Specific primer, probe and kit for evaluating biomass of Branchiostoma belcheri based on environmental DNA technology and application of specific primer, probe and kit

Abstract

The invention discloses a specific primer, a probe and a kit for evaluating the biomass of Branchiostoma belcheri based on an environmental DNA technology and application of the specific primer, the probe and the kit, and relates to the technical field of biology. The primer comprises an upstream primer F: 5 '-TGGAATTGATTAGTGCCTATGATG-3' as shown in a sequence table SEQ ID NO: 1, a downstream primer R: 5 '-GATAACAGTTCATCAGTCCCC 3' as shown in a sequence table SEQ ID NO: 2, and a probe CCAGCCTCGACAGCAGAAGACCAA as shown in a sequence table SEQ ID NO: 3. The invention further discloses a kit for detecting the content of the According to the method, a standard curve of the Branchiostoma belcheri DNA concentration and the Ct value is successfully drawn by using a fluorescent quantitative PCR method, the eDNA in a water body sample under different Branchiostoma belcheri group density environments is determined, and a mathematical model of the relationship between the Branchiostoma belcheri eDNA concentration and the biomass of the Branchiostoma belcheri eDNA concentration is constructed for the first time; technical support and theoretical basis are provided for evaluation of field Branchiostoma belcheri biomass and population density and investigation of distribution status, grading of field endangered degrees of Branchiostoma belcheri is facilitated, and the method is of great significance to evaluation and protection of the endangered degrees of Branchiostoma belcheri.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to specific primers and probes, a kit and applications thereof for evaluating the biomass of lancelet lancelets based on environmental DNA technology. Background Art

[0002] Environmental DNA (eDNA) is an emerging biological monitoring technology, which refers to the sum of genomic DNA fragments that can be directly extracted from environmental samples (such as soil, water, air, ice cores, etc.). Environmental DNA technology uses molecular biology techniques (such as PCR, high-throughput sequencing, etc.) to conduct qualitative or quantitative analysis of DNA in these environments, and is widely used in biodiversity surveys, species monitoring, animal diet analysis, and alien invasive species detection. Compared with traditional survey methods, eDNA technology has significant advantages such as rapidity, high efficiency, high sensitivity, and no damage to organisms. In recent years, eDNA technology has been widely used in many fields such as biodiversity monitoring, environmental monitoring, aquatic ecosystem management, crime investigation, species tracking and detection, population size estimation, diet research, and paleontology and paleo-ecosystem research.

[0003] The diversity of aquatic organisms has dropped sharply, and the number of endangered species has continued to increase, making the protection of endangered aquatic animals an urgent and important task. The lancelet (Brabchiostoma belcheri) plays an extremely important role in tracing the origin of vertebrates and is an ideal model animal for studies such as evolutionary developmental biology and comparative functional genomics. However, due to the destruction of the living environment and indiscriminate hunting, the number of lancelets has dropped rapidly and is facing extinction.

[0004] Therefore, technicians in this field are committed to finding a new survey method to track the number of lancelets without causing harm to them, so as to carry out subsequent scientifically based reproduction, release and protection measures. Summary of the invention

[0005] The present invention provides a specific primer and probe, a kit and its application for biomass assessment of White's lancelet based on environmental DNA technology, aiming to solve the problems existing in the above-mentioned background technology. By innovatively developing a specific primer and probe combination for the eDNA of White's lancelet, accurate assessment of its biomass is achieved through qPCR technology. This tool combination is efficient and specific, and can quantitatively analyze the eDNA concentration of White's lancelet in different water bodies, and construct a scientific mathematical model based on this to accurately map the dynamic relationship between eDNA concentration and biomass. This invention provides a new perspective and technical support for the field ecological survey, protection strategy formulation and endangered assessment of White's lancelet, which is of great significance to promoting species protection and management.

