Application of CpJAZ13 and recombinant overexpression vector of CpJAZ13 in improving drought stress resistance of cucurbita pepo

Abstract

The invention belongs to the technical field of biological gene engineering, and particularly relates to application of CpJAZ13 and a recombinant overexpression vector thereof in improving drought stress resistance of summer squashes, and the nucleotide sequence of the CpJAZ13 is shown as SEQ ID NO.1. According to the invention, overexpression of CpJAZ13 is realized in zucchini through a ZYMV virus mediated overexpression system for the first time, and positive influence of CpJAZ13 on drought resistance of zucchini is confirmed. The expression of the CpJAZ13 is up-regulated after drought stress treatment. The drought resistance of the yeast is improved by overexpressing the CpJAZ13; instantaneous overexpression of the CpJAZ13 increases the oxidation resistance of the summer squash, the ROS accumulation amount is reduced, and the antioxidant enzyme activity is enhanced, so that the resistance of the summer squash to drought stress is increased. Compared with a tedious period of traditional cross breeding, the breeding time can be shortened to several months. According to the invention, a new genetic resource is provided for the improvement of zucchini varieties, and the research and development of new varieties of high-quality and drought-resistant zucchini can be promoted, so that the agricultural production and market requirements are met.

Description

Technical Field

[0001] The present invention belongs to the field of biological genetic engineering technology and specifically relates to a CpJAZ13 and application of its recombinant overexpression vector in improving zucchini's resistance to drought stress. Background Art

[0002] squash( Cucurbita pepo L.) belongs to the Cucurbitaceae family, and it likes warmth and humidity. In production, the young melon is mainly used as the edible organ. The young melon has a thin skin and thick flesh, and is rich in nutrients such as vitamin C and glucose. In recent years, with the growth of market demand, the cultivation area of ​​zucchini has continued to expand, and it has become one of the important vegetable varieties.

[0003] During the cultivation of zucchini, adverse climatic conditions such as high temperature and drought often occur, which have a significant impact on the physiological processes of plant seedlings such as nutritional growth, photosynthesis, enzyme activity, and dry matter accumulation, thereby restricting the improvement of zucchini yield and quality. In order to cope with drought stress, the main existing technical means is to breed zucchini varieties with strong drought resistance for cultivation. At present, the breeding of drought-resistant zucchini varieties mostly relies on conventional breeding methods. However, this method has a long breeding cycle, generally 5 to 8 years, or even longer, and it is difficult to quickly meet the urgent demand for variety renewal in production. Therefore, it is urgent to provide a new strategy for zucchini to cope with drought stress. Summary of the invention

[0004] In order to solve the negative impact of drought stress on zucchini, the present invention provides a CpJAZ13 Application in improving zucchini's resistance to drought stress.

[0005] The technical solution adopted by the present invention is: A first aspect of the present invention provides a CpJAZ13 Application in improving the drought stress resistance of zucchini, the CpJAZ13 The nucleotide sequence is shown in SEQ ID NO.1.

[0006] A second aspect of the present invention provides a method comprising CpJAZ13 recombinant overexpression vector.

[0007] The third aspect of the present invention provides a method for preparing the recombinant overexpression vector, comprising the following steps: Total RNA of wild-type zucchini was extracted and reverse transcribed into cDNA. Using cDNA as template, PCR amplification was performed to obtain CpJAZ13 ; After digesting the expression vector, use seamless cloning to CpJAZ13 The recombinant overexpression vector is obtained by connecting it to the expression vector after enzyme digestion.

[0008] Preferably, the expression vector is pXT1-ZYMV-eGFP.

[0009] Preferably, the restriction endonuclease used to cleave the expression vector is Apa I and Sale I.

[0010] A fourth aspect of the present invention provides an application of the recombinant overexpression vector, wherein the recombinant overexpression vector is used to construct an overexpression plant to improve the resistance of zucchini to drought stress.

[0011] Preferably, the method for constructing the overexpression plant comprises the following steps: The recombinant overexpression vector is transferred into Agrobacterium competent cells, cultured amplified, and an infection solution is prepared; the infection solution is used to infect zucchini and then cultured to obtain overexpression plants.

