Primer for detecting HIST1H4F methylation based on qPCR and application
By designing specific methylated and non-methylated primers, combined with qPCR technology and bisulfite treatment, the complex and cost-effective existing detection methods are solved, and a simple and efficient HIST1H4F methylation detection is achieved, suitable for early cancer screening.
Patent Information
- Application Number
- CN202510102420.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2025-04-15
AI Technical Summary
The existing HIST1H4F methylation detection method is complex and costly, and cannot amplify non-methylated sequences, and cannot accurately determine the relative methylation level of the site.
A detection method based on qPCR was designed. Using specific methylated primers and non-methylated primers, primer-specific PCR was performed after bisulfite treatment, and whether the sample had methylation was determined based on the CT value of the primer amplification.
It realizes simple, fast and repeatable HIST1H4F methylation detection, with small samples required, and can accurately judge the methylation level. It is suitable for early cancer screening.
Smart Images
Figure CN119824075A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biological detection, and in particular to a primer for detecting HIST1H4F methylation based on qPCR and an application thereof. Background Art
[0002] Aberrant DNA methylation is involved in the occurrence, progression, and recurrence of cancer, making it an ideal cancer biomarker. A senior researcher at the Epigenetics Center of the Institute of Biomedical Sciences of Fudan University and a professor at the Shanghai Public Health Clinical Center have been deeply engaged in DNA methylation research for more than 20 years and have identified a type of methylation marker that may be applicable to all cancers - Universal Cancer Only Marker (UCOM). The world's first pan-cancer marker HIST1H4F was published in the international journal Cancer Research (2020IF=12.701) in 2019. The HIST1H4F gene mined through whole-genome DNA methylation data showed abnormally high methylation in 17 types of cancer and can be used for screening of multiple cancers.
[0003] DNA methylation detection methods generally use detection technologies based on the basic principle of bisulfite conversion, PCR, sequencing technology, mass spectrometry, etc. qPCR has the advantages of high efficiency, rapidity, and easy operation; DNA methylation detection based on the NGS platform has high throughput, but the operation is complex and the cost is high; the nucleic acid mass spectrometry platform is a platform between PCR and NGS technology in terms of throughput, price, time, etc.
[0004] Dong SH et al [1] Whole-genome bisulfite sequencing data analysis method revealed that HIST1H4F may be a promising UCOM marker for early cancer patient screening. Primer sequences:
[0005] Forward primer 5′-3′: GTAGAGGTAAAGGTGGTAAAGGTTTAG,
[0006] Reverse primer 5′-3′: AGGTTTAGGAAAGGGAGGYGTTAAG,
[0007] Probe 5′-3′: AAAACACCRCRAATCTCCTCATAAAT.
[0008] The region amplified by the primers is partially located in the promoter of the HIST1H4F gene. The primers can only amplify methylated sequences, but not non-methylated sequences, and cannot determine the relative methylation level of the site. The experimental cost is high, and it is not suitable for large sample research and analysis, and is not suitable for specific site, gene or segment research.
[0009] Varol N et al. [2] Quantitative real-time PCR was performed on RotorGene q using qPCR SYBR Green Master Mix (Qiagen, Germany), with primer sequences: TTGGTAGAGTAGAGGTAAA, biotin-AACACATAATACATTACTTAC, GTAAAGGTTTAGGAAAAGGGAG. Primers were mainly used as PCR templates by bisulfite-treated DNA. PCR was performed under standard conditions with biotinylated primers, and PCR products were subjected to agarose gel electrophoresis before sequencing. The methylation profile of 15 CpG sites in the HIST1H4F gene (chr6: 26240743-26240793) was determined by pyrophosphate sequencing, which is a relatively complex method, with high cost of sequencing quantitative experiments, and one pair of primers is not suitable for specific methylation site studies.
[0010] Wang SF et al. [3] Reference research method: qMS-PCR, RASSF1A and HIST1H4F methylation differentiation of endometrial cancer, qMS-PCR using primers and probes by bisulfite conversion of extracted DNA. The target region of methylation involved is the promoter of the gene. Primer sequence:
[0011] HIST1H4F-F:AGGAATTTTAAGAATATCGC
[0012] HIST1H4F-R: CCATCGGAAAAATACTACG
[0013] HIST1H4F-P:FAM-GGTTAAGCGACGGATGG-BHQ1
[0014] This method is based on the principle of PCR amplification and uses specific primers and probes for amplification. The primer design is difficult, non-methylated sequences cannot be amplified, and the relative methylation level of the site cannot be determined.
