Method for detecting and application of molecular marker of resistance to thiamethoxam in diaphorina citri

By identifying genes related to thiamethoxam resistance in citrus psyllids and establishing molecular marker technology, the expression levels of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 genes were utilized to solve the time-consuming and labor-intensive problem of monitoring pesticide resistance in citrus psyllids. This enabled rapid and specific detection and scientific pesticide application, supporting the sustainable development of the citrus industry.

CN119824098BActive Publication Date: 2026-05-19SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510022658.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-07
Publication Date
2026-05-19
Estimated Expiration
2045-01-07

AI Technical Summary

Technical Problem

The long-term and extensive use of chemical agents has led to high levels of resistance to thiamethoxam in citrus psyllids. Traditional methods for monitoring resistance are labor-intensive and time-consuming, necessitating new methods for monitoring citrus psyllid resistance.

Method used

By identifying genes related to thiamethoxam resistance in citrus psyllids, a molecular marker technique was established. The expression levels of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 genes were used as molecular markers, and rapid detection was performed using specific primer pairs and qPCR.

Benefits of technology

It enables rapid and specific detection of pesticide resistance in citrus psyllids, supports scientific pesticide use and early monitoring, effectively controls pesticide resistance in citrus psyllids, and alleviates the challenges of Huanglongbing (HLB) control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005231842660000051
    Figure BDA0005231842660000051
  • Figure BDA0005231842660000061
    Figure BDA0005231842660000061
  • Figure BDA0005231842660000071
    Figure BDA0005231842660000071
Patent Text Reader

Abstract

The application discloses a molecular marker for resistance of a citrus psyllid to thiamethoxam and application and detection method thereof. The application discovers the molecular marker for resistance of the citrus psyllid to thiamethoxam, namely, cytochrome P450 genes DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2, through synergistic experiments, enzyme activity determination and expression profile analysis. The molecular marker has high specificity and stability, and through analysis of relative expression amounts of the molecular marker of the citrus psyllid to-be-tested sample, it can be known whether the to-be-tested sample is a sensitive strain or a resistant strain to thiamethoxam, so that the drug resistance of the citrus psyllid can be monitored at any time, early monitoring of the drug resistance of the citrus psyllid is facilitated, and the application has important significance for continuous and effective control of the drug resistance of the citrus psyllid and prevention and treatment of Huanglongbing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and relates to a molecular marker, particularly to a molecular marker for resistance of citrus psyllid to thiamethoxam, its application, and detection method. Background Technology

[0002] Huanglongbing (HLB) is a devastating disease in the citrus industry. It causes chlorosis in citrus leaves, branch dieback, fruit drop, deformed small fruits, and lower internal fruit quality, ultimately leading to tree death. The citrus psyllid (Diaphorinacitri Kuwayama, Hemiptera: Psyllidaceae) is the vector for HLB. Currently, there is no cure for HLB; prevention and control of its spread primarily rely on controlling the citrus psyllid population.

[0003] Chemical control is the primary method for controlling citrus psyllids. Thiamethoxam is the main registered pesticide for controlling citrus psyllids in my country. However, the long-term and extensive use of chemical pesticides has led to high levels of resistance in citrus psyllids, thus affecting the effective control of citrus psyllids and posing a serious challenge to the sustainable development of the citrus industry. Resistance monitoring is an important way to guide scientific pesticide use and delay the development of resistance in citrus psyllids. Traditional resistance monitoring is mainly carried out through bioassays, which are labor-intensive and time-consuming. Therefore, it is necessary to develop new methods for monitoring resistance in citrus psyllids. In this regard, we compared the differences in resistance among different citrus psyllid populations in the field, identified resistance-related genes, and conducted functional analysis to clarify the molecular mechanism of resistance to commonly used insecticides in citrus psyllids. Based on this, we established a molecular marker technology for resistance to insecticides in citrus psyllids. Summary of the Invention

[0004] The inventor's research team collected resistant strains of citrus psyllids from orchards in Chongzuo, Nanning, Guangxi, and tested them for resistance to thiamethoxam. Enzyme activity assays and synergistic experiments showed that the cytochrome P450 enzyme system is mainly involved in the metabolic detoxification of thiamethoxam. Subsequent transcriptome sequencing and RT-qPCR results showed that four cytochrome P450 genes—DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2—were significantly upregulated in the resistant strains. Finally, RNAi technology further confirmed the role of these four P450 genes in the formation of thiamethoxam resistance in citrus psyllids. The upregulation of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 expression levels can be used as molecular marker genes for thiamethoxam resistance in citrus psyllids. Based on this, this application protects the following technical solution:

[0005] A first aspect of the present invention provides a molecular marker for resistance to thiamethoxam in the citrus psyllid, said molecular marker being any combination of one or more of the following nucleotide sequences in the citrus psyllid cytochrome P450 gene:

[0006] Genes such as DcitCYP6K3 (SEQ ID NO.25), DcitCYP4V1 (SEQ ID NO.26), DcitCYP15A4 (SEQ ID NO.27), and DcitCYP301a2 (SEQ ID NO.28) are shown.

[0007] A second aspect of the present invention provides a primer pair for detecting the above-mentioned molecular markers, wherein the primer sequences of the primer pair are as follows: the primer pair sequences for detecting the DcitCYP6K3 gene are shown in SEQ ID NO.1 and SEQ ID NO.2; the primer pair sequences for detecting the DcitCYP4V1 gene are shown in SEQ ID NO.5 and SEQ ID NO.6; the primer pair sequences for detecting the DcitCYP15A4 gene are shown in SEQ ID NO.13 and SEQ ID NO.14; and the primer pair sequences for detecting the DcitCYP301a2 gene are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0008] A third aspect of the invention provides the application of the above-described molecular markers in the classification of citrus psyllid populations susceptible to and resistant to thiamethoxam.

[0009] In the aforementioned application technology, the expression levels of the molecular marker genes of the citrus psyllid to be tested are detected. If the expression level of the molecular marker genes of the citrus psyllid to be tested is significantly higher than that of the sensitive population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam; if there is no significant difference in the expression levels of the molecular marker genes between the citrus psyllid to be tested and the sensitive population, it cannot be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

[0010] A fourth aspect of the present invention provides a method for detecting the above-mentioned molecular markers. Using a citrus psyllid susceptible population as a control, the expression levels of the above-mentioned molecular marker genes in the citrus psyllid to be tested are detected. If the expression level of the molecular marker genes in the citrus psyllid to be tested is significantly higher than that in the susceptible population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam. If there is no significant difference in the expression levels of the molecular marker genes between the citrus psyllid to be tested and the susceptible population, it cannot be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

[0011] The above detection method includes the following steps: extracting total RNA from the citrus psyllid to be tested, reversing it into cDNA, performing qPCR amplification using cDNA as a template, using a sensitive population as a control, and measuring the expression level of molecular marker genes in the test subjects. When the expression level of molecular marker genes in the test subjects is significantly higher than that in the sensitive population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

[0012] The above detection method uses the above primer pairs for qPCR amplification.

[0013] The above detection method uses a qPCR amplification reaction system consisting of: 10 μL of 2×ChamQUniversal SYBRqPCRMasterMix, 1 μL each of 10 μM forward and reverse primers, 4 μL of cDNA template, and ddH2O added to bring the total to 20 μL.

