI and XhoI restriction endonucleases respectively. F208M-F379A Gene, xxa-UGT91C1 F208M-F379A Gene, MBP-UGT91C1 F208M-F379A Gene, TrxA-UGT91C1 F208M-F379A Gene, SUMO-UGT91C1 F208M-F379A The gene was then ligated with the pET28a vector digested with NcoI and XhoI restriction endonucleases to obtain pET28a-UGT91C1 F208M-F379A Plasmid, pET28a-xxa-UGT91C1 F208M-F379A Plasmid, pET28a-MBP-UGT91C1 F208M-F379A Plasmid, pET28a-TrxA-UGT91C1 F208M-F379A Plasmid, pET28a-SUMO-UGT91C1 F208M-F379A Plasmid.

[0095] 2.3pET28a-xxa-UGT76G1 T284S-M88L-L200A -xxa-UGT91C1 F208M-F379A Plasmid construction

[0096] Plasmid pET28a-xxa-UGT76G1 T284S-M88L-L200A As a template, the fragment obtained by PCR amplification using primers 76G1-pET-F and 76G1-pET-R was used as a vector; the plasmid pET28a-xxa-UGT91C1 F208M-F379A As a template, PCR amplification was performed using primers 91C1-F and 91C1-R to obtain xxa-UGT91C1 with T7 promoter and terminator. F208M-F379A The expression cassette was then homologously recombined by conventional Gibson assembly method to obtain the double gene expression vector pET28a-xxa-UGT76G1. T284S-M88L-L200A -xxa-UGT91C1 F208M-F379A Plasmid.

[0097] PCR reaction system:

[0098] composition concentration Volume (μL) Template (plasmid, genomic DNA) 20-60 ng / μL 0.5 Upstream primer 10μM 0.5 Downstream primer 10μM 0.5 Phanta Flash Master Mix (Norwezan) 2× 25 Ultrapure water - 23.5

[0099] PCR amplification conditions:

[0100]

[0101]

[0102] 2.4pET28a-UGT76G1 T284S-M88L-L200A -UGT91C1 F208M-F379A Plasmid construction

[0103] Plasmid pET28a-UGT76G1 T284S-M88L-L200A As a template, the fragment obtained by PCR amplification using primers 76G1-pET-F and 76G1-pET-R was used as a vector; the plasmid pET28a-UGT91C1 F208M-F379A As a template, primers 91C1-F and 91C1-R were used for PCR amplification to obtain UGT91C1 with T7 promoter and terminator. F208M-F379A The expression cassette was then homologously recombined by conventional Gibson assembly method to obtain the double gene expression vector pET28a-UGT76G1. T284S-M88L-L200A -UGT91C1 F208M-F379A Plasmid.

[0104] 2.5 Construction of pET28a-atSUS1 plasmid

[0105] The same method as 2.1 was used to digest the atSUS1 gene with NcoI and XhoI restriction endonucleases, and then ligated with the pET28a vector digested with NcoI and XhoI restriction endonucleases to obtain the pET28a-atSUS1 plasmid.

[0106] 2.6 Construction of pBAD(p15A)-galU plasmid

[0107] The same method as in 2.1 was used to digest the galU gene with XhoI and HindIII restriction endonucleases, and then ligated with the pBAD(p15A) vector digested with NcoI and XhoI restriction endonucleases to obtain the pBAD(p15A)-galU plasmid.

[0108] 2.7 Construction of pBAD(p15A)-ndk plasmid

[0109] The same method as in 2.1 was used to digest the ndk gene with XhoI and HindIII restriction endonucleases, and then ligated with the pBAD(p15A) vector digested with NcoI and XhoI restriction endonucleases to obtain the pBAD(p15A)-ndk plasmid.