[0006] In order to achieve the above technical objectives, the present invention mainly adopts the following technical solutions:

[0007] In the first aspect, the present invention discloses a specific primer and probe for biomass assessment of white-breasted lancelet based on environmental DNA technology, wherein the primers include an upstream primer F: 5'-TGGGAATTGATTAGTGCCTATGATG-3', as shown in the sequence table SEQ ID NO: 1, a downstream primer R: 5'-GATAAACAGTTCATCCAGTCCCC-3', as shown in the sequence table SEQ ID NO: 2, and the probe is CCAGCCTCGACAGCAGAAGAAGCCAA, as shown in the sequence table SEQ ID NO: 3.

[0008] In a preferred embodiment of the present invention, the 5' end of the probe SEQ ID NO: 3 is labeled with a reporter fluorescent group FAM, and the 3' end is labeled with a quencher fluorescent group BHQ1.

[0009] In a second aspect, the present invention discloses an application of the specific primers and probes as described in the first aspect in biomass assessment of Amphioxus whitingii.

[0010] In a third aspect, the present invention discloses a kit for evaluating the biomass of Amphioxus whitingii, comprising the specific primers and probes as described in the first aspect.

[0011] In a fourth aspect, the present invention discloses a use of the kit as described in the third aspect in biomass assessment of Amphioxus whitingii.

[0012] In a fifth aspect, the present invention discloses a method for evaluating the biomass of Amphioxus bai'sii based on environmental DNA technology, comprising the following steps:

[0013] Step 1, prepare a DNA standard of Amphioxus bai'sii and calculate its copy number; perform gradient dilution as a template, perform qPCR using the primers and probes in claim 1, and establish a standard curve of DNA concentration and Ct value;

[0014] Step 2, collecting water samples of the biomass of the amphioxus bai's population, extracting environmental DNA and using it as a template for qPCR, and recording the Ct value;

[0015] Step 3: Calculate the environmental DNA concentration based on the standard curve in step 1 and the Ct value in step 2, and establish a relationship curve between environmental DNA and biomass.

[0016] In a preferred embodiment of the present invention, the method for preparing a DNA standard of Amphioxus bai'sii comprises the following steps:

[0017] Step 1.1, extracting DNA from Amphioxus bai'sii, performing PCR amplification using the primers as claimed in claim 1, recovering and purifying the PCR product to obtain a purified DNA product;

[0018] Step 1.2, connecting the purified DNA product to the pMD 19-T plasmid vector, and transforming it into DH5α competent cells to construct the COI-pMD 19-T recombinant plasmid, and culturing;

[0019] Step 1.3, collecting the single bacterial solution cultured in step 1.2, performing PCR amplification using the primers as described in claim 1, and detecting the PCR amplification product by 1% agarose gel electrophoresis, collecting the bacterial solution that meets the target band, and performing expansion culture;

[0020] Step 1.4: Use a plasmid extraction kit to extract plasmid standard DNA from the expanded culture product in step 1.3 to obtain the Amphioxus whitingii DNA standard.

[0021] In a preferred embodiment of the present invention, in step 1, the gradient dilution of the DNA standard is 10 8 -10 1 copies / μL.

[0022] In a preferred embodiment of the present invention, the qPCR reaction system is: 2 μL DNA template, 10 μL 2×Pro TaqHS Probe Premix, 0.4 μL (0.2 μM) of upstream and downstream primers and probes, 6.8 μL ddH2O; the reaction conditions are: 95°C 30s; 95°C 5s, 59°C 30s, for a total of 40 cycles.

[0023] In a preferred embodiment of the present invention, in step 2, the water sample is first filtered using a filter membrane with a pore size of 0.22 μm before extracting environmental DNA.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention successfully uses the fluorescent quantitative PCR method to draw a standard curve of the DNA concentration and the Ct value of the white's amphioxus, and based on this, the eDNA in water samples under different white's amphioxus population density environments is determined. A mathematical model of the relationship between the eDNA concentration and the biomass of the white's amphioxus is constructed for the first time, which provides technical support and theoretical basis for conducting an assessment of the biomass and population density of the white's amphioxus in the wild and an investigation of its distribution status, is conducive to grading the endangered degree of the white's amphioxus in the wild, and is of great significance to the endangered degree evaluation and protection of the white's amphioxus. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The standard curve of the logarithmic concentration and Ct value of the amphioxus plasmid standard is shown in the figure. The curve equation in the figure is: y = -3.3036x + 38.011, the horizontal axis x represents the logarithm of the concentration of the amphioxus plasmid standard after dilution, and the vertical axis y represents the Ct of the corresponding concentration qPCR reaction.