[0012] Preferably, the Agrobacterium competent cell is GV3101.

[0013] Preferably, the infected part of the zucchini is the cotyledon.

[0014] Preferably, the conditions for the expanded culture are culturing at 28° C. for 16 hours.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a CpJAZ13 Application in improving the drought stress resistance of zucchini, the CpJAZ13 The nucleotide sequence is shown in SEQ ID NO. 1. The present invention is the first to achieve the overexpression system mediated by ZYMV virus in zucchini. CpJAZ13 and confirmed its positive effect on drought resistance in zucchini. CpJAZ13 The expression is upregulated after drought stress treatment. CpJAZ13 Improved drought resistance in yeast; transient overexpression CpJAZ13 The antioxidant capacity of zucchini is increased, wherein the ROS accumulation is reduced and the antioxidant enzyme activity is enhanced, thereby increasing the resistance of zucchini to drought stress. Compared with the lengthy cycle of traditional hybrid breeding, the present invention can shorten the breeding time to several months. The present invention provides new genetic resources for zucchini variety improvement, and can promote the research and development of high-quality, drought-resistant zucchini new varieties to meet agricultural production and market needs.

[0016] In addition, the present invention deeply explores the functional genes related to drought stress response and explains its molecular mechanism of action, which is of great significance for the creation of drought-resistant zucchini germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1For the drought stress of PEG6000 with a mass fraction of 20% CpJAZ13 expression of.

[0018] Figure 2 Tobacco leaves CpJAZ13 Subcellular localization analysis of pBI121-eGFP, A-D are respectively: pBI121-eGFP signals in GFP channel, mCherry-Nucleus channel, Merge channel and DIC; E-H are respectively: pBI121- CpJAZ13 -eGFP signals in GFP channel, mCherry-Nucleus channel, Merge channel and DIC.

[0019] Figure 3 For overexpression CpJAZ13 Improved the resistance of yeast to drought stress. A-E are: Without drought treatment, yeast containing pYES2 empty vector had a significant effect on the resistance of yeast to drought stress. 0 , 10 -1 , 10 -2 , 10 -3 and 10 -4 The growth status of yeast when a~e are: without drought treatment, containing pYES2- CpJAZ13 The yeast of the carrier was instilled for 10 0 , 10 -1 , 10 -2 , 10 -3 and 10 -4 The growth status of yeast at 10 ℃ and 20 ℃; F~J are respectively: when treated with 5% PEG6000, yeast containing pYES2 empty vector 0 , 10 -1 , 10 -2 , 10 -3 and 10 -4 The growth status of yeast at 5% mass fraction of PEG6000; f~j are: when treated with pYES2- CpJAZ13 The yeast of the carrier was instilled for 10 0 , 10 -1 , 10 -2 , 10 -3 and 10 -4 The growth status of yeast at 10% mass fraction of PEG6000; K~O are as follows: when the yeast containing pYES2 empty vector is treated with 10% mass fraction of PEG6000, the yeast containing pYES2 empty vector is treated with 10% mass fraction of PEG6000. 0 , 10 -1 , 10 -2 , 10 -3 and 10 -4 The growth status of yeast at 10% mass fraction of PEG6000; k~o are as follows: when treated with pYES2- CpJAZ13 Yeast instillation of carrier 10 0 , 10 -1 , 10 -2 , 10 -3 and 10 -4 Yeast growth condition.

[0020] Figure 4 For overexpression CpJAZ13 Improved the resistance of zucchini to drought stress. A-C are the front view, top view and fluorescence detection image of zucchini after ZYMV-eGFP infection; D-F are the ZYMV- CpJAZ13 Front view, top view and fluorescence detection image of zucchini after infection; G~I are: phenotypes of zucchini infected with ZYMV-eGFP after 4 days of drought stress, 7 days of drought stress and 2 days of rewatering; J~L are: ZYMV- CpJAZ13 Phenotypes of zucchini after 4 days of drought stress, 7 days of drought stress and 2 days of rewatering after infection.

[0021] Figure 5 For overexpression CpJAZ13 PCR detection of zucchini plants.

[0022] Figure 6 For overexpression CpJAZ13 Expression analysis of zucchini plants.