[0110] 2.8pET28a-xxa-UGT76G1 T284S-M88L-L200A -xxa-UGT91C1 F208M-F379A Construction of -atSUS1 plasmid

[0111] pET28a-xxa-UGT76G1 T284S-M88L-L200A -xxa-UGT91C1 F208M-F379A Plasmid was used as template, and primers 76-91-F and 76-91-R were used to obtain the vector fragment by the same PCR strategy as in 2.3; pET28a-atSUS1 plasmid was used as template, and primers SUS1-F and SUS1-R were used to PCR amplify the atSUS1 expression cassette with T7 promoter and terminator, and then homologous recombination was performed by conventional Gibson assembly method to obtain the three-gene expression vector pET28a-xxa-UGT76G1 T284S -M88L-L200A -xxa-UGT91C1 F208M-F379A -atSUS1 plasmid, plasmid structure as Figure 1 shown.

[0112] 2.9 Construction of pBAD(p15A)-galU-ndk plasmid

[0113] Using plasmid pBAD(p15A)-galU as template and primers galU-F and galU-R, the vector fragment was obtained by the same PCR strategy as in 2.3. Using E. coli DNA as template and primers ndk-F and ndk-R, PCR amplification was performed to obtain the ndk gene, and then homologous recombination was performed by conventional Gibson assembly method to obtain the dual gene expression vector pBAD(p15A)-galU-ndk. The plasmid structure is as follows: Figure 2 shown.

[0114] 2.10 Construction of pBAD(p15A)-cgPPGK plasmid

[0115] The same method as in 2.1 was used to digest the cgPPGK gene with XhoI and HindIII restriction endonucleases, and then ligated with the pBAD(p15A) vector digested with NcoI and XhoI restriction endonucleases to obtain the pBAD(p15A)-cgPPGK plasmid.

[0116] 2.11 Construction of pBAD(p15A)-galU-ndk-cgPPGK plasmid

[0117] Using pBAD(p15A)-galU-ndk as a template and primers gadk-F and gadk-R, the vector fragment was obtained by the same PCR strategy as in 2.3. Using plasmid pBAD(p15A)-cgPPGK as a template and primers PPGK-F and PPGK-R, PCR amplification was performed to obtain a cgPPGK expression cassette containing the pBAD promoter and terminator, and then homologous recombination was performed by conventional Gibson assembly method to obtain a dual gene expression vector pBAD(p15A)-atSUS1-cgPPGK. The plasmid structure is as follows: Figure 3 shown.

[0118] Example 2 Construction of recombinant bacteria

[0119] (1) Construction of recombinant bacteria B01

[0120] pET28a-UGT76G1 T284S-M88L-L200A -UGT91C1 F208M-F379A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day, added to the culture medium, and cultured at 37°C and 200 rpm for 12 h. The recombinant bacterium was named B01.

[0121] (2) Construction of recombinant bacteria B02

[0122] pET28a-xxa-UGT76G1 T284S-M88L-L200A -xxa-UGT91C1F208M-F379A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked every other day, culture medium was added, and cultured at 37°C and 200 rpm for 12 h. The recombinant bacteria were named B02.

[0123] (3) Construction of recombinant bacteria B03

[0124] pET28a-xxa-UGT76G1 T284S-M88L-L200A -xxa-UGT91C1 F208M-F379A The -atSUS1 plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked every other day, culture medium was added, and cultured at 37°C and 200 rpm for 12 h. The recombinant bacteria was named B03.

[0125] (4) Construction of recombinant bacteria B04

[0126] 4.1 Knockout of the gene encoding L-arabinose isomerase, araA

[0127] ① Using pKIKO plasmid as template, design primers DaraA-F and DaraA-R, introduce 50bp upstream and downstream bases of araA gene at both ends of the primers, perform PCR amplification, and obtain the knockout fragment containing the upstream and downstream homology arms of the target gene and the kanamycin resistance gene (concentration is 50ng / μL).

[0128] ②Inoculate the E. coli BL21 (DE3) strain transformed with the pKD46 plasmid into 5 mL LB liquid medium, culture overnight at 30°C, and then transfer to 20 mL SOB medium to make the initial OD 600nm =0.05, continue culturing until OD 600nm =0.15, and then add 200 μL of L-arabinose (1 M stock solution) to induce pKD46λ-red expression, and continue to culture cells until OD 600nm When the concentration reaches about 0.5, start preparing electrocompetent cells. Centrifuge at 200 rpm for 5 min, discard the supernatant, resuspend with 10 mL of pre-cooled sterile water, centrifuge at 200 rpm for 5 min, discard the supernatant, resuspend with 40 mL of pre-cooled sterile 10% glycerol aqueous solution, repeat twice, discard the supernatant, add 200 uL of pre-cooled sterile 10% glycerol aqueous solution, and resuspend the cells.