[0014] The qPCR amplification conditions were: 95℃ pre-denaturation for 3 min; then 95℃ denaturation for 10 sec, 55℃ annealing for 30 sec, for 40 cycles.

[0015] The fifth aspect of the present invention provides a dsRNA that interferes with the above-mentioned molecular marker genes. The dsRNA sequence of the DcitCYP6K3 gene is shown as the base sequence from position 344 to 845 of the sequence shown in SEQ ID NO.25; the dsRNA sequence of the DcitCYP4V1 gene is shown as the base sequence from position 1096 to 1523 of the sequence shown in SEQ ID NO.26; the dsRNA sequence of the DcitCYP15A4 gene is shown as the base sequence from position 391 to 805 of the sequence shown in SEQ ID NO.27; and the dsRNA sequence of the DcitCYP301a2 gene is shown as the base sequence from position 708 to 1206 of the sequence shown in SEQ ID NO.28.

[0016] A sixth aspect of the present invention provides any of the following applications of the above-described dsRNA:

[0017] 1) Application in inhibiting the expression of the molecular marker gene or in the preparation of products that inhibit the expression of the molecular marker gene;

[0018] 2) Application in increasing the susceptibility of citrus psyllids to thiamethoxam or in the preparation of products that increase the susceptibility of citrus psyllids to thiamethoxam;

[0019] 3) Application in increasing the control effect of thiamethoxam on citrus psyllids or in the preparation of products that increase the control effect of thiamethoxam on citrus psyllids.

[0020] The beneficial effects of this invention are:

[0021] This invention identified and validated a molecular marker for thiamethoxam resistance in citrus psyllids through synergistic experiments, enzyme activity assays, and expression profiling. This marker exhibits high specificity and stability. By analyzing the relative expression levels of this molecular marker in citrus psyllid samples, it is possible to determine whether the sample is a susceptible or resistant strain to thiamethoxam. This allows for real-time monitoring of citrus psyllid resistance, facilitating early detection and crucial for sustained and effective control of citrus psyllid resistance and the prevention and control of Huanglongbing (HLB).

[0022] This invention provides specific forward and reverse primers for molecular markers of citrus psyllid resistance to thiamethoxam, as well as an optimized qPCR system and amplification program. It can successfully and rapidly detect the relative expression levels of detoxification metabolism-related genes DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 in citrus psyllids. If the expression levels are significantly higher than those in susceptible citrus psyllid populations, it can be determined that the tested citrus psyllids are resistant to thiamethoxam.

[0023] The detection method of this invention is simple and quick to operate, with strong detection specificity and high sensitivity. Attached Figure Description

[0024] Figure 1 The results show the differential expression of P450s, CarE, and GST genes in the SS and THRS populations of the citrus psyllid. The bar chart represents the mean ± standard deviation of three replicates. The significance of the results was determined using Student's t-test (**p < 0.01).

[0025] Figure 2 The results show the specific viability of P450s, CarE, and GSTs for different populations of the citrus psyllid. SS: susceptible populations of the citrus psyllid; THRS: thiamethoxam-resistant populations of the citrus psyllid. Error bars represent the standard deviation of the mean of three independent replicates. Significance results were determined using Student's t-test (**p < 0.01).

[0026] Figure 3 The expression patterns of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 in different tissues and developmental stages of THRS were shown. Statistical comparisons were performed using one-way ANOVA. The bar charts represent the mean ± standard deviation of three replicates. Different letters on the bars indicate significant differences (Duncan, P < 0.05). HE: head, CU: epidermis, MG: midgut, MT: Malpighian tubules, FB: fat body, TE: testis, OV: ovary; Egg: egg, 1st-5th: 1st-5th instar nymphs, Adult: adult.

[0027] Figure 4 The expression patterns of the P450 gene in THRS under different concentrations of thiamethoxam stress were shown: AD: LC30 treatment, EH: LC50 treatment, IL: LC70 treatment; the bar charts represent the mean ± standard deviation of three replicates; significance was determined using the Student's-test (**p < 0.01 * p < 0.05).

[0028] Figure 5 The expression levels of the P450 gene after H2O and dseGFP treatments are shown: H2O was used instead of dsRNA in artificial feed; the bar charts represent the mean ± standard deviation of three replicates; significance was determined using Student's t-test (**p < 0.01 * p < 0.05).

[0029] Figure 6 The study showed the silencing efficiency of target genes in citrus psyllids and the effect of P450 gene knockdown on thiamethoxam toxicity: AD: silencing efficiency of the four P450 genes after 48 h of silencing treatment; EH: silencing efficiency of the four P450 genes after 72 h of silencing treatment; IL: susceptibility of SS P450 gene knockdown to thiamethoxam; MP: susceptibility of THRS P450 gene knockdown to thiamethoxam; the bar chart represents the mean ± standard deviation of three replicates; significance was determined using Student's t-test (**p < 0.01 * p < 0.05). Detailed Implementation

[0030] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.

[0031] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0032] Example 1: Transcriptome sequencing of thiamethoxam-resistant and susceptible strains of citrus psyllids

[0033] 1. Materials

[0034] 1.1 Test insect source

[0035] The susceptible population (SS) of citrus psyllids was collected in 2020 from Yanshan, Guilin, Guangxi (25.01°N, 110.33°E) and has been reared in the insect rearing room of the Guangxi Special Crops Research Institute in Guilin City since then. It has not been exposed to any pesticides and has been continuously reared for over 50 generations. The thiamethoxam-resistant population (THRS) was collected in 2023 from Chongzuo City, Nanning, Guangxi (22.40°N, 107.26°E), and each generation was sprayed with a lethal dose (LC50). 30 Thiamethoxam (CAS Registry Number) concentration

[0036] (153719-23-4) Selection is carried out for each generation, and 20 generations have been continuously raised to date. Both strains are raised in 120-mesh mesh cages, with cage dimensions of 60×60×90cm; each cage contains 5 to 6 pots of Murraya paniculata plants. The rearing temperature is 26±1℃, the light condition is 14L:10D (light:dark), and the relative humidity is 70-85%.

[0037] 1.2 Main Reagent Sources

[0038] ReliaPrep™ RNATissueMiniprep System (Promage, Product No.: Z6111);

[0039] HiScriptⅢ 1st Strand cDNA Synthesis Kit (+gDNAwiper) Reverse Transcription Kit (Nanjing Novizan Biotechnology Co., Ltd., Catalog No.: R312);

[0040] ChamQ™ Universal SYBR qPCR MasterMix (Nanjing Novizan Biotechnology Co., Ltd., Product No.: Q711).

[0041] 2 methods

[0042] 2.1 Collection of thiamethoxam-resistant and susceptible strains of citrus psyllid

[0043] The citrus psyllids, which are 3-7 days old and susceptible to emergence, were collected using trematode tubes. The collected syllids were then placed into 1.5 mL enzyme-free tubes, with approximately 50 syllids per tube. Three tubes were collected for each strain as replicates. After preparation, the tubes were flash-frozen in liquid nitrogen and stored at -80°C for later use.

[0044] 2.2 Transcriptome sequencing and expression profiling analysis

[0045] The prepared samples were sent to Beijing Biomarker Biotechnology Co., Ltd. for transcriptome sequencing on the Illumina HiSeq platform.