[0015] Currently, the detection of HIST1H4F methylation is mainly based on PCR and sequencing methods, which are complex to operate, costly, and cannot amplify non-methylated sequences.
[0016] References:
[0017] [1]Dong SH, Li W, Wang L, et al.Histone-Related Genes AreHypermethylated in Lung Cancer and Hypermethylated HIST1H4F Could Serve as aPan-Cancer Biomarker[J].Cancer Research, 2019,79(24):6101-6112.
[0018] [2] Varol N, Keles B, Yildiz H, et al. Methylation analysis of histone 4-related gene HIST1H4F and its effect on gene expression in bladder cancer [J]. Gene, 2023,866.
[0019] [3]Wang SF, Du CY, Li M, et al. Endometrial Cancer Detection by DNAMethylation Analysis in Cervical Papanicolaou Brush Samples[J]. Technology in Cancer Research&Treatment, 2024. Summary of the invention
[0020] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a primer and application for detecting HIST1H4F methylation based on qPCR. The primer can be used to detect HIST1H4F methylation simply, quickly and repeatably, and a small amount of sample is required.
[0021] To achieve the above purpose, the technical solution adopted by the present invention is as follows:
[0022] A primer for detecting HIST1H4F methylation based on qPCR, comprising a methylation primer and a non-methylation primer;
[0023] The methylation primers are shown in SEQ ID NO.1 and SEQ ID NO.2;
[0024] The non-methylated primers are shown in sequences SEQ ID NO.3 and SEQ ID NO.4.
[0025] The present invention also provides the use of the above-mentioned primers for detecting HIST1H4F methylation based on qPCR as a detection kit.
[0026] Furthermore, before using primers for amplification, the DNA in the sample is treated with bisulfite and then primer-specific PCR is performed; the primers shown in the sequences SEQ ID NO.1 and SEQ ID NO.2 amplify the methylated DNA chain, and the primers shown in the sequences SEQ ID NO.3 and SEQ ID NO.4 amplify the unmethylated DNA chain; and the presence of methylation in the sample is determined based on the primer amplification CT value.
[0027] Furthermore, the PCR amplification system was: 1× dye method qPCR reaction buffer, 0.4 μM upstream and downstream primers; 1× background calibration dye I, 1-10 ng template, and nuclease-free water to 20 μL.
[0028] Furthermore, the PCR amplification reaction conditions were: 95°C for 3 min, followed by the following cycles: 95°C for 5 s, 60°C for 30 s, for a total of 45 cycles.
[0029] Furthermore, the sample is fresh tissue or paraffin section or plasma free nucleic acid DNA.
[0030] Compared with the prior art, the present invention has the following beneficial effects:
[0031] The present invention provides a primer for detecting HIST1H4F methylation based on qPCR, which can determine whether the sample being tested is methylated by amplifying the CT value of the primer, thereby performing early screening for cancer. The primer can be used to detect HIST1H4F methylation simply, quickly and repeatedly, and a small amount of sample is required. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 is the methylation primer qPCR result;
[0033] Figure 2 The results are for qPCR using non-methylated primers. DETAILED DESCRIPTION
[0034] The present invention is further described below in conjunction with the accompanying drawings and embodiments. The embodiments of the present invention include but are not limited to the following embodiments.
[0035] The present invention provides a primer for detecting HIST1H4F methylation based on qPCR, and the primers have two pairs: a pair of methylated primers and a pair of non-methylated primers, the methylated primers are shown in the sequences SEQ ID NO.1 and SEQ ID NO.2, and the non-methylated primers are shown in the sequences SEQ ID NO.3 and SEQ ID NO.4. Before using the primers for amplification, the DNA to be detected is first treated with bisulfite, so that the unmethylated cytosine is converted into uracil, while the methylated one remains unchanged, and then primer-specific PCR is performed. SEQ ID NO.1 and SEQ ID NO.2 primers can amplify methylated samples, and SEQ ID NO.3 and SEQ ID NO.4 can amplify unmethylated samples. It is judged whether the sample to be tested is methylated based on the primer amplification CT value of the methylated or non-methylated DNA chain after treatment.
[0036] The detection method based on qPCR for detecting HIST1H4F methylation is as follows:
[0037] (1) Suitable samples
[0038] Fresh tissue, paraffin sections, plasma free nucleic acid DNA, etc.
[0039] (2) Nucleic acid extraction
[0040] DNA can be extracted by purchasing commercially available or self-prepared fresh tissue genomic DNA extraction reagents, paraffin section tissue genomic DNA extraction reagents, or plasma free nucleic acid DNA extraction reagents.