[0129] ③ Add 1-2uL of the araA gene knockout fragment to be transformed obtained in step ① and place on ice for 3 minutes; then transfer to a pre-cooled 0.2cm electroporation cup and pre-cool in an ice bath for 10 minutes; turn on the electroporator and set the parameters to 2.5kV, 200 / 25μF, and the electric shock time is about 5ms; take out the electroporation cup from the ice, absorb the surface moisture with a paper towel, and place it in the sample slot; immediately add 1mL SOB culture medium after electric shock, and culture at 30℃, 200rpm for 1.5h, then spread the transformed competent cells on LB solid culture medium containing kanamycin and culture overnight at 37℃.

[0130] ④ Pick a single colony and perform colony PCR verification on the transformant using primers V-araA-F and V-araA-R to determine whether the gene is knocked out. Subsequently, plasmid pCP20 is transferred to eliminate the kan fragment in the transformant. The culture conditions after electroporation are 30℃ for 2h, then raised to 42℃ for 12-16h to remove pCP20, and the recombinant E. coli BL21(DE3)ΔaraA is obtained.

[0131] 4.2 Knockout of ushA, the gene encoding 5'-nucleotidase / UDPG hydrolase

[0132] ① Using pKIKO plasmid as template, primers DushA-F and DushB-R were designed. 50 bp of upstream and downstream bases of ushA gene were introduced at both ends of the primers respectively. PCR amplification was performed to obtain a knockout fragment containing the upstream and downstream homologous arms of the target gene and the kanamycin resistance gene (concentration was 50 ng / μL).

[0133] ② Based on the recombinant Escherichia coli BL21(DE3)ΔaraA, the same strategy as that for knocking out the araA gene in 4.1 was adopted, and the transformants were verified by colony PCR using primers V-ushA-F and V-ushA-R to obtain the recombinant Escherichia coli BL21(DE3)ΔaraAΔushA.

[0134] 4.3 Transformation of recombinant E. coli BL21(DE3)ΔaraAΔushA

[0135] pET28a-xxa-UGT76G1 T284S-M88L-L200A -xxa-UGT91C1 F208M-F379A -atSUS1 plasmid and pBAD(p15A)-galU-ndk plasmid were transformed into Escherichia coli BL21(DE3)ΔaraAΔushA competent cells and cultured at 37°C overnight. A single clone was picked every other day and inoculated into LB liquid culture medium. The recombinant bacteria were cultured at 37°C and 200 rpm for 12 h and named as recombinant bacteria B04.

[0136] (5) Construction of recombinant bacteria B05

[0137] pET28a-xxa-UGT76G1 T284S-M88L-L200A -xxa-UGT91C1 F208M-F379A -atSUS1 plasmid and pBAD(p15A)-galU-ndk-cgPPGK plasmid were transformed into Escherichia coli BL21(DE3)ΔaraAΔushA competent cells and cultured at 37°C overnight. A single clone was picked every other day and inoculated into LB liquid culture medium. It was cultured at 37°C and 200 rpm for 12 h and named as recombinant bacteria B05.

[0138] (6) Construction of recombinant bacteria B06

[0139] pET28a-UGT76G1 T284S-M88L-L200A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The recombinant bacteria were cultured at 37°C and 200 rpm for 12 h and named as recombinant bacteria B06.

[0140] (7) Construction of recombinant bacteria B07

[0141] pET28a-xxa-UGT76G1 T284S-M88L-L200A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The recombinant bacteria were cultured at 37°C and 200 rpm for 12 h and named as recombinant bacteria B07.

[0142] (8) Construction of recombinant bacteria B08

[0143] pET28a-MBP-UGT76G1 T284S-M88L-L200A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The culture was carried out at 37°C and 200 rpm for 12 h and named as recombinant bacteria B08.