[0046] 2.3 Construction of cDNA library and sequencing

[0047] First, using Oligo(dT) magnetic beads, mRNA from the citrus psyllid was isolated from total RNA and enriched. The mRNA was then fragmented using a specific buffer. Using these fragmented mRNAs as templates, and with the aid of M-MuLV reverse transcriptase, the first strand of cDNA was synthesized using random oligonucleotide primers. The complementary strand of cDNA was then synthesized using a combination of DNA polymerase I, ribonuclease H, deoxyribonucleoside triphosphates (dNTPs), and buffer. The double-stranded cDNA was purified using a QiaQuick PCR extraction kit, and the poly(A) ends were repaired, while sequencing adapters were ligated. Approximately 150 bp cDNA fragments were screened using AMPureXP beads, and the library concentration was further increased by PCR amplification. The PCR products were then purified again using AMPureXP beads to obtain the final library. The constructed library was quantitatively analyzed using qPCR (concentration greater than 2 nM) to ensure it met quality standards. After the library passed the testing, it was sequenced using the Illumina HiSeq™ 2500 sequencing platform.

[0048] 2.4 Data quality control and reference sequence alignment

[0049] To ensure sufficient read quality, raw sequencing data (rawreads) undergo a screening process to remove reads containing adapters, low-quality reads, and reads containing more than 10% N bases, thus obtaining high-quality cleanreads. These cleanreads are then aligned to the genome sequence of the citrus psyllid. Reads aligned to the reference genome are called mapped reads. The percentage of mapped reads to clean reads is used to assess whether the selected reference genome assembly meets the requirements for information analysis. Transcripts are then assembled and compared with existing annotation information to identify annotated genes with known functions and potential novel genes.

[0050] 2.5 Differentially expressed gene analysis and enrichment

[0051] Differential expression analysis was performed between sample groups using DESeq software to identify gene sets with different expression levels under two biological conditions. For samples lacking biological replicates, EBseq was used for differential expression analysis. The screening criteria for differentially expressed genes were a fold change (FC) ≥ 2 and a false discovery rate (FDR) < 0.01. Based on the screening criteria of FDR < 0.01 and |log2(FC)| > 1, significantly differentially expressed genes (DEGs) between THRS and SS of the citrus psyllid were identified. Subsequently, functional enrichment analyses using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were performed on all selected DEGs, with a significance level set at P ≤ 0.05.

[0052] 2.6 RT-qPCR Validation of Differentially Expressed Genes

[0053] cDNA was synthesized from RNA returned after transcriptome sequencing by a sequencing company using the HiScript III 1st Strand cDNA Synthesis Kit. The procedure was performed according to the kit instructions. The reaction volume was 20 μL, and the reaction conditions were: 37℃ for 15 min; 85℃ for 5 sec. The obtained cDNA was used as a template for qPCR to detect the relative expression levels of upregulated genes in the transcriptome results. Ten differentially expressed genes were selected for validation. Primer sequences for RT-qPCR of the target genes were designed using Primer 6 software, with GAPDH and β-actin as internal reference genes. These primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The primer sequences are shown in Table 1.

[0054] Table 1. Primer sequence information for RT-qPCR

[0055] Gene name Primer sequence (5'-3') SEQ ID NO DcitCYP6K3-F CCACATATCAAGTCTGCTCCTGTC SEQ ID NO.1 DcitCYP6K3-R AAGTGCCAATTAGAATGCCGAAGT SEQ ID NO.2 DcitCYP301a2-F TGGTCATGGTGCTAGGATGTGTCT SEQ ID NO.3 DcitCYP301a2-R ACCTTGTACTCCAGTGGCTTGTGA SEQ ID NO.4 DcitCYP4V1-F CGTCATCCGCAAATACAGCAGGAA SEQ ID NO.5 DcitCYP4V1-R AGTTAGCCGTCTTCGTGGTGTCT SEQ ID NO.6 DcitCYP4C30-F CTGACCAGACCTGAGCACATAGA SEQ ID NO.7 DcitCYP4C30-R GCGATGCGAATGCCACTTAGC SEQ ID NO.8 DcitCYP4g6-F GAAGCCGCCAAGAGACCAGTA SEQ ID NO.9 DcitCYP4g6-R TCCAACACAACCTGCTCCATATTAG SEQ ID NO.10 DcitCYP313b1-F GGAGCGGATGGCACAATGTT SEQ ID NO.11 DcitCYP313b1-R TGAGAACGAAATAGGTGGGATTGG SEQ ID NO.12 DcitCYP15A4-F TGCCATTAGTGGAAGCCGTCTT SEQ ID NO.13 DcitCYP15A4-R TGGTATCTTCGGTCGCTCTGTG SEQ ID NO.14 DcitCYP4C41-F CCGAGGATACAGCAGGAACATTGTG SEQ ID NO.15 DcitCYP4C41-R AGTTAGCCGTCTTCGTGGTGTCT SEQ ID NO.16 DcitCCE32-F CGGTAGTGACAACTGCCTCTTCC SEQ ID NO.17 DcitCCE32-R ATTGCCTCCCTTGAATGCTCCTC SEQ ID NO.18 DcitGSTD1-F GAGCCGTGCCATCATTGCCTAC SEQ ID NO.19 DcitGSTD1-R GTTGACGATGCCTCTCGCCTTG SEQ ID NO.20 DcitActin1-F TGTGACGAAGAAGTTGCTGC SEQ ID NO.21 DcitActin1-R TGGGGTATTTCAGGGTCAGG SEQ ID NO.22 DcitGAPDH2-F CATGGCAAGTTCAACGGTGA SEQ ID NO.23 DcitGAPDH2-R CGATGCCTTCTCAATGGTGG SEQ ID NO.24

[0056] The qPCR reaction system consisted of: 10 μL of ChamQ Universal SYBR qPCR Matser Mix, 1 μL each of 10 μM forward and reverse primers, 4 μL of cDNA template from the sample to be tested, and ddH2O added to a final volume of 20 μL. The amplification program was: 95℃ pre-denaturation for 3 min; then 95℃ denaturation for 10 sec, 55℃ annealing for 30 sec, for 40 cycles.

[0057] 2.7 Data Analysis

[0058] The RT-qPCR analysis software used was qPCRsoft 4.0. The relative gene expression levels of the treatment group and the control group were calculated using SPSS 20.0 software, and the differences in the above calculation results were analyzed for significance using one-way ANOVA and Duncan's new multiple range method.

[0059] 3 Results

[0060] 3.1 Sequencing quality

[0061] After constructing cDNA libraries and sequencing six samples from the citrus psyllid SS and THRS, a total of 42.59 Gb of clean data was obtained, with each sample reaching 6.54 Gb of clean data. The GC content was above 40.43%, and the Q30 base percentage was above 96.73%, indicating good sequencing quality.

[0062] 3.2 Number of differentially expressed genes

[0063] A total of 1420 DEGs were obtained from the thiamethoxam-resistant population THRS and the susceptible strain SS (represented by the letter A in English). Among them, 702 genes were upregulated and 718 genes were downregulated. The log2 (FC) ranged from -12.35 to 8.21.

[0064] 3.3 GO functional enrichment of differentially expressed genes

[0065] Following GO enrichment analysis, DEGs were enriched into 34 functional groups across three main categories. Within the "Biological Processes" category, "Cellular Processes" and "Metabolic Processes" had the highest number of genes. "Binding" and "Catalytic Activity" were the most numerous subcategories within the "Molecular Functions" category.