[0023] Figure 7 Results of DAB staining and NBT staining. A: Overexpression CpJAZ13 NBT staining of three parallel samples of plant leaves; B: overexpression CpJAZ13 DAB staining of three parallel samples of plant leaves; C: NBT staining of three parallel samples of control plants; D: DAB staining of three parallel samples of control plants.

[0024] Figure 8 For overexpression CpJAZ13 The results of antioxidant enzyme activity test of zucchini plants, A~F are H2O2 content, O2 - content, MDA content, POD content, SOD content and CAT content. DETAILED DESCRIPTION

[0025] The present invention is further described below by specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0026] The inventive concept of the present invention is as follows: During the cultivation of zucchini, the adverse climatic conditions of high temperature and drought have a significant impact on the physiological processes of plant seedlings, such as nutritional growth, photosynthesis, enzyme activity, and dry matter accumulation, which in turn restricts the improvement of zucchini yield and quality. In order to cope with drought stress, the main existing technical means is to breed zucchini varieties with strong drought resistance for cultivation. At present, the breeding of drought-resistant zucchini varieties mostly relies on conventional breeding methods. However, this method has a long breeding cycle, generally 5 to 8 years, or even longer, which makes it difficult to quickly meet the urgent demand for variety renewal in production.

[0027] Based on this, the present invention provides a CpJAZ13 Application in improving the drought stress resistance of zucchini, the CpJAZ13 The nucleotide sequence is shown in SEQ ID NO.1.

[0028] In order to enable those skilled in the art to better understand the technical solution of the present invention and implement it, the present invention is further described below in conjunction with specific embodiments. In the description of the present invention, unless otherwise specified, the reagents used are all commercially available, and the methods used are all conventional techniques in the art.

[0029] The abbreviations of the present invention are shown in Table 1.

[0030] Table 1 Abbreviations

[0031] Example 1 CpJAZ13 The application of the recombinant overexpression vector in improving the drought stress resistance of zucchini is as follows: 1. Materials and methods.

[0032] (1) Plant materials and treatments.

[0033] The zucchini used in the present invention is a self-pollinating zucchini. Zucchini seeds are planted in a mixture of soil and vermiculite in a mass ratio of 1:1, and cultured in an artificial climate chamber with a photoperiod of 18h / 6h and 28°C / 22°C. After 8 weeks, the germinated zucchini seedlings are placed under drought stress conditions for co-culture for 24h, and leaves are collected at 0h, 6h, 12h and 24h, respectively. The treatment condition of drought stress is PEG6000 with a mass fraction of 20%. After collecting the leaves, all the leaves are immediately frozen in liquid nitrogen and stored at -80°C for extraction of total RNA. All leaves are tested using 3 technical replicates and 3 independent biological replicates.

[0034] (2) CpJAZ13 Gene expression analysis.

[0035] RNA extraction and CpJAZ13Reference for expression analysis: Xu, K., & Wang, P. (2024). Transcriptome-wide identification of the Hsp70 gene family in Pugioniumcornutum and functional analysis of PcHsp70-5 under drought stress. Planta, 260(4), 84. https: / / doi.org / 10.1007 / s00425-024-04509-9. actin and CAC gene as an internal reference gene. CpJAZ13 The relative expression level was 2 -ΔΔCT The primers used in the present invention are listed in Table 2.

[0036] Table 2 Primers used in the present invention

[0037] Note: Since the present invention adopts homologous recombination to carry out gene cloning, the lowercase letters in the sequence information in Table 2 represent homology arms, and the uppercase letters represent the 5' end and 3' end of the corresponding gene.

[0038] (3) Construction of recombinant vector.

[0039] CpJAZ13 The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. The following vector construction process uses the vector shown in SEQ ID NO.1 CpJAZ13 nucleotide sequence.

[0040] 1) Use pBI121-eGFP vector to construct a vector for subcellular localization as follows: pBI121-eGFP vector Xba I and Bam After HI digestion, the primers shown in SEQ ID NO.11 and SEQ ID NO.12 were used to clone the CpJAZ13 Cloned into pBI121-eGFP vector Bam HI and Xba I site in the middle, the obtained pBI121- CpJAZ13 -eGFP vector was injected into tobacco leaves for subcellular localization.

