Method for synthesizing protein-RNA (Ribonucleic Acid) compound in vivo for nucleic acid detection

Abstract

The invention discloses a method for synthesizing a protein-RNA compound in vivo for nucleic acid detection, and relates to the technical field of biology. The technical key points are as follows: a series of recombinant plasmids capable of realizing the simultaneous expression of CRISPR / Cas effect proteins [including all sgRNA-guided Cas proteins such as Cas9, Cas12 (a, b, g, f and the like), Cas13, Cas14 and the like] and crRNA / tracrRNA (sgRNA) thereof in a series of expression strains of escherichia coli and assembling in the escherichia coli body are constructed, wherein the recombinant plasmids can be used for realizing the simultaneous expression of the CRISPR / Cas effect proteins [including all sgRNA-guided Cas proteins such as Cas9, Cas12 (a, b, g, f and the like); according to the present invention, the His tag is added to the 3'end of the compound gene, such that the compounds can be purified by using the nickel column so as to be used for subsequent nucleic acid detection, and the CRISPR / Cas protein nucleic acid compound assembled in vivo has characteristics of high enzyme activity, high sensitivity and high specificity so as to create good conditions for the CRISPR system to establish the nucleic acid detection platform;

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a method for in vivo synthesis of protein-RNA complexes for nucleic acid detection. Background Art

[0002] In recent years, nucleic acid detection technologies based on CRISPR / Cas nucleases guided by sgRNA have shown great application prospects in the field of molecular diagnosis. Such as Cas9, Cas12a, Cas12b, and Cas13a, etc. Their specific cleavage activities guided by sgRNA enable the CRISPR / Cas system to be developed into nucleic acid diagnostic tools for highly specific detection. By combining with RPA pre-amplification, Cas13a and Cas12a nucleases have been used to develop the SHERLOCK (Specific High Sensitivity Enzymatic Reporter UnLOCKing) system and the DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter) system for highly sensitive and specific nucleic acid detection, respectively.

[0003] However, in the actual application process, the CRISPR / Cas system still faces huge challenges: (1) Acquisition of RNA. In existing research, sgRNA is often obtained by in vitro synthesis. The RNA obtained in this way takes a long time, has a high cost, is unstable, and is easily degraded. (2) Transportation and storage of the system. Even when combined with Cas protein, sgRNA needs to be stored at a low temperature of -20°C or even -80°C. Preparing the protein in the form of freeze-dried powder can extend its storage time, but this method undoubtedly increases the complexity of the operation and the costs of storage and transportation; (3) Cleavage efficiency. The in vitro assembled CRISPR / cas system relies on the assembly of Cas protein and sgRNA and the recognition of RNP and the target to activate the trans-cleavage activity. This process often takes about 30 minutes, which prolongs the detection time in the actual application process; (4) Economic cost. The price of synthesizing each RNA nucleic acid molecule is between $10 and $100, and the cost required for every 100 determinations is between $100 and $500. This makes the cost required for each detection too high to be applied and popularized.

[0004] Therefore, the present invention aims to provide a method for in vivo synthesis of protein-RNA complexes for nucleic acid detection to solve the above problems. Summary of the Invention

[0005] The purpose of the present invention is to solve the above problems and provide a method for in vivo synthesis of protein-RNA complexes for nucleic acid detection, so as to provide a new method for obtaining Cas protein-sgRNA complexes when the sgRNA-guided CRISPR system is used for nucleic acid detection, comprehensively improving its detection performance and reducing the detection cost.