[0066] 3.4 Functional enrichment of differentially expressed gene KEGG

[0067] KEGG is a major public database for pathways, and significant enrichment of pathways can identify the most important biochemical metabolic and signal transduction pathways involved by genes. In this study, 432 DEGs were classified and annotated in the KEGG database, with "Metabolism" being the most prevalent category. Among them, the "lysosome" and "Autophagy" pathways had the most enriched pathways, each containing 16 DEGs. The three metabolic pathways related to drug metabolism—"ABC transporters," "drug metabolism-other enzymes," "drug metabolism-cytochrome P450," and "Metabolism of xenobiotics by cytochrome P450"—contained 5, 7, 4, and 5 DEGs, respectively. These DEGs may be involved in the metabolism of thiamethoxam by the citrus psyllid.

[0068] 3.5 Statistical analysis of differentially expressed genes related to metabolism

[0069] Insects have evolved mechanisms to break down or inhibit drugs before they act on their targets using detoxification enzymes and transport proteins. The main detoxification enzymes include P450s, CCEs, and GSTs; the main transport proteins include ABCs and UGTs. In this study, based on RNA sequencing results, a total of 28 genes related to detoxification metabolism were identified, including 17 P450s genes, 2 ESTs genes, 1 GST gene, 2 UGTs genes, and 6 ABCs genes.

[0070] 3.6 RT-qPCR Validation of Differential Expression of Detoxification Enzyme Genes

[0071] To verify the accuracy of the transcriptome sequencing results and further confirm the expression levels of detoxification enzyme-related genes, sequence alignment and analysis were performed on differentially expressed detoxification enzyme genes. We selected eight P450 genes, one CarE gene, and one GST gene for RT-qPCR analysis (Table 2). The experimental results are as follows: Figure 1As shown, compared with the susceptible population SS, the seven P450s genes DcitCYP6K3, DcitCYP301a2, DcitCYP4V1, DcitCYP4g6, DcitCYP313b1, DcitCYP15A4, and DcitCYP4C41 were upregulated by 2.13-fold, 2.52-fold, 2.69-fold, 1.21-fold, 1.74-fold, 1.64-fold, and 1.33-fold, respectively, in the resistant population THRS; the DcitCYP4C30 gene was downregulated by 6.46-fold in the THRS. Compared with the susceptible population SS, the CCEs gene DcitCCE32 was upregulated by 1.54-fold in the resistant strain THRS; and the GST gene DcitGSTD1 was upregulated by 1.40-fold in the resistant strain THRS.

[0072] Table 2. Statistical Table of Detoxification Enzyme Gene Information

[0073]

[0074]

[0075] Example 2: Bioassay and Synergistic Effect Test of Thiamethoxam on Citrus Psyllid

[0076] 1. Materials and Reagents

[0077] 1.1 Test insect source

[0078] The laboratory-sensitive population (SS) and the thiamethoxam-resistant population (THRS) were the same as in Example 1.

[0079] 1.2 Main Reagents

[0080] 97% Thiamethoxam Technical Grade (Liuzhou Huinong Chemical Co., Ltd.)

[0081] Diethyl maleate (DEM), piperonyl butyl ether (PBO), and triphenyl phosphate (TPP) were all purchased from Sigema, Inc., USA.

[0082] 2 methods

[0083] 2.1 Bioassay

[0084] The toxicity of thiamethoxam to adult citrus psyllids was determined using the glass tube biofilm method, an improvement upon the in-bottle bioassay method of Kanga and Chen (Chen et al., 2017; Kanga et al., 2016). All experiments used adult citrus psyllids (male and female) approximately one week after emergence. First, the thiamethoxam technical grade (97%) was diluted with acetone to a concentration of 1000 mg / L. -1As a stock solution, based on the preliminary experimental results, the stock solution was diluted to 5-6 concentrations of thiamethoxam solution, and each solution was prepared and used immediately. Then, using a pipette, 200 μL of the thiamethoxam-acetone dilution or acetone (control) was added to a clean, dry 20 mL flat-bottomed glass tube (1.5 cm in diameter, 8 cm in height). The tube was then quickly laid flat and rolled on a table until the acetone evaporated and a uniform film of the drug formed on the inner wall. Next, 15-20 citrus psyllids were gently blown into the glass tube using a pipette. The tube opening was sealed tightly with nylon mesh (100 mesh) and a rubber band, and the tube was placed flat in an artificial incubator (temperature: 26±1℃, light conditions: 14L:10D, humidity: 70-85%). The mortality rate was recorded after 5 hours. A citrus psyllid was considered dead if its legs did not move when gently touched with a soft brush. Each concentration was repeated three times.

[0085] 2.2 Synergist Experiment

[0086] Because citrus psyllids exhibit high resistance to thiamethoxam, the synergistic effects of triphenyl phosphate (TPP), an inhibitor of esterase, diethyl maleate (DEM), an inhibitor of glutathione S-transferase, and piperonyl butyl ether (PBO), an inhibitor of multifunctional oxidase, on the efficacy of thiamethoxam in susceptible and resistant populations were determined. A 100 mg / L solution was prepared using acetone as the organic solvent. -1 The synergist stock solution was diluted into 3-5 concentration gradients; similarly, 1000 mg·L -1 The thiamethoxam stock solution was diluted to 5-6 concentrations as needed. Preliminary experiments were conducted. This method is an improvement upon the leaf-dipping method of Naeem and Tian (Naeem et al., 2019; Tian et al., 2016), and the method is as follows:

[0087] First, measure 20-50 mL of ultrapure water into a 250 mL Erlenmeyer flask using a graduated cylinder. Weigh 0.2-0.5 g of agar and add it to prepare a 1% agar mixture. Heat the mixture in an oven for 2 minutes to completely dissolve the agar. After cooling to room temperature, add 10 mL of this solution to a 90 mm diameter disposable plastic petri dish and allow it to stand at room temperature until the agar solidifies. Next, wash fresh citrus leaves (of similar size) with ultrapure water, air dry them, and then cut off the petioles and halve the leaves along the midrib. Immerse the leaves in synergist solutions of different concentrations for 30 seconds. Remove the leaves with tweezers and place them face down on a clean, inverted 20 mm diameter glass petri dish. Use a pipette to apply 200 μL of the corresponding concentration of synergist solution evenly to the underside of the leaves. After air drying at room temperature, place the treated leaves face down on an agar bed (covering at least 85% of the total petri dish area). Finally, 25 adult citrus psyllids were placed in 1.5 mL centrifuge tubes and frozen in an ice box for 60-90 seconds until stunned. They were then quickly transferred to petri dishes using a short-bristled brush, covered, and sealed with a cross-shaped sealing film to ensure sufficient oxygen and prevent escape. Acetone treatment was used as a control. Each synergist concentration was repeated three times. The petri dishes were placed in an artificial climate chamber at 26±2℃, 75±5% humidity, and a light ratio of 16:8 (L:D) for 48 hours. The mortality rate of citrus psyllids under different synergist concentrations was observed and statistically analyzed to select the optimal synergist concentration. The toxicity of surviving adults was then determined using the film-based method to investigate the effectiveness of the synergist.

[0088] Based on preliminary experiments, the highest concentration of the three synergists was selected as 20 mg·L⁻¹. -1 After 48 hours, the mortality rate was not significantly different from the control group. However, toxicity testing revealed a significant increase in mortality among adults that had ingested leaves containing the synergist. The synergistic effect of the synergist was determined using the same method as in the preliminary experiment. Finally, the LC-125 assay was performed without the synergist. 50 LC using synergists 50 Calculate the synergistic ratio (SR).