[0041] 2) Use pYES2 vector to express CpJAZ13 Perform overexpression experiments as follows: pYES2 vector Bam HI and Eco After RI digestion, the primers shown in SEQ ID NO.5 and SEQ ID NO.6 were used to clone the DNA fragments by seamless cloning. CpJAZ13 Clone into pYES2 vector to obtain pYES2- CpJAZ13 Then, the pYES2- CpJAZ13 The vector and the pYES2 empty vector were transformed into the Saccharomyces cerevisiae INVScl strain, and positive clones were screened on SD-U medium after incubation at 30°C for 40 h. Yeast growth was evaluated by dropping 10-fold serial dilutions on solid SD-U medium.

[0042] 3) Expression vector pXT1-ZYMV-eGFP was used to express CpJAZ13 Perform overexpression experiments as follows: Total RNA of wild-type zucchini was extracted and reverse transcribed into cDNA. Using cDNA as template, PCR amplification was performed to obtain CpJAZ13 The expression vector pXT1-ZYMV-eGFP was Apa I and Sale After enzyme digestion, the primers shown in SEQ ID NO.9 and SEQ ID NO.10 were used to clone the DNA by seamless cloning technology. CpJAZ13 Clone into pXT1-ZYMV-eGFP vector to obtain the recombinant overexpression vector pXT1-ZYMV- CpJAZ13 For ease of explanation, in the following text, pXT1-ZYMV- CpJAZ13 Abbreviated as ZYMV- CpJAZ13, pXT1-ZYMV-eGFP is referred to as ZYMV-eGFP 。 The recombinant overexpression vector ZYMV- CpJAZ13 After the vector was transformed into Agrobacterium competent cells GV3101, it was then transferred to LB medium containing 50μg / mL Kan and 50μg / mL Rif for expansion. After culturing at 28℃ for 16h, the bacterial precipitate was collected by centrifugation at 6000g for 5min. The bacterial precipitate was resuspended with a resuspension solution to prepare the infection solution. After the infection solution was allowed to stand at room temperature for 2 hours, a 1mL syringe was used to inject the infection solution into the cotyledons of zucchini, and repeated 3 times. Subsequently, the cells were cultured at 28℃ and observed for fluorescence using a handheld fluorescent flashlight.

[0043] Each liter of resuspension solution contains: 10 mmol MgCl2, 10 mmol MES and 100 μmol / L acetosyringone, and the rest is made up with LB medium.

[0044] SEQ ID NO.1: ATGTCGACTTCTTCGGGATTCTCTCAGGTTTCGTCTCTAAAATCGCCGGAGAACCTCGGGTTTCTTCCCGCCGGTGCGATGCTGGTTTCCGGCGAGGATCTGAATCTGGGTTTCTCGGCGAATCTCCGGAGAAGAAACGGGTCGGCGCCGGAACTGTTCCACCGGCCGGAAAAAATGGCGAATCTCAAGTCGTTGGATTTGTTTCCTCAAGAAGCTGGATTTGGTATCTCAAACGACGTCGTTTCAAGCGTCTATAAATCTGCTACGGCGGCGCCTCAAGCTTCCCAAATGACGATCTTTTACGCCGGCCAAGTTTTTGTGTTCAACAATTTCCCGGCGGAAAGAGTCGGCGAAGTTATGTTTCTAGCAGGCCGAGAGAGCTCCAAACTGAACATCCCAGCCGCCACTGTCGCTTCCGGCCAGCCTATCTTGGTCGGAACTCCGGCGGATTCTTTAAGCTCCAGTTCCCCTGTTTCCACTCGGACCCCAACCCCACCACCGCCTCCTCAGCCGCAGTCCGTCACCGGCGCTCTTCCAATGGCTCGTAAAGCTTCGATTCAACGTTTCCTAGAGAAGAGAAGAGACAGGCTAACTCTGAGAGCGCCGTACCAGAACTGCCCGGCGCCGAGCAAACTCGCCGGCGACAACTCCTGGCTGGGTTTGGCCGTGCAGCCGTAG。

[0045] SEQ ID NO.2: MSTSSGFSQVSSLKSPENLGFLPAGAMLVSGEDLNLGFSANLRRRNGSAPELFHRPEKMANLKSLDLFPQEAGFGISNDVVSSVYKSATAAPQASQMTIFYAGQVFVFNNFPAERVGEVMFLAGRESSKLNIPAATVASGQPILVGTPADSLSSSSPVSTRTPTPPPPPQPQSVTGALPMARKASIQRFLEKRRDRLTLRAPYQNCPAPSKLAGDNSWLGLAVQP。

[0046] (4) Determination of reactive oxygen species, antioxidant enzymes and MDA contents.