[0006] To achieve the above object, the technical solution of the present invention is as follows:

[0007] The present invention provides a method for in vivo synthesis of a protein-RNA complex for nucleic acid detection, the method comprising the following steps:

[0008] S1. Construct a CRISPR / Cas protein-sgRNA framework plasmid;

[0009] S2. Insert a crRNA transcription template sequence (including a T7 promoter, a crRNA Repeat, and a Spacer transcription template) between the translation terminator and the transcription terminator of the CRISPR / Cas protein-sgRNA framework plasmid to construct an expression vector of a CRISPR / Cas protein-sgRNA complex targeting a specific target;

[0010] S3. Transform the CRISPR / Cas protein-sgRNA complex of the specific target into an Escherichia coli expression strain and culture it; perform protein induction expression and purification to obtain a CRISPR / Cas protein-sgRNA protein nucleic acid complex;

[0011] S4. Use the CRISPR / Cas protein-sgRNA protein nucleic acid complex for nucleic acid detection; the detection includes optimization of reaction solution components and reaction conditions;

[0012] Optimization of reaction solution components: Optimize the components of the reaction Buffer used in the detection method;

[0013] Optimization of reaction conditions: Optimize the reaction conditions for in vivo synthesis and assembly of CRISPR / Cas detection, and the optimized reaction conditions are to react at 37 °C for 20 min.

[0014] In step S1, the CRISPR / Cas protein is guided by sgRNA;

[0015] The sgRNA in step S1 includes all sgRNAs such as crRNA and tracrRNA that guide Cas effector proteins;

[0016] The plasmid vector in step S1 is all engineering plasmid vectors such as pET, pBAD, and pEGX for expressing recombinant proteins.

[0017] The Escherichia coli strain in step S3 is an E. coli series strain for expressing proteins;

[0018] In step S3, IPTG is used for induction, and the final concentration of IPTG is 0.5 mM;

[0019] The induction conditions are 16°C, 150 r / min, for 16 - 20 hours;

[0020] The buffer components used in the purification step in step S3 are 20 mM Tris, 300 mM NaCl, and 10 mM MgCl2.

[0021] A method for in - vivo synthesis of protein - RNA complexes for nucleic acid detection can obtain a method for detecting the nucleic acid of Lumpy Skin Disease Virus (LSDV) by in - vivo assembled Cas12a - crRNA and the Recombinase Polymerase Amplification (RPA) technique. The method includes the following steps:

[0022] S1. Construct the pET_28a - LbCas12a - crRNA framework plasmid: Design an LbCas12a - crRNA sequence with a length of 3760 bp. The LbCas12a - crRNA sequence is as shown in SEQ ID NO: 1. Clone the nucleotide sequence onto the pET_28a plasmid to obtain the pET_28a - LbCas12a - crRNA plasmid;

[0023] S2. Construct the complex expression vector of LbCas12a - crRNA targeting a specific target: Insert the sequence SEQ ID NO: 2 (including a T7 promoter, crRNA Repeat, and Spacer transcription template) between the NdeⅠ and BlpⅠ restriction enzyme sites of the above pET_28a - crRNA framework plasmid;

[0024] S3. Transformation and expression: Transform the cloned product into Escherichia coli and culture it; perform protein induction expression and purification to obtain the LbCas12a - crRNA protein - nucleic acid complex;

[0025] S4. Primer design: Download the nucleic acid sequence of Lumpy Skin Disease Virus from GeneBank, select the conserved region of Lumpy Skin Disease Virus, and design and synthesize RPA primers and crRNA templates;

[0026] S5. Design a reporter ssDNA, and the sequence of the ssDNA is SEQ ID NO: 5;

[0027] S6, Reaction System: Add 25 μL of Reaction Buffer, 2 μL of 10 μM Forward / Reverse Primer, 2.5 μL of template, and 2.5 μL of MgOAC to the freeze-dried RPA particles; CRISPR Reaction System: 5 μL of reaction Buffer, 2 μL of 250 nM LbCas12a-crRNA protein-nucleic acid complex, 2 μL of 10 μM ssDNA reporter probe, and 7 μL of DEPC water; After adding the components except LbCas12a-crRNA to the reaction tube, vortex and mix well. Add LbCas12a-crRNA to the tube cap, amplify at 37 °C for 20 min, and centrifuge briefly to spin down the LbCas12a-crRNA protein-nucleic acid complex on the tube cap. Place it in a qPCR instrument and react at 37 °C for 20 min. Record the fluorescence value every 30 seconds and interpret the result through the fluorescence curve;

[0028] S7, Result Judgment: React in a qPCR instrument. The fluorescence curve of the reaction tube containing the genomic DNA of lumpy skin disease virus rises, and the negative control is a smooth straight line. Under the irradiation of a blue light lamp, the positive sample emits green fluorescence, while the negative control does not emit light.