[0089] 1.2 Data Analysis

[0090] The experimental results were processed using PoloPlus, and the median lethal concentration (LC50) was calculated. 50 The reasonableness of the results is evaluated using values ​​such as degrees of freedom (df), 95% confidence interval, and chi-square value, and then the LC of the resistant population is used. 50 / LC of sensitive populations 50 Calculate the resistance ratio (RR).

[0091] 3 Results

[0092] Table 3 shows the LC50 of thiamethoxam against SS and THRS strains of citrus psyllids. 50 The values ​​were 0.22 mg·L. -1 and 15.59 mg·L -1 The resistance fold was 70.86-fold. The esterase activity inhibitor TPP reduced the LC50 of both the SS and THRS populations. 50 Reduced to 0.15 mg·L⁻¹ -1 and 9.92 mg·L -1 The synergistic effects were 1.46-fold and 1.57-fold, respectively. The glutathione S-transferase activity inhibitor DEM reduced the LC50 of both the SS and THRS populations. 50 Reduced to 0.16 mg·L⁻¹ -1 and 10.44 mg·L -1 The inhibitors PBO, a multifunctional oxidase inhibitor, showed synergistic effects of 1.38-fold and 1.49-fold, respectively. PBO reduced the LC ratios of the SS and THRS populations. 50 Reduced to 0.14 mg·L -1 and 7.81 mg·L -1 The synergistic effects were 1.57 times and 2.00 times, respectively. Preliminary toxicity assays demonstrated that P450 plays a dominant role in the resistance of citrus psyllids to thiamethoxam.

[0093] Table 3. Toxicity of thiamethoxam to citrus psyllid SS and THRS

[0094]

[0095] Example 3: Enzyme activity assay of citrus psyllid-sensitive and thiamethoxam-resistant strains

[0096] 1. Materials and Reagents

[0097] 1.1 Test insect source

[0098] Laboratory-susceptible populations (SS) and thiamethoxam-resistant populations (THRS) were treated simultaneously.

[0099] 1.2 Main Reagents

[0100] 7-Ethoxycoumarin and 7-hydroxycoumarin were purchased from Sigema, Inc., USA.

[0101] CarE activity assay kits (BC0845) and GST activity assay kits (BC0355) were purchased from Beijing Solarbio Co., Ltd.

[0102] 2 methods

[0103] 2.1 Construction of the standard curve for bovine serum albumin

[0104] The prepared 1000 μg / mL bovine serum albumin (BSA) standard solution was diluted to seven concentration gradients with 0.5 mol / L Tris-HCl (pH 7.5). Samples were added to the microplate: 200 μL of Coomassie Brilliant Blue G-250 solution and 50 μL of different concentrations of BSA solution. 50 μL of 0.5 mol / L Tris-HCl (pH 7.5) was added to the control wells. Each group was repeated three times. After incubation at 37℃ for 10 min, the absorbance at 595 nm was measured using a microplate reader. Finally, a standard curve of BSA was plotted with the concentration of BSA (μg / mL) on the x-axis and the difference in OD values ​​between the treatment group and the control group (ΔOD) on the y-axis. Details of the establishment of the BSA standard curve are shown in Table 4.

[0105] Table 4. Reaction system for bovine serum albumin standard curve

[0106]

[0107] 2.2 Protein content determination

[0108] The protein content in the crude enzyme solution was determined according to Bradford's Coomassie Brilliant Blue method (Bradford, 1976). 200 μL of Coomassie Brilliant Blue G-250 solution and 50 μL of the crude enzyme solution to be tested were added to an ELISA plate. A control group was prepared by adding 50 μL of 0.5 mol / L Tris-HCl (pH 7.5) solution. The experiment was performed in triplicate. After reacting at 37°C for 10 min, the absorbance at 595 nm was measured using an ELISA reader. The protein content in the crude enzyme solution was calculated using a bovine serum albumin (BSA) standard curve.

[0109] 2.3 Assay of Specific Activity of Cytochrome P450 Oxidase

[0110] Preparation of crude enzyme solution: Fifty adult citrus psyllids were placed in a 1.5 mL enzyme-free (DNase / RNase-free) centrifuge tube. 1 mL of 0.1 mol / L phosphate buffer (containing 0.5 mol / L DTT, 0.1 mol / L PMSF, 0.1 mol / L EDTA, and 10% glycerol) was added. The mixture was homogenized on ice using a vibratory grinder. The homogenate was then centrifuged at 14000 × g for 20 min at 4 °C. The supernatant was transferred to a new 1.5 mL enzyme-free centrifuge tube and immediately placed on ice for subsequent experiments. Adult citrus psyllids of susceptible strains were used as controls, with three replicates per group.

[0111] Enzyme activity assay: The specific activity of cytochrome P450 oxidase in susceptible and field-resistant populations of citrus psyllids was determined using 7-ethoxycoumarin as the reaction substrate, with slight modifications to the method of Tang Tao and Bass (Tang Tao, 2019; Bass et al., 2011). In a 1.5 mL centrifuge tube, 365 μL of 0.1 mol / L pH 7.5 phosphate buffer, 5 μL of 40 mmol / L 7-ethoxycoumarin, 10 μL of 10 mmol / L NADPH, and 120 μL of the enzyme solution were added sequentially. After shaking for 15 min at 30 °C, the reaction tube was immediately transferred to ice, and the reaction was terminated by adding 300 μL of 15% trichloroacetic acid (TCA). Centrifuge the mixture after terminating the reaction at 15000×g for 2 min, and collect as much of the supernatant as possible. Add 100 μL of the supernatant to a 96-well microplate, along with 50 μL of 1.6 mol / L glycine-sodium hydroxide (Gly-NaOH) at pH 11.5. Detect the 7-hydroxycoumarin content using a Thermo Varioskan Flash fluorescent microplate reader with excitation wavelength of 358 nm and emission wavelength of 456 nm. Each treatment is repeated three times. Construct a standard curve using 7-hydroxycoumarin standards, and convert the fluorescence intensity values ​​to nmol 7-hydroxycoumarin.

[0112] Construction of the 7-hydroxycoumarin standard curve: Using phosphate buffer as a control, 0.01 mmol / L of 7-hydroxycoumarin was diluted with phosphate buffer, and 100 μL of 100 L Ly-NaOH was added. After mixing, the OD values ​​were measured immediately. The actual content of 7-hydroxycoumarin was plotted on the x-axis, and the difference between the OD values ​​of the treatment group and the control group (ΔOD) was plotted on the y-axis. The establishment of the 7-hydroxycoumarin standard curve is detailed in Table 5.

[0113] Specific activity calculation: Specific activity = (Cproduct × Vtotal) / (T × Pro)

[0114] Cproduct is the product concentration (nmol), Vtotal is the total reaction volume (μL), T is the reaction time (min), and Pro is the protein content (mg).

[0115] Table 57 Reaction system for the standard curve of 7-hydroxycoumarin

[0116]

[0117] 2.4 Determination of the specific activities of carboxylesterase and glutathione S-transferase

[0118] Preparation of crude enzyme solution: Fifty adult citrus psyllids were placed in 1.5 mL enzyme-free centrifuge tubes, and 1 mL of 0.1 mol / L phosphate buffer (pH 7.5) was added. The mixture was homogenized on ice using a vibratory grinder, and then centrifuged at 14000 × g for 20 min at 4°C. The supernatant was transferred to a new 1.5 mL enzyme-free centrifuge tube and immediately placed on ice for subsequent experiments. Adult citrus psyllids of susceptible strains were used as controls, with three replicates per group.