[0047] Determination of relevant indicators, including MDA, H2O2 and O2 - The content levels and the activities of CAT, SOD and POD were determined using corresponding kits, all of which were purchased from Solarbio.

[0048] (5) Solution preparation.

[0049] Preparation of 1 mg / mL DAB solution: Take 0.1 g DAB, dissolve it in 100 mL distilled water, and adjust the pH to 3.8.

[0050] Preparation of 0.5 mg / mL NBT solution: Dissolve 50 mg NBT in 100 mL distilled water and adjust the pH to 7.5.

[0051] (6) DAB staining, the method is as follows: 1) Place the plasmid containing pBI121- CpJAZ13 -eGFP vector-expressing tobacco leaves and wild-type tobacco leaves were placed in 1 mg / mL DAB solution and immersed for 8 h.

[0052] 2) Take out the tobacco leaves, place them in 96% ethanol by volume, boil them for 30 minutes, and decolorize them.

[0053] 3) Place the decolorized leaves in lactophenol water, make them transparent, and then take photos.

[0054] (7) NBT staining, the method is as follows: 1) Place the plasmid containing pBI121- CpJAZ13 -eGFP vector-expressing tobacco leaves and wild-type tobacco leaves were placed in 0.5 mg / mL NBT solution and immersed for 4 h.

[0055] 2) Take out the tobacco leaves, place them in 96% ethanol by volume, boil them for 30 minutes, and decolorize them.

[0056] 3) Place the decolorized transgenic tobacco leaves in lactophenol water, make them transparent, and then take photos.

[0057] 2. Results

[0058] The present invention uses Primer 5.0 software to design qRT-PCR primers. The qRT-PCR primers are shown in Table 2. They are used to analyze the 20% PEG6000 treatment period at 0h, 6h, 12h and 24h in zucchini leaves. CpJAZ13 Gene expression profiling, CpJAZ13 Gene expression profiles Figure 1 qRT-PCR data showed that most CpJAZ The genes all responded to drought stress. As the PEG6000 treatment time increased CpJAZ13 The expression level of α gradually increased and reached a peak at 12 h after stress. Figure 1 All data were analyzed using the mean ± SD method, and each analysis was repeated at least three times. **p < 0.01.

[0059] For research CpJAZ13 Subcellular localization of pBI121- CpJAZ13 -eGFP and pBI121-eGFP vectors were injected into tobacco epidermal cells respectively and observed under a confocal microscope after incubation for a period of time. CpJAZ13 A prominent green fluorescence signal overlaps with the nuclear marker, thus verifying its localization in the cell nucleus, see Figure 2 .

[0060] Subsequently, the present invention analyzed the overexpression CpJAZ13 Effects on yeast growth and stress resistance. CpJAZ13 No significant effect on yeast growth, see Figure 3 However, overexpression was observed CpJAZ13 The yeast cells showed obvious resistance in the low concentration SD-U medium containing 5% PEG6000, especially at 10 -4 In case of double infusion.