[0144] (9) Construction of recombinant bacteria B09

[0145] pET28a-SUMO-UGT76G1 T284S-M88L-L200A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The culture was carried out at 37°C and 200 rpm for 12 h and named the recombinant bacterium B09.

[0146] (10) Construction of recombinant bacteria B10

[0147] pET28a-TrxA-UGT76G1 T284S-M88L-L200AThe plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The culture was carried out at 37°C and 200 rpm for 12 h and named as recombinant bacteria B10.

[0148] (11) Construction of recombinant bacteria B11

[0149] pET28a-UGT91C1 F208M-F379A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The culture was carried out at 37°C and 200 rpm for 12 h and named as recombinant bacteria B11.

[0150] (12) Construction of recombinant bacteria B12

[0151] pET28a-xxa-UGT91C1 F208M-F379A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The culture was carried out at 37°C and 200 rpm for 12 h and named as recombinant bacteria B12.

[0152] (13) Construction of recombinant bacteria B13

[0153] pET28a-MBP-UGT91C1 F208M-F379A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The culture was carried out at 37°C and 200 rpm for 12 h and named as recombinant bacteria B13.

[0154] (14) Construction of recombinant bacteria B14

[0155] pET28a-SUMO-UGT91C1 F208M-F379A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The culture was carried out at 37°C and 200 rpm for 12 h and named as recombinant bacteria B14.

[0156] (15) Construction of bacterial group B15

[0157] pET28a-TrxA-UGT91C1 F208M-F379A The plasmid was transformed into competent E. coli BL21 (DE3) cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid medium. The culture was carried out at 37°C and 200 rpm for 12 h and named as recombinant bacteria B15.

[0158] (16) Construction of control recombinant bacteria B16

[0159] The pET28a plasmid was transformed into Escherichia coli BL21 (DE3) competent cells and cultured at 37°C overnight. A single clone was picked the next day and inoculated into LB liquid culture medium. The recombinant bacteria were cultured at 37°C and 200 rpm for 12 h and named as recombinant bacteria B16.

[0160] Example 3 Screening of lytic tags

[0161] Recombinant strains B06, B07, B08, B09, B10, B11, B12, B13, B14, B15 and control recombinant bacteria B16 were inoculated into LB liquid culture medium containing 50 mg / L kanamycin, and cultured at 37°C and 200 rpm for 12 hours. Subsequently, 1% of the volume of the culture medium was inoculated into LB liquid culture medium containing the corresponding antibiotics, cultured at 37°C and 200 rpm until the logarithmic growth phase, IPTG was added at a final concentration of 0.1 mM, and after induction at 18°C ​​for 14 hours, the bacteria were collected by centrifugation at 10,000 rpm and the supernatant was discarded. Take 50 mL of bacteria, add 1 / 4 of the volume of culture solution Talon buffer (20 mM Tris-HCl, 300 mM NaCl, pH 8.0) to resuspend the bacteria, disrupt the bacteria by ultrasound, and then centrifuge at 12,000 rpm for 30 minutes, collect the supernatant for protein electrophoresis detection, and the test results are as follows: Figure 4 shown.

[0162] Figure 4 In the middle panel b, M indicates marker; 1 indicates the protein electrophoresis band of the expression control recombinant bacteria B16; 2 indicates the protein electrophoresis band of the recombinant bacteria B11, and the arrow indicates UGT91C1 F208M-F379A Protein bands; 3 represents the protein electrophoresis band of recombinant bacteria B12, where the arrow indicates XXA-UGT91C1 F208M-F379A Protein bands; 4 represents the protein electrophoresis band of recombinant bacteria B13, where the arrow indicates MBP-UGT91C1 F208M-F379A Protein bands; 5 represents the protein electrophoresis band of recombinant bacteria B14, where the arrow indicates SUMO-UGT91C1 F208M-F379A Protein bands; 6 represents the protein electrophoresis band of recombinant bacteria B15, where the arrow indicates trxA-UGT91C1 F208M-F379A Protein bands.