[0119] The preparation method for crude cytochrome P450 oxidase was basically the same as that for crude esterase and glutathione S-transferase, except that the latter two used phosphate buffer (pH 7.5) without any other mixtures. Their activities were determined and calculated according to the instructions of Solarbio's carboxylesterase (CarE) activity assay kit and glutathione S-transferase (GST) activity assay kit.

[0120] 3 Results

[0121] The regression equation for bovine serum albumin is y = 0.0037x + 0.1014, R0 2 =0.9991, suitable as a standard curve for calculating protein content. The regression equation for 7-hydroxycoumarin is y = 413.8x + 44.169, R0 = 0.9991. 2 =0.9965, which is suitable as a standard curve for calculating the amount of 7-hydroxycoumarin produced.

[0122] To further understand and determine the role of detoxification enzymes in insecticide resistance, the crude enzyme specific activities of P450s, CarEs, and GSTs in citrus psyllid SS and THRS populations were determined. The results are as follows: Figure 2 As shown, there are significant differences in the activities of the three detoxification enzymes between the SS and THRS populations. The activities of P450s, CarEs, and GSTs in the THRS population are 1.71 times, 1.37 times, and 1.33 times higher than those in the SS population, respectively.

[0123] Example 4: Spatiotemporal expression pattern analysis of the P450 gene in citrus psyllids

[0124] 1. Materials and Reagents

[0125] 1.1 Test insect source

[0126] The laboratory-sensitive population (SS) and the thiamethoxam-resistant population (THRS) were the same as in Example 1.

[0127] 1.2 Main Reagents

[0128] 97% Thiamethoxam technical powder (Liuzhou Huinong Chemical Co., Ltd.)

[0129] 2 methods

[0130] 2.1 Sample collection from different tissues of the citrus psyllid

[0131] One hundred adult citrus psyllids, aged 5-7 days, were collected from the SS and THRS strains of the citrus psyllid. Before dissection, they were placed on an ice box for 30-60 seconds to stun them, then immersed in 70% alcohol for 20-30 seconds and rinsed three times with sterile water. The psyllids were then transferred to a dissection tray containing pre-chilled PBS, and the various tissues were dissected under a stereomicroscope. Finally, the head, epidermis, midgut, Malpighian tubules, fat body, testes, and ovary were collected by forceps into 1.5 mL enzyme-free centrifuge tubes, rapidly frozen in liquid nitrogen, and stored at -80°C for subsequent use. Three biological replicates were set up for each sample.

[0132] 2.2 Sample collection from different developmental stages of the citrus psyllid

[0133] Female citrus psyllids about to lay eggs (yellow abdomen) were selected from the SS and THRS strains and transferred to new cages. They were reared on Murraya paniculata shoots containing tender shoots. After 7-10 days of rearing and egg laying, all adults were removed. The tender shoots containing eggs were cut off, and 1000-1200 eggs were observed and collected using a stereomicroscope and forceps. The remaining eggs were left to develop in the cages, and nymphs of different instars were collected promptly: 800-1000 first-instar nymphs, 600-800 second-instar nymphs, 300-500 third-instar nymphs, 100-200 fourth-instar nymphs, 50 fifth-instar nymphs, and 30 adults were collected, with three biological replicates per group. All samples were collected into 1.5 mL enzyme-free centrifuge tubes, rapidly frozen in liquid nitrogen, and stored at -80°C for later use.

[0134] 2.3 Sample collection induced by pesticides on citrus psyllids

[0135] Under pesticide stress, pests can enhance their detoxification and metabolic capacity by upregulating the expression of toxic enzyme genes, thereby better adapting to the environment. To investigate the effects of pesticides on the expression of four P450 upregulated genes, the glass tube film method was used to stress resistant citrus psyllids with thiamethoxam. This method was improved based on previous studies (Tiwari et al., 2011; Yu and Killiny, 2018). Similar to the bioassay method, the difference was that citrus leaves were immersed in acetone-thiamethoxam for 30 seconds, dried, and then placed in a glass tube with a film of pesticide on the inner wall. Based on the bioassay results, LC-120 analysis was performed. 30 (10.30 mg·L) -1 ), LC 50 (15.59 mg·L) -1 ), / LC 70 ((23.58mg·L -1Adult citrus psyllids were treated with different dosages of pesticide for 1 h, 2 h, 4 h, 12 h, and 24 h, with 25 citrus psyllids per treatment. Acetone treatment was used as a control, and each treatment was performed in triplicate. At each time point, surviving adults were collected in 1.5 mL enzyme-free centrifuge tubes, rapidly killed with liquid nitrogen, and then stored at -80°C for subsequent use.

[0136] 2.4 Real-time quantitative PCR

[0137] RNA was extracted from all the collected samples to synthesize first-strand cDNA.

[0138] Using all obtained cDNA samples as templates, the relative expression levels of 24 genes (DCCYP6K3, DCCYP4V1, DCCYP15A4, and DCCYP301a2) under different developmental stages, tissues, and concentrations of thiamethoxam were analyzed by real-time quantitative PCR. Primer sequences for the four P450 genes are shown in Table 1. The quantitative PCR reaction methods and conditions were the same as before.

[0139] 3 Results

[0140] 3. Expression patterns of 14 P450 genes in different tissues

[0141] The expression patterns of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 in different tissues of THRS were detected by RT-qPCR. The results showed (e.g.) Figure 3 Among the various DcitCYP gene expression levels, DcitCYP6K3 was lowest in the ovary and highest in the Malpighian tubules (9287.94 times higher than in the ovary), followed by the midgut and head (3414.17 times and 12.87 times higher than in the ovary, respectively). DcitCYP4V1 was lowest in the head and highest in the testes (47.97 times higher than in the head), followed by the Malpighian tubules and fat body (32.29 times and 28.22 times higher than in the head, respectively). DcitCYP15A4 was lowest in the ovary and highest in the testes (77.35 times higher than in the ovary), followed by the Malpighian tubules and midgut (18.67 times and 13.23 times higher than in the ovary, respectively). DcitCYP301a2 was lowest in the midgut and highest in the fat body (19.17 times higher than in the midgut), followed by the epidermis and testes (7.97 times and 7.65 times higher than in the midgut, respectively).

[0142] 3. Expression patterns of 24 P450 genes at different developmental stages

[0143] The expression patterns of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 at different developmental stages of THRS were detected by RT-qPCR. The results showed (e.g.) Figure 3 These four P450 genes (EH) are expressed at every developmental stage. From the egg stage to the adult stage, the expression levels of DcitCYP6K3 and DcitCYP15A4 show a trend of first increasing and then decreasing with increasing larval stage, while the expression levels of DcitCYP4V1 and DcitCYP301a2 show a trend of first decreasing, then increasing, and then decreasing again. DcitCYP6K3, DcitCYP15A4, and DcitCYP301a2 are expressed most abundantly in nymphs. The expression levels of DcitCYP6K3 in second-instar nymphs, DcitCYP15A4 in third-instar nymphs, and DcitCYP301a2 in fourth-instar nymphs are 12.82 times, 30.42 times, and 30.60 times that of adults, respectively. The expression level of DcitCYP4V1 was highest in the adult stage, followed by the fourth instar nymphs, which were 5.19 times and 4.07 times higher than those in the first instar nymphs, respectively.