[0061] ZYMV- CpJAZ13 After the recombinant overexpression vector was transferred into Agrobacterium strain GV3101, zucchini was inoculated using the Agrobacterium-mediated method, and zucchini inoculated with ZYMV-eGFP was used as a control. All zucchini began to show mosaic symptoms on their new leaves 7 days after inoculation. Figure 4 The zucchini plants were placed under a handheld fluorescent lamp for observation and found that the CpJAZ13 Compared with the zucchini plants inoculated with ZYMV-eGFP, the zucchini plants inoculated with ZYMV-eGFP showed stronger fluorescence throughout the leaves. CpJAZ13 The diseased zucchini plants expressing ZYMV-eGFP and ZYMV-eGFP were successfully infected. Figure 5 qRT-PCR analysis revealed that compared with zucchini plants infected with ZYMV-eGFP, ZYMV- CpJAZ13 Infected zucchini plants CpJAZ13 The expression level was significantly increased. Figure 6 . Figure 5 and Figure 6 Among them, OE1, OE2 and OE3 were overexpressed in three strains. CpJAZ13pekinensis plants; WT1, WT2 and WT3 are three wild-type zucchini plants. Figure 6 All data were analyzed using the mean ± standard deviation method, and each analysis was repeated at least three times. **p < 0.01. The overexpressing plants were subjected to natural drought stress to observe the effects of drought stress on seedling performance. After 4 days of drought, ZYMV-eGFP zucchini plants showed wilting. On the 7th day, ZYMV-eGFP zucchini plants showed obvious wilting, while ZYMV- CpJAZ13 The zucchini plants only wilted slightly. After watering was resumed in both groups, ZYMV- CpJAZ13 The zucchini plants resumed normal growth, while the ZYMV-eGFP zucchini plants were still wilting 2 days after watering. Figure 4 Subsequently, the zucchini plants infected with ZYMV-eGFP and ZYMV- CpJAZ13 Infected zucchini plants were subjected to DAB and NBT staining. Figure 7 Drought stress usually causes a lot of oxidative damage in plants. In the present invention, drought stress causes O2 - NBT staining and DAB staining showed that there was no significant difference in leaf color between ZYMV-eGFP and ZYMV-CpJAZ13 lines under normal growth conditions. However, under drought stress, ZYMV-CpJAZ13 leaves showed weaker blue and brown staining compared with ZYMV-eGFP leaves, indicating that H2O2 and O2 - The accumulation of ZYMV- CpJAZ13 Compared with zucchini plants infected with ZYMV-eGFP, the levels of MDA, H2O2 and O2 in zucchini plants infected with ZYMV-eGFP were significantly higher than those in zucchini plants infected with ZYMV-eGFP. - The levels were higher in drought treatment, while the activities of three antioxidant enzymes, CAT, SOD and POD, were lower. Figure 8 . Figure 8 All data were analyzed using the mean ± standard deviation method, and each analysis was repeated at least three times. Different lowercase letters in the bar graphs indicate significant differences, p < 0.01. CpJAZ13 The antioxidant activity of zucchini seedlings increased and their resistance to drought stress was enhanced.

[0062] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0063] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. CpJAZ13 Application in improving the drought stress resistance of zucchini, characterized in that: Said CpJAZ13 The nucleotide sequence is shown in SEQ ID NO.

1.

2. A method comprising the method according to claim 1 CpJAZ13 recombinant overexpression vector.

3. The method for preparing a recombinant overexpression vector according to claim 2, characterized in that: The following steps are involved: Total RNA of wild-type zucchini was extracted and reverse transcribed into cDNA; Using cDNA as template, PCR amplification was performed to obtain CpJAZ13 ; After the expression vector was digested, the CpJAZ13 The recombinant overexpression vector is obtained by connecting it to the expression vector after enzyme digestion.

4. The preparation method according to claim 3, characterized in that: The expression vector is pXT1-ZYMV-eGFP.

5. The preparation method according to claim 3, characterized in that: The restriction endonuclease used to digest the expression vector is Apa I and Sal I.

6. The use of the recombinant overexpression vector as claimed in claim 2, characterized in that: The recombinant overexpression vector is used to construct an overexpression plant to improve the resistance of zucchini to drought stress.

7. The use according to claim 6, characterized in that The method for constructing the overexpression plant comprises the following steps: The recombinant overexpression vector is transferred into Agrobacterium competent cells, cultured and expanded to prepare infection solution; The zucchini was infected with the infection solution and then cultured to obtain overexpression plants.

8. The use according to claim 7, characterized in that The Agrobacterium competent cell is GV3101.

9. The use according to claim 7, characterized in that The infected part of the zucchini is the cotyledon.

10. The use according to claim 7, characterized in that The conditions for the expanded culture are culturing at 28° C. for 16 h.

Images