[0163] Figure 4 In Figure c, M indicates Marker; 7 indicates the protein electrophoresis band of the control recombinant strain B16; 8 indicates the protein electrophoresis band of the recombinant strain B06, where the arrow indicates UGT76G1 T284S-M88L-L200A Protein bands;

[0164] 9 represents the protein electrophoresis band of the recombinant strain B07, where the arrow indicates XXA-UGT76G1 T284S-M88L-L200A 10 represents the protein electrophoresis band of the recombinant bacteria B08, where the arrow indicates MBP-UGT76G1 T284S-M88L-L200A 11 represents the protein electrophoresis band of the recombinant bacteria B09, where the arrow indicates SUMO-UGT76G1 T284S-M88L-L200A 12 represents the protein electrophoresis band of the recombinant bacteria B10, where the arrow indicates trxA-UGT76G1 T284S-M88L-L200A protein bands.

[0165] from Figure 4 As can be seen, the key enzyme glycosyltransferase UGT76G1 without the solubility-promoting tag T284S-M88L-L200A and UGT91C1 F208M-F379A The expression level of the two key enzymes was very low, and most of them existed in the form of inclusion bodies. The addition of the solubility-promoting tag greatly increased the soluble expression of the two key enzymes. Among them, the solubility-promoting tag xxa had the best solubility-promoting effect, so xxa-UGT76G1 expressing the tag was selected. T284S-M88L-L200A and xxa-UGT91C1 F208M-F379A Whole-cell catalytic synthesis of Reb M was performed.

[0166] Example 4 Recombinant bacteria screening

[0167] (1) Effect of the lytic tag on whole-cell catalytic production of rebaudioside M

[0168] Recombinant bacteria B01 and B02 were inoculated into LB liquid medium containing 50 mg / L kanamycin, respectively, and cultured at 37°C and 200 rpm for 12 h. Subsequently, 1% of the volume of the culture medium was inoculated into LB liquid medium containing the corresponding antibiotics, cultured at 37°C and 200 rpm until the logarithmic growth phase, IPTG was added at a final concentration of 0.1 mM, induced at 18°C ​​for 14 h, and centrifuged at 10,000 rpm to collect the bacteria, and the supernatant was discarded to obtain the bacterial cells.

[0169] Inoculate the cells into 5 mL of whole-cell catalytic reaction solution and resuspend the cells to a concentration of OD 600nm =30.0, and catalyzed the reaction at 42°C for 24h to obtain rebaudioside M.

[0170] The formula of the whole cell catalytic reaction solution is: each liter of culture medium contains 23.5g / L trisodium citrate, 500g / L sucrose, 33.4g / L Na 2 HPO 4 12H 2 O, 1.1 g / L NaH 2 PO 4, 1.0 g / L EDTA, 2.0 g / L AEO-9, 30.0 g / L Reb A (purity 97%).

[0171] The conditions for detecting the product Reb M by high performance liquid chromatography are as follows: chromatographic column: Diamonsil Plus 5μmC18-A250×4.6mm; column temperature: 40°C; mobile phase: acetonitrile:10mmol sodium phosphate buffer = 32:68 (pH = 2.6); flow rate: 1.0mL / min; injection volume: 20μL; detection wavelength: 210nm.

[0172] (2) Shake flask fermentation and screening of optimal recombinant bacteria

[0173] Pick out the E. coli recombinant bacteria B03 monoclone and inoculate it into LB liquid medium containing 50 mg / L kanamycin, pick out the E. coli recombinant bacteria B04 monoclone and inoculate it into LB liquid medium containing 50 mg / L kanamycin and 100 mg / L ampicillin, pick out the E. coli recombinant bacteria B05 monoclone and inoculate it into LB liquid medium containing 50 mg / L kanamycin and 100 mg / L ampicillin, and culture them at 37°C at 200 rpm for 12 hours. Subsequently, inoculate 1% of the volume of the culture medium into LB liquid medium containing the same antibiotics as the previous culture, culture at 37°C and 200 rpm until the logarithmic growth phase, add IPTG with a final concentration of 0.1 mmol, induce at 18°C ​​for 14 hours, centrifuge at 10000 rpm to collect the bacteria, discard the supernatant, absorb the liquid on the wall of the centrifuge tube with filter paper, inoculate the bacteria into 5 mL of the whole cell catalytic reaction solution and resuspend the bacteria, so that the bacteria OD 600nm =30.0, and catalyzed the reaction at 42°C for 24h to obtain rebaudioside M.