[0029] Compared with the prior art, the beneficial effects of this solution are:

[0030] 1. The present invention uses genetic recombination technology to modify pET series engineering plasmids, realizing the in vivo assembly of CRISPR effector proteins and sgRNA, and the complex can be directly purified through His Tag;

[0031] 2. The in vivo assembly method described in the present invention does not require in vitro synthesis of RNA, reducing the cost of the detection reaction;

[0032] 3. The CRISPR / Cas protein-sgRNA protein-nucleic acid complex obtained by the in vivo synthesis and assembly method of the present invention has higher stability. This complex can be stored for more than 140 days at 4 °C and for more than half a year at -80 °C, saving storage costs and transportation costs;

[0033] 4. Compared with the complex assembled by in vitro synthesis, the CRISPR / Cas protein-sgRNA complex described in the present invention has higher nicking activity, sensitivity, and specificity, and has the potential to develop a new detection platform. Description of the Drawings

[0034] Figure 1 It is the plasmid map of the complex expression vector in the embodiment of the present invention;

[0035] Figure 2It is a schematic diagram of analyzing protein expression by SDS-PAGE in the embodiments of the present invention;

[0036] Figure 3 It is a schematic diagram of analyzing the transcription of crRNA in the embodiments of the present invention;

[0037] Figure 4 It is a schematic diagram of the verification result of the nicking activity of the in vivo assembled complex in the embodiments of the present invention;

[0038] Figure 5 It is a schematic diagram of comparing the sensitivity of detecting double-stranded DNA by the complexes assembled in vivo and in vitro in the embodiments of the present invention;

[0039] Figure 6 It is a schematic diagram of determining the enzyme kinetic constant in the embodiments of the present invention;

[0040] Figure 7 It is a schematic diagram of stability analysis in the embodiments of the present invention;

[0041] Figure 8 It is a schematic diagram of analyzing the sensitivity of in vivo / in vitro assembled Cas12a-crRNA-RPA to LSDV132 in the embodiments of the present invention;

[0042] Figure 9 It is a schematic diagram of analyzing the specificity of in vivo / in vitro assembled Cas12a-crRNA-RPA to LSDV132 in the embodiments of the present invention. Detailed implementation manners

[0043] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments and drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0044] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0045] Example 1:

[0046] 1. Construction of the expression vector of the LbCas12a-crRNA complex targeting the bovine nodule LSDV132 sequence

[0047] Download the LSDV132 gene sequence from Gene Bank, screen the target to design the crRNA transcription template, and insert this template between the NdeⅠ and BlpⅠ restriction enzyme sites of the pET_28a-LbCas12a-crRNA framework plasmid.

[0048] 2. Transformation and expression

[0049] Take the above recombinant plasmid to transform E. coli BL21(DE3) competent cells, coat them on a solid LB medium agar plate containing kanamycin (50 mg / L), and culture overnight at 37°C; pick a single colony into 5 mL of liquid LB medium containing kanamycin (50 mg / L), and culture at 180 r / min for 6 h; take the bacterial solution and verify the accuracy of the sequence through sequencing.