[0144] The ORF sequences of genes DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 are shown in SEQ ID NO.25, 26, 27 and 28, respectively.

[0145] 3. Responses of 34 P450 genes to different concentrations of insecticides

[0146] To further investigate the relationship between thiamethoxam and four P450 genes, we used three concentrations (LC) 30 (10.30 mg·L) -1 ), LC 50 (15.59 mg·L) -1 ), / LC 70 ((23.58mg·L -1 Thiamethoxam was used to induce THRS populations of citrus psyllids, and the expression patterns of the corresponding genes were determined at 1h, 2h, 4h, 12h and 24h after treatment.

[0147] The results are as follows Figure 4 As shown:

[0148] LC 30After concentration treatment, compared with the control group, the expression level of DcitCYP6K3 was significantly upregulated by 2.05-fold, 1.42-fold, and 1.54-fold at 1 h, 2 h, and 4 h, respectively; DcitCYP4V1 showed significant upregulation at all treatment times, increasing by 1.48-fold, 3.08-fold, 1.78-fold, 1.66-fold, and 1.62-fold, respectively; the expression patterns of DcitCYP15A4 and DcitCYP301a2 were similar to those of DcitCYP6K3. The expression level of DcitCYP15A4 was significantly upregulated by 2.25-fold, 1.29-fold, and 1.19-fold at 1 h, 2 h, and 4 h, respectively; the expression level of DcitCYP301a2 was significantly upregulated by 1.48-fold, 1.57-fold, and 1.24-fold at 1 h, 2 h, and 4 h, respectively. Figure 4 AD).

[0149] LC 50 After concentration treatment, compared with the control group, the expression levels of DcitCYP6K3 were significantly upregulated at 1h, 2h, 4h, and 12h, increasing by 6.62-fold, 4.10-fold, 1.60-fold, and 1.85-fold, respectively; the expression levels of DcitCYP4V1 were significantly upregulated at 1h, 2h, 4h, and 24h, increasing by 3.26-fold, 2.31-fold, 1.31-fold, and 1.14-fold, respectively; the expression pattern of DcitCYP15A4 was similar to that of DcitCYP6K3, upregulated at 1h, 2h, 4h, and 12h, increasing by 2.93-fold, 1.81-fold, 1.44-fold, and 1.23-fold, respectively; and the expression levels of DcitCYP301a2 were upregulated at 1h, 2h, 12h, and 24h, increasing by 2.95-fold, 1.31-fold, 1.31-fold, and 1.14-fold, respectively. Figure 4 EH).

[0150] In LC 70 Under treatment with thiamethoxam at the specified doses, compared with the control group, the expression of all four P450 genes was upregulated to varying degrees at each time point. The expression level of DcitCYP6K3 was significantly upregulated by 3.70-fold, 6.09-fold, 3.61-fold, 1.22-fold, and 1.39-fold at 1 h, 2 h, 4 h, 12 h, and 24 h, respectively; the expression level of DcitCYP4V1 was significantly upregulated by 1.26-fold, 2.34-fold, 4.29-fold, 1.26-fold, and 1.50-fold at 1 h, 2 h, 4 h, 12 h, and 24 h, respectively; D... The expression levels of citCYP15A4 were significantly upregulated by 3.70-fold, 2.50-fold, 3.00-fold, 1.22-fold, and 1.45-fold at 1 h, 2 h, 4 h, 12 h, and 24 h, respectively; the expression levels of DcitCYP301a2 were significantly upregulated by 4.80-fold, 4.09-fold, 2.35-fold, 1.48-fold, and 1.42-fold at 1 h, 2 h, 4 h, 12 h, and 24 h, respectively. Figure 4 IL).

[0151] Example 5: Sensitivity to thiamethoxam after P450 gene silencing

[0152] 1. Materials and Reagents

[0153] 1.1 Test insect source

[0154] The laboratory-sensitive population (SS) and the thiamethoxam-resistant population (THRS) were the same as in Example 1.

[0155] 1.2 Main Reagents

[0156] 97% Thiamethoxam technical powder (Liuzhou Huinong Chemical Co., Ltd., China);

[0157] ChamQ TM Universal qPCR Master Mix: Nanjing Novizan (China);

[0158] HiScript III RT SuperMix for qPCR (+gDNAwiper): Nanjing Novizan (China);

[0159] III 1st Strand cDNA Synthesis Kit: Nanjing Novizan (China);

[0160] TranscriptAid T7 High Yield Transcription Kit: Thermo Fisher Scientific, USA.

[0161] 2 methods

[0162] 2.1 Cloning of the target gene and recovery of the target fragment

[0163] Total RNA extraction from citrus psyllids: 20 citrus psyllids were collected, and RNA was extracted according to ReliaPrep. TM RNATissue MiniprepSystem RNA Extraction Instructions

[0164] Synthesis of first-strand cDNA from the citrus psyllid: Using extracted RNA as a template, and utilizing... The first-strand cDNA was reverse transcribed and synthesized from the first-strand cDNA of the citrus psyllid using the III 1st Strand cDNA Synthesis Kit (+gDNAwiper)(vazyme).

[0165] Primers for RNAi were designed and synthesized using Primer 6 software, with the enhanced green fluorescent protein eGFP gene (Genbank: CAA58789.1) as a control. After the primers were designed, the T7 promoter sequence was added to the 5' end. The primer sequences are shown in Table 6.

[0166] Table 6. RNAi primer sequence information

[0167]

[0168] Using the synthesized cDNA as a template, PCR was performed using 2×Phanta Max Master Mix (vazyme) to amplify the target fragment. The following reaction mixture was added to the PCR tube:

[0169]

[0170] After mixing and centrifuging, proceed with the following reaction procedure on a PCR instrument:

[0171]

[0172] The reaction products were detected by 1% agarose gel electrophoresis (with blue dye added), and the target DNA band was purified and recovered using the FastPure GelDNAExtraction Mini Kit (Vazyme).

[0173] 2.2 Ligation and Transformation of Target Fragment and Vector

[0174] The restriction enzyme sites of the four target genes were analyzed using Bioxm v2.7 software. Based on the restriction enzyme sites on the pCold II vector, the pCold II vector was double-digested using KpnI and PstI. The following reaction mixture was then added to ice:

[0175]

[0176] After the reaction, the reaction product was detected by 1% agarose gel electrophoresis (with blue dye added) (120V, 30min). The target band was purified and recovered using the FastPure Gel DNAExtraction Mini Kit (Vazyme). Following the instructions of the ClonExpress Ultra One Step Cloning Kit V2 (C116) (Vazyme), the reaction mixture for ligating the vector and the target fragment was prepared on ice.

[0177] Immediately after the reaction, the cells were placed on ice to undergo DH5α competent cell conversion.

[0178] 2.3 Detection of recombinant plasmids

[0179] Pick 3-5 single colonies from a 2.2 μL plate and transfer them to a 1.5 mL centrifuge tube containing 1 mL of LB medium and antibiotics. Use 2 μL of this sample as a template for PCR amplification. Incubate the remaining bacterial culture at 37°C and 200 rpm for 4-6 hours. Detect the colonies by gel electrophoresis. If the colonies are positive, send them to Chongqing Qingke Biotechnology for sequencing.