[0174] The conditions for detecting the product Reb M by high performance liquid chromatography are as follows: chromatographic column: Diamonsil Plus 5μmC18-A250×4.6mm; column temperature: 40°C; mobile phase: acetonitrile:10mmol sodium phosphate buffer = 32:68 (pH = 2.6); flow rate: 1.0mL / min; injection volume: 20μL; detection wavelength: 210nm.

[0175] The results of HPLC detection of product Reb M are as follows Figure 6 As shown. Figure 6The results show that the Reb M production of recombinant bacteria B01 is 2.8g / L, and the Reb M production of recombinant bacteria B02 is 2.5 times that of recombinant bacteria B01, reaching 7.0g / L. This result further confirms that the addition of the solubility-promoting tag xxa can increase the production of Reb M. The Reb M production of recombinant bacteria B03 is 8.2g / L. After overexpressing galU and ndk and knocking out araA and ushA, the Reb M production of recombinant bacteria B04 reached 9.5g / L, an increase of 16% compared with recombinant bacteria B03. On this basis, the expression of cgPPGK further increased the Reb M production of recombinant bacteria B05 to 11.5g / L, which is 1.4 times that of B03, an increase of 40%.

[0176] Example 5 Continuous fed-batch fermentation and whole-cell catalytic synthesis of Reb M by recombinant bacteria B05

[0177] (1) Continuous fed-batch fermentation of recombinant strain B05

[0178] ① Inoculate the recombinant E. coli B05 into 10 mL LB liquid medium containing 50 mg / L kanamycin and 100 mg / L ampicillin, and culture overnight at 37°C and 200 rpm (measure OD at the end of culture). 600nm ≈6) to obtain the first pre-culture solution.

[0179] ② The first pre-culture solution was inoculated into 50 mL of batch culture medium (composition see Table 1) containing kanamycin (50 μg / mL) and ampicillin (100 μg / mL) to make the initial OD 600nm When the OD value reaches 0.25, the cells were cultured at 37°C and 200 rpm for 10 h (OD value was measured at the end of the culture). 600nm ≈8-10) to obtain the second pre-culture solution.

[0180] ③ Batch fermentation stage: In a 3L fermenter, the secondary pre-culture solution was inoculated into 1L of batch medium (components see Table 1) to make the initial OD 600nm When the pH reaches 0.2, batch culture is started at 37°C. Glycerol depletion is detected by a sudden rise in dissolved oxygen and pH, which means the batch fermentation is terminated.

[0181] ④ Fed-batch stage: According to the preset final volume of the culture medium after feeding (1.8 L), kanamycin was added to the bioreactor at a final concentration of 50 mg / L, and a trace metal solution (1000×) (composition see Table 2) was added and incubated at 37 °C.

[0182] Cultivation, the stirring speed is set to automatically adjust according to the dissolved oxygen (maintaining 20% ​​of the saturated dissolved oxygen concentration); during the reaction, the feed solution 1 (components are shown in Table 3) in the batch culture feed medium is added to the bioreactor according to the feeding formula of Formula I (when the glycerol consumption is detected to be completed through the sudden increase of dissolved oxygen and pH value, the feeding rate of the feed solution 1 is determined according to the feeding formula of Formula I for feeding). When the specific growth rate (μset, μ) is 0.2h-1, and the OD of the cells is 600nm When it reaches 60, it enters the subsequent induction stage.

[0183] F 1 =(μ×X 0 ×V 0 exp(μt)×1000) / (Y×S 0 )........................Formula I

[0184] In Formula I, F 1 is the feeding rate of feeding solution 1 (mL / h); μ is the specific growth rate (0.2h-1 in this example); X 0 is the cell concentration at the start of the fed-batch phase (5.5 g-DCW / L in this example); V 0 is the initial (batch fermentation stage) volume (1 L in this example); t is the culture time after the start of fed-batch culture (h); Y is the yield coefficient (0.4 g-DCW / g glycerol in this example); S 0 is the concentration of the substrate in the feed solution (500 g-glycerol / L in this example).