[0050] Pick a monoclonal colony with correct sequencing and inoculate it into liquid LB medium containing kanamycin. When the OD600 of the bacterial solution reaches between 0.6 - 0.8 at 37°C and 180 r / min, add IPTG with a final concentration of 0.5 mM for protein induction expression. The induction conditions are 16°C, 150 r / min, and 20 h; after induction, collect the bacteria, break them on a high-pressure homogenizer until the bacterial solution becomes clear, then purify the target complex with a nickel column. The purified complex is ultrafiltered and concentrated, and the buffer is exchanged into a protein cryopreservation solution for storage. Use SDS-PAGE and Coomassie brilliant blue staining to verify the protein expression. Digest the protein with proteinase K and then add single-stranded DNA complementary to crRNA for PAGE electrophoresis to verify the RNA transcription.

[0051] 3. Verification of the activity of Cas12a-crRNA protein assembled in vivo

[0052] 4. For the verification of the cleavage activity, use a 20 μL reaction system containing 50, 100, 150, 200 nmol L -1 RNPs assembled in vivo, 200 nmol L -1 LSDV132 gene, 2 μL reaction Buffer, and DEPC treated water. React at 37°C for 1 h, add 1 μL of proteinase K, and after reacting at 37°C for 20 min, analyze the cleavage results by 10% SDS-PAGE electrophoresis. For the verification of the collateral cleavage activity, use a 50 μL reaction system containing 50, 100, 150, 200 nmol L -1 RNPs assembled in vivo / in vitro, 200 nmol L -1 LSDV132 gene, 50 μL reaction Buffer, 400 nmol L -1Probes and DEPC-treated water. After reacting at 37 °C for 30 min, observe the fluorescence signal using a qPCR instrument or under an ultraviolet lamp.

[0053] 5. Determination of the sensitivity of the in vivo assembled Cas12a-crRNA complex to double-stranded DNA: Dilute the LSDV 132 double-stranded DNA target to different concentrations. Take 2.5 μL of each diluted sample for CRISPR / Cas12a detection, set the gain to 7, set 3 replicates for each dilution gradient, and create a working curve to determine the sensitivity.

[0054] 6. Determination of the enzyme kinetic constants of the in vivo assembled Cas12a-crRNA complex

[0055] For the determination of enzyme kinetics, dilute the reporter probe to 0.1 μmol L -1 、0.2 μmol L -1 、0.4 μmol L -1 、0.8 μmol L -1 、1.0 μmol L -1 、1.6 μmol L -1 、3.2 μmol L -1 respectively. The enzyme activity detection system contains 100 nmol L -1 in vivo / in vitro assembled Cas12a protein, 5 μL of reaction buffer, 47.2 nmol L -1 activator (effective complex, Et = 47.2 nmol L -1 ), and Depc-treated water. React the reaction system in a qPCR instrument for 30 min, and record the fluorescence signal every 30 s. Calculate the initial velocity (Vo) by fitting a linear regression, and plot the substrate concentration according to the following formula to determine the Michaelis-Menten constant (GraphPad Software): Y = (Vmax × X) / (Km + X), where X is the substrate concentration and Y is the enzyme velocity. The turnover number (kcat) is determined by the following formula: kcat = Vmax / Et, where Et = 47.2 nmol L -1 .

[0056] 7. Stability analysis of the in vivo assembled Cas12a-crRNA complex

[0057] For the purification of Cas12a and the stability analysis of RNPs, after purifying the Cas12a protein and the Cas12a-crRNA protein-nucleic acid complex, they were aliquoted into 500 μL centrifuge tubes, 20 μL per tube, and stored in refrigerators at 4°C, -20°C, and -80°C respectively. The enzyme activity was detected every 7 days.

[0058] 8. Nucleic acid detection

[0059] Reaction system: Add 25 μL of Reaction Buffer, 2 μL of 10 μM Forward / Reverse Primer, 2.5 μL of template, and 2.5 μL of MgOAC to the RPA lyophilized particles; CRISPR reaction system: 5 μL of reaction Buffer, 2 μL of 250 nM LbCas12a-crRNA protein-nucleic acid complex, 2 μL of 10 μM ssDNA reporter probe, and 7 μL of DEPC water; After adding the components except LbCas12a-crRNA to the reaction tube, vortex and mix well, add LbCas12a-crRNA to the tube cap, amplify at 37°C for 20 min, centrifuge briefly to spin down the LbCas12a-crRNA protein-nucleic acid complex on the tube cap, place it in a qPCR instrument, react at 37°C for 20 min, record the fluorescence value every 30 seconds, and the result can be judged by the fluorescence curve;

[0060] Result determination: React in a qPCR instrument. The fluorescence curve of the reaction tube containing the genomic DNA of lumpy skin disease virus rises, and the negative control is a smooth straight line. Under the irradiation of a blue light lamp, the positive sample emits green fluorescence, while the negative control does not emit light.