[0027] Figure 2 This is a graph showing the relationship between the eDNA concentration of Amphioxus whitingii and the density of Amphioxus whitingii.

[0028] Figure 3 This is a graph showing the relationship between the eDNA concentration of Amphioxus whitingii and the biomass of Amphioxus whitingii.

[0029] Figure 4 This is a graph showing the relationship between the biomass of L. californica and the density of L. californica. DETAILED DESCRIPTION

[0030] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention. Specific experimental conditions and methods are not specified in the following examples, and the technical means used are generally conventional means known to those skilled in the art.

[0031] The manufacturers of the relevant instruments, reagents and materials used in the following examples are: TCST-9620PCR instrument, QuantStudio TM 1Plus real-time fluorescence quantitative PCR instrument, Mu1Liskam Go 1510 microplate reader, Novezan cell / tissue DNA extraction kit, Novezan gel recovery kit, Novezan plasmid mini-extraction kit, Jinteng diaphragm vacuum pump, Jinteng filtration device and matching filter paper (0.22 μm), Taq HS Probe Mix were purchased from Aikerui Biotechnology Co., Ltd.

[0032] Example 1

[0033] 1. Specific primer and probe design

[0034] qPCR specific primers and probes were designed based on the COⅠ sequence of the mitochondrial DNA gene of Amphioxus baileyi. qPCR specific primers and probes were designed based on the COⅠ sequence of the mitochondrial DNA gene of Amphioxus baileyi. A total of 76 COⅠ gene sequence fragments of 8 species of Amphioxus were downloaded from GenBank: 11 Amphioxus baileyi, 19 Amphioxus japonicus (6 of which may be mislabeled Amphioxus baileyi), 6 Branchiostoma floridae, 24 Branchiostoma lanceolatum, 4 Asymmetron inferum, 6 Asymmetron lucayanum, 3 Epigonichthys cultellus, and 3 Epigonichthys maldivensis. SnapGene software was used to align the sequences, and the conserved sequences of Amphioxus baileyi and Amphioxus japonicus were selected as templates. Species-specific primers and TaqMan probes were designed using Beacon Designer 7 software. The principles of primer design include length, GC content, avoidance of continuous G / C at the 3' end, and no complementary sequence; the probe design should be close to the primer but not overlapping, with a moderate length and a Tm value higher than the primer, and avoid hairpin structure and three base complementarity. The primers and probes were synthesized by Fuzhou Ruizhen Biotechnology Co., Ltd., with FAM connected to the 5' end of the probe and BHQ1 connected to the 3' end.

[0035] The primers and probes designed specifically are:

[0036] Upstream primer F: 5'-TGGGAATTGATTAGTGCCTATGATG-3'; as shown in SEQ ID NO: 1 in the sequence listing;

[0037] Downstream primer R: 5'-GATAAACAGTTCATCCAGTCCCC-3'; as shown in the sequence listing SEQ ID NO: 2;

[0038] TaqMan probe: FAM-CCAGCCTCGACAGCAGAAGAAGCCAA-BHQ1, as shown in the sequence table SEQ ID NO: 3.