[0185] ⑤ Induction phase: At the beginning of the induction phase, IPTG with a final concentration of 0.2 mM was added to the bioreactor, and feed solution 1 and feed solution 2 were added at 20°C for induction culture. Feed solution 2 was supplemented with the inducer lactose at a rate of 2.0 g / L / h, with the goal of always controlling the lactose concentration at around 2 g / L and the arabinose concentration at around 1.5 g / L; for feed solution 1 in the induction phase, feed was added in a decreasing gradient as follows.

[0186] The feeding rate of feeding solution 1 is controlled in a gradient decreasing manner as follows:

[0187] Induction phase 0-5 hours: F 1 =85%×F 1 max

[0188] Induction phase 6-11 hours: F 1 =70%×F 1 max

[0189] Induction phase 12-14 hours: F 1 =60%×F 1 max

[0190] Induction phase 15-16 hours: F 1 =40%×F 1 max ;(F 1 max is the maximum feed rate of feeding solution 1 during the exponential feeding phase)

[0191] During the whole process of continuous fed-batch fermentation, pH was maintained at 6.5 by 25% (v / v) ammonia. The dissolved oxygen (DO) level was regulated by a stirring rate cascade (200-1400 rpm) and aeration rate to maintain at 30% of air saturation. The end of glycerol consumption in the batch culture phase was detected by a sudden rise in dissolved oxygen and pH, followed by the exponential feeding phase. During the fermentation, samples were taken regularly to detect the bacterial OD 600nm , the concentrations of glycerol, lactose, and arabinose in the supernatant. Figure 7 This is the result of continuous fed-batch fermentation. The bacterial concentration reached the highest at 33h. 600nm Continue to culture at OD 33 600nm The fermentation was stopped at 33h and the cells were collected by centrifugation.

[0192] (2) Whole-cell catalytic synthesis of Reb M

[0193] Optimization of whole-cell catalytic conditions: The concentration of recombinant bacteria B05 was OD 600nm The concentration of Reb A was 30.0-100.0, and the concentration of substrate Reb A was 30.0-80.0 g / L. The bacterial suspension was added to a 3L bioreactor and reacted continuously at 40°C for 72 h at a speed of 120 rpm. The concentration of Reb M was measured and recorded at regular intervals. The optimal conditions for whole-cell catalysis were obtained based on the concentration of Reb M. The optimal conditions for whole-cell catalysis were as follows: 600nm =60.0, and the concentration of substrate Reb A is 80.0 g / L. The concentration of product Reb M under the optimal conditions of whole cell catalysis changes with time as shown in the following figure: Figure 8 As shown. Figure 8 The results show that the RebM yield increases with the progress of the reaction, reaching a maximum of 77.8 g / L at 60 h, the synthesis rate is 1.3 g / L / h, and the substrate conversion rate reaches 97.3%, all of which are the highest reported so far.

[0194] The above is only a preferred embodiment of the present invention, and the present invention is not limited to the above embodiments. It is understood that other improvements and changes directly derived or associated by those skilled in the art without departing from the spirit and concept of the present invention should be considered to be included in the protection scope of the present invention.

Claims

1. A recombinant Escherichia coli strain for whole-cell catalytic synthesis of rebaudioside M, characterized in that: The recombinant Escherichia coli contains a glycosyltransferase UGT76G1 encoding gene mutant, a glycosyltransferase UGT91C1 encoding gene mutant, a sucrose synthase atSuS1 gene, and a polyphosphate glucose kinase cgPPGK gene; overexpresses a glucose-1-phosphate uridyltransferase galU gene, a nucleoside diphosphate kinase ndk gene, and; and simultaneously knocks out an L-arabinose isomerase encoding gene araA gene and a 5'-nucleotidase / UDG hydrolase encoding gene ushA gene.