[0041] In this example, the following method was used to extract plasma free nucleic acids:
[0042] a. Add 1 mL of plasma to the test tube, then add 40 μL of proteinase K and mix well (plasma and proteinase K need to be added and mixed well before adding lysis buffer) and then add 80 μL of lysis buffer (proteinase K cannot be added directly to the lysis buffer, otherwise it will cause proteinase K to lose its activity and affect the extraction efficiency).
[0043] b. After adding the three components, vortex and mix for 5 seconds and incubate at 60℃ for 20 minutes.
[0044] c. After the incubation, wait for the sample to return to room temperature, add 1.2 mL of binding buffer and 40 μL of magnetic beads (the magnetic beads need to return to room temperature in advance), invert and mix 10 times, and shake at medium speed (400-500 rpm) at room temperature for 6 minutes (invert and mix several times during the period).
[0045] d. Divide the sample into two low-absorption tubes, place them on a magnetic rack, and let them stand for 3-5 minutes. After the liquid becomes clear, carefully remove the supernatant.
[0046] e. Add 2 mL of washing solution I to each low-absorption tube (distribute as evenly as possible), mix well and centrifuge, then combine into one tube, continue vortexing for 30 seconds, centrifuge, place on a magnetic rack, wait for the solution to become clear, and discard the supernatant;
[0047] f. Add 2 mL of washing solution II to the low adsorption tube, vortex for 30 seconds, centrifuge, place on a magnetic stand, wait for the solution to become clear, and discard the supernatant;
[0048] g. Briefly centrifuge, place on a magnetic rack and let stand, carefully remove the remaining supernatant, dry, and air dry for 5-10 minutes until the surface of the magnetic beads is matte (the drying time can be adjusted according to the ambient humidity. If the magnetic beads are not completely dried, it will affect the downstream experiments. If the magnetic beads are cracked, it will affect the DNA yield and quality);
[0049] h. After the magnetic beads are dried, add 25-50 μL of elution buffer, vortex to disperse the magnetic beads, and gently shake 1-2 times to accelerate DNA dissolution;
[0050] i. Place on a magnetic rack and let stand for 3 minutes. After the solution is clarified, carefully transfer the DNA solution to a new low-adsorption tube (a second transfer is required to absorb the remaining magnetic beads);
[0051] j. Store at -20℃.
[0052] (3) Bisulfite treatment
[0053] The extracted DNA can be treated with a commercially available or self-prepared bisulfite treatment reagent.
[0054] Use the following steps to treat the bisulfite:
[0055] 3.1. Thaw the DNA for bisulfite reaction. Ensure that all reagents for bisulfite conversion are fully dissolved. If necessary, heat at 60°C and vortex until completely dissolved. This process takes up to 5 minutes.
[0056] 3.2. Prepare the bisulfite reaction in a 200 μL PCR tube. Add each component in the order listed in Table 1. Mix thoroughly after adding the sample according to Table 1, transfer to the PCR instrument, and perform the transformation according to the program in Table 2. This process takes 30 minutes.
[0057] Table 1:
[0058]
[0059]
[0060] Note: The total volume of the high concentration sample DNA solution and RNase-free water must be 20 μl.
[0061] Note: The total volume of the low concentration sample DNA solution and RNase-free water must be 40 μl.
[0062] Table 2
[0063] step time temperature transsexual 5min 95℃ Incubation 10min 60℃ transsexual 5min 95℃ Incubation 10min 60℃ Hold unlimited 20℃
[0064] 3.3. Purification of sulfite-converted DNA:
[0065] a. After bisulfite conversion is complete, briefly centrifuge the PCR tube containing the bisulfite reaction and transfer the entire bisulfite reaction (140 μL) to a clean 1.5 mL microcentrifuge tube.
[0066] b. Add 310 μL of freshly prepared Buffer BL, mix thoroughly, and centrifuge briefly. Note: When the starting DNA content is less than 100 ng, carrier RNA solution needs to be added to Buffer BL. When the starting DNA content is greater than 100 ng, Buffer BL can be used directly without the need for carrier RNA solution. The preparation ratio of carrier RNA solution and Buffer BL is shown in Table 3 below.
[0067] Table 3
[0068]
[0069] c. Add 250 μL of ethanol (96–100%), vortex to mix for 15 seconds, and centrifuge briefly.
[0070] d. Transfer all the solution obtained in the previous step to the DNA purification column provided with the kit.