[0180] 2.4 Extraction of recombinant plasmids

[0181] Take 100 μL of the correctly sequenced bacterial culture and add it to a 10 mL glass tube containing antibiotics. Incubate overnight at 37°C with shaking at 200 rpm. Extract plasmids using the EndoFree Mini Plasmid Kit II.

[0182] 2.5dsRNA Synthesis and Purification

[0183] Using the plasmid extracted in section 2.4 as a template, PCR products were amplified using the primers in Table 6. The recovered plasmids were then used as templates for dsRNA synthesis. Using the eGFP (Genbank: CAA58789.1) gene primers as a control, dsRNA was synthesized using the TranscriptAid T7 High Yield Transcription Kit.

[0184] The product obtained above was purified to obtain dsRNA, which was then stored at -80°C for later use.

[0185] The dsRNA sequence of the DcitCYP6K3 gene is shown in bases 344 to 845 of the sequence shown in SEQ ID NO.25; the dsRNA sequence of the DcitCYP4V1 gene is shown in bases 1096 to 1523 of the sequence shown in SEQ ID NO.26; the dsRNA sequence of the DcitCYP15A4 gene is shown in bases 391 to 805 of the sequence shown in SEQ ID NO.27; and the dsRNA sequence of the DcitCYP301a2 gene is shown in bases 708 to 1206 of the sequence shown in SEQ ID NO.28.

[0186] 2.6 Feeding dsRNA

[0187] Gene silencing in adult citrus psyllids was achieved using a film feeding method (Tang et al., 2021), as follows:

[0188] (1) Starvation treatment of citrus psyllids: Collect citrus psyllids into a cage (30×30×30cm3) without Murraya paniculata and place it in an incubator for 5-6 hours.

[0189] (2) Preparation of artificial feed: The artificial feed contains 20% sucrose, 0.1% green food dye and 0.4% yellow food dye (Yu and Killiny, 2018).

[0190] (3) Fabrication of the feeding device: Parafilm membrane was cut into small pieces and then gently stretched to its thinnest possible (so that the mouthparts of the citrus psyllid could pierce it). It was laid flat on one side of an acrylic tube (15 mm inner diameter, 20 mm thickness, 60 mm height). 100 μL of artificial feed mixed with dsRNA was dripped onto the membrane using a pipette. Then, another layer of Parafilm membrane was used to wrap the membrane, distributing the artificial feed on the surface of the tube opening. Fifteen starved psyllids were transferred from the other side of the tube opening into the tube, and a sponge wrapped in black cloth was inserted. 150 μL of sterile water was added to the sponge to keep it moist (Pan et al., 2024). The insects were fed for 72 h, and live insects were collected to test the silencing efficiency and sensitivity to thiamethoxam. Three biological replicates were set up, using dseGFP as a control. Based on the preliminary experiment, a dsRNA concentration of 1000 ng / μL was found to provide better silencing efficiency after 72 h of feeding.

[0191] 2.7 Silencing efficiency and pesticide susceptibility testing

[0192] Silencing efficiency test: Live citrus psyllid adults were collected from section 2.6, with those fed dseGFP as a control. RNA was extracted and reverse transcribed into cDNA. The expression level of the target gene was detected by RT-qPCR to evaluate the effectiveness of RNAi.

[0193] Insecticide susceptibility testing: Live adult citrus psyllids were collected from 2.6, with those fed dseGFP as a control. The LC50 concentration of the two populations was used as the detection concentration to determine the mortality rate of citrus psyllids after the target gene was silenced. The bioassay method was the same as in Example 2.

[0194] 3 Results

[0195] 3.14 P450 gene silencing efficiency

[0196] To investigate the relationship between overexpression of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 and thiamethoxam resistance, we silenced these genes using RNAi and then used thiamethoxam bioassays to assess their roles in thiamethoxam resistance. RT-qPCR results showed no significant difference in the expression levels of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 after treatment with artificial feed containing dsRNA (H2O is used as a substitute in the figure) and dseGFP treatment for 48 h and 72 h. Figure 5 Treatment with dsRNA corresponding to the four P450 genes effectively silenced all four genes. Furthermore, treatment for 72 hours showed better silencing efficiency compared to 48 hours of dsRNA treatment. After 48 hours of dsRNA silencing treatment, compared to the dseGFP control, the expression levels of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 were significantly decreased, by 34.44%, 26.75%, 20.32%, and 22.38%, respectively. Figure 6 AD); After 72 h of dsRNA silencing treatment, compared with the control fed dseGFP, the expression levels of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 were significantly decreased, by 45.41%, 37.61%, 34.29%, and 47.34%, respectively. Figure 6 Therefore, subsequent bioassays were performed by feeding dsRNA for 72 hours.

[0197] 3.2 Sensitivity determination to thiamethoxam after P450 gene silencing

[0198] Two populations of citrus psyllids, SS and THRS, were treated with dsRNA for 72 h. Active adults were then collected to determine the susceptibility of citrus psyllids to thiamethoxam. Bioassays showed that silencing DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2, respectively, increased the mortality rate of SS by 25.17%, 19.62%, 20.17%, and 23.00% compared to the control. Figure 6 The mortality rates of IL, THRS, and IL increased by 28.42%, 21.15%, 22.46%, and 26.15%, respectively. Figure 6 These results indicate that silencing of four P450 genes increases the susceptibility of citrus psyllids to thiamethoxam.

Claims

1. Application of molecular markers in the classification of thiamethoxam-susceptible and resistant populations of citrus psyllids, wherein the molecular markers are as shown in SEQ ID NO.

28. DcitCYP301a2 Gene.

2. The application according to claim 1, characterized in that: The expression levels of the molecular marker genes described in claim 1 of the citrus psyllid to be tested are detected. If the expression level of the molecular marker genes of the citrus psyllid to be tested is significantly higher than that of the sensitive population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam; if there is no significant difference in the expression levels of the molecular marker genes between the citrus psyllid to be tested and the sensitive population, it cannot be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

3. The application according to claim 2, characterized in that: The procedure includes the following steps: extracting total RNA from the citrus psyllid to be tested, reversing it into cDNA, performing qPCR amplification using the cDNA as a template, using a sensitive population as a control, and measuring the expression levels of molecular marker genes in the test subjects. When the expression levels of molecular marker genes in the test subjects are significantly higher than those in the sensitive population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

4. The application according to claim 3, characterized in that: qPCR amplification was performed using primer pairs, the sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.

4.

5. The application according to claim 4, characterized in that: The qPCR amplification reaction system is as follows: 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 1 μL each of 10 μM forward and reverse primers, 4 μL of cDNA template, and ddH2O added to 20 μL. The qPCR amplification conditions were: 95℃ pre-denaturation for 3 min; then 95℃ denaturation for 10 sec, 55℃ annealing for 30 sec, for 40 cycles.

6. DcitCYP301a2 Any of the following applications of the dsRNA of a gene: 1) Application in increasing the susceptibility of citrus psyllids to thiamethoxam or in the preparation of products that increase the susceptibility of citrus psyllids to thiamethoxam; 2) Application in enhancing the control effect of thiamethoxam on citrus psyllids or in the preparation of products that enhance the control effect of thiamethoxam on citrus psyllids; The DcitCYP301a2 The dsRNA sequence of the gene is shown as the sequence of bases 708 to 1206 of the sequence shown in SEQ ID NO.28.