2. The recombinant Escherichia coli according to claim 1, characterized in that The glycosyltransferase UGT76G1 encoding gene mutant is obtained by introducing T284S, M88L and L200A mutation sites on the basis of the sequence of gene number GenBank: 6KVI_A, and the nucleotide sequence of the glycosyltransferase UGT76G1 encoding gene mutant is shown in SEQ ID NO.1; the UGT91C1 encoding gene mutant is obtained by introducing F208M and F379A mutation sites on the basis of the sequence of gene number GenBank: 7ERX_A, and the nucleotide sequence of the UGT91C1 encoding gene mutant is shown in SEQ ID NO.2; the nucleotide sequence of the atSuS1 gene is shown in SEQ ID NO.

3.

3. The recombinant Escherichia coli according to claim 1, characterized in that The nucleotide sequence of the cgPPGK gene is shown in SEQ ID NO.4; the nucleotide sequence of the galU gene is shown in SEQ ID NO.5; and the nucleotide sequence of the ndk gene is shown in SEQ ID NO.

6.

4. The recombinant Escherichia coli according to claim 1, characterized in that The glycosyltransferase UGT76G1 encoding gene mutant is fused with a xxa solubility-promoting tag; the glycosyltransferase UGT91C1 encoding gene mutant is fused with a xxa solubility-promoting tag.

5. The recombinant Escherichia coli according to claim 1, characterized in that The galU gene and the ndk gene are overexpressed by constructing a plasmid expression vector and transferring it into Escherichia coli.

6. The recombinant Escherichia coli according to claim 1, characterized in that The deposit number of the recombinant Escherichia coli is CCTCC M 2025427.

7. A method for constructing a recombinant Escherichia coli according to any one of claims 1 to 6, characterized in that: The construction method comprises the following steps: The araA gene and ushA gene in Escherichia coli BL21 (DE3) were knocked out by homologous recombination technology; then UGT91C1 containing a fusion xxa solubility tag was constructed. F208M-F379A expression cassette, UGT76G1 fused with xxa lytic tag T284S -M88L-L200A A three-gene expression plasmid vector containing an expression cassette of and an expression cassette of atSUS1; an overexpression plasmid vector containing galU gene, ndk gene and cgPPGK gene is constructed; and the constructed three-gene expression plasmid vector and the overexpression plasmid vector are transformed into competent cells of Escherichia coli BL21 (DE3) in which the araA gene and the ushA gene are knocked out to obtain the recombinant Escherichia coli bacteria.

8. The construction method according to claim 7, characterized in that: The specific process of knocking out the araA gene in Escherichia coli BL21 (DE3) is as follows: (1) Using the pKIKO plasmid as a template, primers DaraA-F and DaraA-R were designed and PCR amplified to obtain a fragment containing the araA gene knockout; The nucleotide sequence of DaraA-F is shown in SEQ ID NO.7; the nucleotide sequence of DaraA-R is shown in SEQ ID NO.8; (2) The pKD46 plasmid was transformed into competent cells of Escherichia coli BL21 (DE3), and then transformed into competent cells again by adding L-arabinose for induction. Then, the araA gene knockout fragment to be transformed obtained in step (1) was added, and colony PCR verification was performed to obtain Escherichia coli BL21 (DE3) in which the araA gene was knocked out.

9. The construction method according to claim 7, characterized in that: The specific process of knocking out the ushA gene in Escherichia coli BL21 (DE3) is as follows: (1) Using the pKIKO plasmid as a template, primers DushA-F and DushA-R were designed and PCR amplified to obtain a fragment containing the ushA gene knockout; The nucleotide sequence of DushA-F is shown in SEQ ID NO.9; the nucleotide sequence of DushA-R is shown in SEQ ID NO.10; (2) The pKD46 plasmid was transformed into competent cells of Escherichia coli BL21 (DE3) in which the araA gene was knocked out, and then induced by adding L-arabinose and transformed into competent cells again, and then the ushA gene knockout fragment to be transformed obtained in step (1) was added, and colony PCR verification was performed to obtain Escherichia coli BL21 (DE3) in which the araA gene and the ushA gene were knocked out.

10. Use of the recombinant Escherichia coli according to any one of claims 1 to 6, characterized in that: The application is specifically as follows: using rebaudioside A as a substrate and recombinant Escherichia coli as a catalyst, rebaudioside M is obtained by fed-batch fermentation.

Images