[0071] e. Centrifuge at maximum speed for 1 min, discard the waste liquid, and put the purification column back into the collection tube.
[0072] f. Add 500 μL Buffer BW (wash buffer) to the purification column and centrifuge at maximum speed for 1 min, discard the waste liquid, and return the purification column to the collection tube.
[0073] g. Add 500 μL of Buffer BD (desulfurization buffer) to the purification column, cover the lid (Buffer BD should be exposed to air as little as possible), and let it stand at room temperature (15-25°C) for 15 minutes.
[0074] h. Centrifuge at maximum speed for 1 minute, discard the waste liquid, and put the purification column back into the collection tube.
[0075] i. Add 500 μL Buffer BW to the purification column and centrifuge at maximum speed for 1 min. Discard the waste liquid and return the purification column to the collection tube.
[0076] j. Repeat the above steps.
[0077] k. Add 250 μL of ethanol (96–100%) to the purification column and centrifuge at maximum speed for 1 min.
[0078] l. Place the purification column into a new 2 mL collection tube and centrifuge the purification column at maximum speed for 1 min to remove all residual liquid.
[0079] Optional: Place the column into a clean 1.5 mL microcentrifuge tube and incubate in a metal bath at 60°C for 5 min. This step will evaporate any remaining liquid.
[0080] m. Place the purification column in a clean 1.5 mL microcentrifuge tube. Add 15 μL Buffer EB (elution buffer) directly to the center of each purification column membrane, gently close the lid, and let the purification column stand at room temperature for 1 minute;
[0081] n. Centrifuge at 15,000 x g (12,000 rpm) for 1 min to elute the DNA.
[0082] Note: If a higher DNA concentration is required, only 10 μL of Buffer EB can be used for elution, but the yield will be reduced by approximately 20%. Do not elute with less than 10 μL of Buffer EB because the purification column membrane will not be fully hydrated.
[0083] o. Quantitative.
[0084] Note: Purified DNA can be stored at 2-8°C for 24 hours. For storage longer than 24 hours, it is recommended to store at -15 to -30°C.
[0085] 3.4. Notes:
[0086] a. The kit is shipped at room temperature (15-25°C). Upon arrival, DNA purification columns, DNA Protect Buffer, and Buffer BD should be stored at 2-8°C. However, short-term storage (up to 4 weeks) at room temperature will not affect their performance. All other buffers and bisulfite mixtures should be stored at room temperature and are stable under these conditions for at least 6 months.
[0087] b. Lyophilized carrier RNA can be stored at room temperature for 1 year. Carrier RNA can only be dissolved in RNase-free water. Dissolved carrier RNA should be added immediately to buffer BL, which should be freshly prepared and stable at 2-8°C for 48h. Unused carrier RNA dissolved in RNase-free water should be frozen in aliquots at -15°C to -30°C and can be stored for up to 1 year.
[0088] c. Due to the sensitivity of nucleic acid amplification technology, care should be taken to avoid cross-contamination between sample preparations when handling DNA purification columns.
[0089] (4) Primer design
[0090] In order to allow the primers to relatively quantify the level of methylation, more CpG sites can be covered, and the primer design is relatively simple without relying on enzymes. The promoter region DNA sequence of HIST1H4F was selected, and the sequences of the promoter regions of these genes can be found through the link http: / / www.genome.ucsc.edu / cgi-bin / hgGateway. The primers were designed using the online methylation primer design software (http: / / www.urogene.org / methprimer), one pair of methylated primers, and one pair of non-methylated primers.
[0091] Methylation Primers:
[0092] SEQ ID NO.1(HIST1H4F-Left M):TTTAGAATTTTGGGAGGTCGA
[0093] SEQ ID NO.2(HIST1H4F-Right M):AACTACAACTACAAACGCGCGT
[0094] Unmethylated primers:
[0095] SEQ ID NO.3(HIST1H4F-Left U): TTTTAGAATTTTGGGAGGTTGA
[0096] SEQ ID NO.4(HIST1H4F-Right U):CAATAACTACAACTAAAACACACA
[0097] (5) qPCR amplification
[0098] Amplification reaction system: 1× dye method qPCR reaction buffer, 0.4 μM upstream and downstream primers (1:1), background calibration dye I, 1-10 ng template, nuclease-free water to make up the total system to 20 μL. The dye method qPCR reaction buffer and background calibration dye I were purchased directly from a commercial company, and the template was the DNA of the sample to be tested.
[0099] Amplification reaction conditions: 95°C for 3 min, followed by the following cycles: 95°C for 5 s, 60°C for 30 s, for a total of 45 cycles.