[0061] Example 2:

[0062] 1. Genomic DNA extraction: Use the corresponding nucleic acid extraction method or genomic extraction kit to extract genomic DNA from the blood or tissues of diseased cattle.

[0063] 2. Primer design: Download the nucleic acid sequence of lumpy skin disease virus from GeneBank, select the conserved region of lumpy skin disease virus, and design and synthesize RPA primers and crRNA templates.

[0064] RPA primers and crRNA transcription templates:

[0065] Forward primer: CTGTTTTTAACAATGATGATGTTAAAACTGAACTC;

[0066] Reverse primer: CATTGTTACCTATTCCATTTTCTAAAATATCAAC;

[0067] crRNA transcription template:

[0068] TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATGATAC ATCACATAATGTAAC。

[0069] 3. Design report ssDNA:

[0070] Fluorescent reporter ssDNA probe: / FAM / TTATT / Iowa Black Quencher / ; (In the fluorescent reporter molecule, the dT near the 5' end is labeled with FAM, and the dT near the 3' end is labeled with BHQ1).

[0071] The primers and ssDNA reporter probes were synthesized by Hece Gene Co., Ltd.

[0072] 4. Reaction system:

[0073] Add 25 μL Reaction Buffer, 2 μL 10 μM Forward / Reverse Primer, 2.5 μL template, and 2.5 μL MgOAC to the RPA lyophilized particles; CRISPR reaction system: 5 μL reaction Buffer, 2 μL 250 nM LbCas12a-crRNA protein-nucleic acid complex, 2 μL 10 μM ssDNA reporter probe, 7 μL DEPC water; After adding the components except LbCas12a-crRNA to the reaction tube, vortex and mix well, add LbCas12a-crRNA to the tube cap, amplify at 37°C for 20 min, centrifuge instantaneously to spin down the LbCas12a-crRNA protein-nucleic acid complex on the tube cap, place it in a qPCR instrument, react at 37°C for 20 min, record the fluorescence value every 30 seconds, and the result can be judged by the fluorescence curve;

[0074] 5. Result determination: The fluorescence curve of the reaction tube containing the genomic DNA of Lumpy skin disease virus rises, and the negative control is a smooth straight line.

[0075] Sequence

[0076] SEQ ID NO: 1

[0077]

[0078] SEQ ID NO: 2 (crRNA transcription template)

[0079] TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATGATACATCACATAATGTAAC

[0080] SEQ ID NO: 3

[0081]

[0082] SEQ ID NO: 4

[0083] Sequencing primer

[0084] F: AACAAGCGCTCATGAGCC

[0085] R: CTCAAGACCCGTTTAGAGGCCCCAA

[0086] SEQ ID NO: 5

[0087] Single-stranded DNA Reporter

[0088] FAM / TTATT / Iowa Black Quencher / 。

[0089] The above specific embodiments are only explanations of the present invention, and they are not limitations of the present invention. After reading this specification, those skilled in the art can make modifications to these embodiments without creative contributions as needed, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A method for in vivo synthesis of protein-RNA complexes for nucleic acid detection, characterized in that: The method comprises the following steps: S1, construction of CRISPR / Cas protein-sgRNA framework plasmid; S2, inserting the crRNA transcription template sequence between the translation terminator and the transcription terminator of the CRISPR / Cas protein-sgRNA framework plasmid to construct a CRISPR / Cas protein-sgRNA complex expression vector targeting a specific target; S3, transforming the CRISPR / Cas protein-sgRNA complex of the specific target into an Escherichia coli expression strain and culturing it; Perform protein induction expression purification to obtain CRISPR / Cas protein-sgRNA protein nucleic acid complex; S4. Use CRISPR / Cas protein-sgRNA protein nucleic acid complex to perform nucleic acid detection; the detection includes optimization of reaction solution components and optimization of reaction conditions.