[0100] (6) Result determination
[0101] The methylation status can be judged according to the CT value. After the PCR reaction is completed, the Ct threshold is set in the exponential amplification interval (in this experiment, the fluorescence intensity ΔRn is set to 1), and the amplification with a Ct value less than 40 is considered positive. The ΔRn value represents the amount of PCR product during the PCR process. A curve is drawn with the ΔRn value versus the cycle number, and a fluorescence threshold is selected. The cycle number at which the fluorescence reaches the fluorescence threshold is called the threshold cycle number, which is also the CT value. The ΔRn value is the optimal value automatically set by the software, and can also be manually changed according to the experimental requirements. It is generally set in the middle or end of the exponential amplification interval.
[0102]
[0103] When partial methylation occurs, relative quantitative judgment is performed using the following formula:
[0104]
[0105] in,
[0106] N m : Copy number after amplification using methylated primers;
[0107] N u : Copy number after amplification using non-methylated primers;
[0108] N m0 : Initial methylation substrate copy number;
[0109] N uo : Initial unmethylated substrate copy number;
[0110] e x : Amplification efficiency;
[0111] ct m : Ct value of methylation primer amplification;
[0112] ct u : Ct value of non-methylated primer amplification;
[0113]
[0114] The following is described with specific embodiments:
[0115] The methylation status of the HIST1H4F gene promoter region can be determined based on the amplified CT value. In this embodiment, the above method was used to detect free nucleic acid in advanced lung cancer, lung nodules and healthy human plasma as samples. The test results are as follows: Figure 1 , Figure 2 As shown. Among them, Figure 1This is the result of methylation primer qPCR test. The CT value of methylation (late-stage lung cancer sample) is 26.017, and the CT value of partial methylation (lung nodule sample) is 33.603. The sample without amplification curve is a healthy person sample. Figure 2 The qPCR test results of non-methylated primers show that the CT value of unmethylated (healthy samples) is 19.8, and the CT value of partially methylated (lung nodule samples) is 27.303. The samples without amplification curves are advanced lung cancer samples. Figure 1 , Figure 2 Substitute the partially methylated CT value into the formula for calculation ((When ΔRn=1, the copy numbers of the two amplified genes are equal, that is, N m =N u ), calculate N m0 / N m0 +N uo *100% = 1.25%. The higher the percentage of partial methylation detection, that is, the higher the degree of methylation, usually indicates a higher risk of malignant transformation of cells, which has a more direct guiding significance for the progression of the disease and prognosis assessment.
[0116] The above embodiment is only one of the preferred implementation modes of the present invention and should not be used to limit the protection scope of the present invention. Any changes or modifications that are made to the main design concept and spirit of the present invention and have no substantive significance, and the technical problems they solve are still consistent with the present invention, should be included in the protection scope of the present invention.
Claims
1. A primer for detecting HIST1H4F methylation based on qPCR, characterized in that: Includes methylated primers and non-methylated primers; The methylation primers are shown in SEQ ID NO.1 and SEQ ID NO.2; The non-methylated primers are shown in sequences SEQ ID NO.3 and SEQ ID NO.
4.
2. Use of the primers for detecting HIST1H4F methylation based on qPCR as claimed in claim 1 as a detection kit.
3. The use of primers for detecting HIST1H4F methylation based on qPCR according to claim 2, characterized in that: Before using the primers for amplification, the DNA in the sample is treated with bisulfite, and then primer-specific PCR is performed; the primers shown in the sequences SEQ ID NO.1 and SEQ ID NO.2 amplify the methylated DNA chain, and the primers shown in the sequences SEQ ID NO.3 and SEQ ID NO.4 amplify the unmethylated DNA chain; The presence of methylation in the sample was determined based on the primer amplification CT value.
4. The use of primers for detecting HIST1H4F methylation based on qPCR according to claim 3, characterized in that: The PCR amplification system was: 1× dye method qPCR reaction buffer, 0.4 μM upstream and downstream primers; 1× background calibration dye I, 1-10 ng template, and nuclease-free water to 20 μL.
5. The use of primers for detecting HIST1H4F methylation based on qPCR according to claim 4, characterized in that: The PCR amplification reaction conditions were: 95°C for 3 min, followed by the following cycles: 95°C for 5 s, 60°C for 30 s, for a total of 45 cycles.
6. The use of primers for detecting HIST1H4F methylation based on qPCR according to claim 5, characterized in that: The sample is fresh tissue or paraffin section or plasma free nucleic acid DNA.