2. The method for nucleic acid detection using an in vivo synthesized protein-RNA complex as claimed in claim 1, characterized in that: In step S1, the CRISPR / Cas protein is guided by sgRNA; The sgRNA in step S1 includes all sgRNAs such as crRNA and tracrRNA that guide Cas effector proteins; The plasmid vector in step S1 is an engineered plasmid vector for expressing recombinant protein.

3. The method for nucleic acid detection using an in vivo synthesized protein-RNA complex as claimed in claim 2, characterized in that: The engineering plasmid vector comprises pET, pBAD and pEGX.

4. The method for nucleic acid detection using an in vivo synthesized protein-RNA complex as claimed in claim 1, characterized in that: The E. coli strain in step S3 is a strain of the E. coli series used for expressing proteins; In step S3, IPTG is used for induction, and the final concentration of IPTG is 0.5 mM; The induction conditions are 16°C, 150r / min, 16-20 hours; The buffer components used in the purification step in step S3 are 20 mM Tris, 300 mM NaCl, and 10 mM MgCl2.

5. A method for detecting bovine nodular dermatitis virus nucleic acid by Cas12a-crRNA assembled in vivo and RPA technology, applied to a method for nucleic acid detection of an in vivo synthetic protein-RNA complex as described in any one of claims 1-4.

6. A method for detecting bovine nodular dermatitis virus nucleic acid by Cas12a-crRNA assembled in vivo as claimed in claim 5 and RPA technology, characterized in that: The method comprises the following steps: S1. Construction of pET_28a-LbCas12a-crRNA framework plasmid: Designing a LbCas12a-crRNA sequence with a length of 3760 bp, the LbCas12a-crRNA sequence is as shown in SEQ ID NO: 1, and cloning the nucleotide sequence into the pET_28a plasmid to obtain the pET_28a-LbCas12a-crRNA plasmid; S2. Construction of a complex expression vector of LbCas12a-crRNA targeting a specific target: inserting the sequence SEQ ID NO: 2 between the NdeⅠ and BlpⅠ restriction sites of the above-mentioned pET_28a-crRNA framework plasmid; S3, transformation and expression: transforming the cloned product into Escherichia coli and culturing it; Protein induction expression and purification were performed to obtain the LbCas12a-crRNA protein-nucleic acid complex; S4. Primer design: Download the nucleic acid sequence of bovine nodular skin disease virus from GeneBank, select the conserved segment of bovine nodular skin disease virus, and design synthetic RPA primers and crRNA templates; S5. designing a report ssDNA, wherein the sequence of the ssDNA is SEQ ID NO: 5; S6. Reaction system: add 25 μL Reaction Buffer, 2 μL 10 μM Forward / Reverse Primer, 2.5 μL template, and 2.5 μL MgOAC to the RPA freeze-dried particles; CRISPR reaction system: 5 μL reaction buffer, 2 μL 250nM LbCas12a-crRNA protein-nucleic acid complex, 2 μL 10 μM ssDNA reporter probe, and 7 μL DEPC water; add the components other than LbCas12a-crRNA to the reaction tube and vortex to mix, add LbCas12a-crRNA to the tube cap, amplify at 37°C for 20 min, centrifuge instantly to shake off the LbCas12a-crRNA protein-nucleic acid complex on the tube cap, place it in a qPCR instrument, react at 37°C for 20 min, record the fluorescence value every 30 seconds, and judge the result of nucleic acid detection by the fluorescence curve.

Images