[0039] The eDNA primers and probes of Amphioxus bai's were compared with the partial sequences of COX1 of the other seven species of Amphioxus. The results showed that the designed upstream and downstream primers and probes of Amphioxus bai's were completely matched with the gene sequence of Amphioxus bai's. The upstream primer had 5 base differences with Branchiostomafloridae, 3 base differences with Branchiostomajaponicum, 7 base differences with Branchiostoma lanceolatum, 6 base differences with Asymmetron inferum, 4 base differences with Asymmetron lucayanum, 5 base differences with Epigonichthys cultellus, and 5 base differences with Epigonichthys maldivensis (Table 1); the downstream primer had 5 base differences with Branchiostomafloridae, 7 base differences with Branchiostomajaponicum, 2 base differences with Branchiostoma lanceolatum, 5 base differences with Asymmetron inferum, 6 base differences with Asymmetron lucayanum, 4 base differences with Epigonichthys cultellus, and 5 base differences with Epigonichthys maldivensis (Table 1). maldivensis has 5 base differences (Table 2); the probe has 1 base difference with Branchiostomafloridae, 3 base differences with Branchiostoma japonicum, 2 base differences with Branchiostoma lanceolatum, 6 base differences with Asymmetron inferum, 5 base differences with Asymmetron lucayanum, 5 base differences with Epigonichthys cultellus, and 3 base differences with Epigonichthys maldivensis (Table 3).

[0040] Table 1 Alignment results of upstream primers of Amphioxus bai'sii and sequences of seven species of Amphioxus

[0041]

[0042]

[0043] Note: The underline indicates the part that does not match the upstream primer.

[0044] Table 2 Alignment results of the downstream primers of Amphioxus bai'sii and the sequences of seven species of Amphioxus

[0045]

[0046] Note: The underline indicates the part that does not match the downstream primer.

[0047] Table 3 Alignment results of the TaqMan probe of Amphioxus bai'sii and the sequences of seven species of Amphioxus

[0048]

[0049]

[0050] Note: The underline indicates the part that does not match the probe.

[0051] 2. Preparation of standard curve of logarithmic concentration and Ct value of Amphioxus whitingii plasmid standard

[0052] Take muscle tissue of Amphioxus bai'sii, extract DNA of Amphioxus bai'sii according to the instructions of DNA extraction kit, measure DNA concentration with microplate reader, and the concentration of DNA stock solution is 178ng / μL. Run PCR, perform gel electrophoresis, use gel recovery kit to recover and purify PCR products, connect and transform COI-pMD 19-T recombinant plasmid, perform bacterial liquid PCR, and use plasmid mini-extraction kit to extract plasmid standard DNA.

[0053] The specific steps include:

[0054] a. PCR product recovery and purification

[0055] Experimental materials: 1.5mL sterile centrifuge tube, anhydrous ethanol, isopropanol (add 1 times the gel volume of isopropanol when the recovered fragment is ≤100bp), and water bath.

[0056] Preliminary experiment: PCR amplification system is 25μL, including 2×Accurate Taq Master Mix 10μL, ddH2O6.4μL, DNA2μL, forward and reverse primers (COI F / COI R) 0.8μL each. PCR reaction program: 94℃ pre-denaturation for 30s; 94℃ denaturation for 20s, 58℃ annealing for 30s, 72℃ extension for 20s, 35 cycles; 72℃ final extension for 2min. Detect the product by 2% agarose gel electrophoresis. If it can be detected, start the formal experiment.

[0057] Formal experiment: PCR amplification system is 50μL, including 2×Accurate Taq Master Mix 25μL, ddH2O16μL, DNA 5μL, forward and reverse primers (COI F / COI R) 2μL each. PCR reaction program: 94℃ pre-denaturation for 30s; 94℃ denaturation for 20s, 58℃ annealing for 30s, 72℃ extension for 20s, 35 cycles; 72℃ final extension for 2min. Repeat twice. Detect the product by 1% agarose gel electrophoresis. Gel DNA Extraction Mini Kit was used for gel recovery. The specific operation is as follows:

[0058] (1) After DNA electrophoresis, quickly cut the gel containing the target DNA fragment under ultraviolet light, absorb the liquid on the surface of the gel with a paper towel and cut it into pieces, and try to remove the excess gel. Weigh the gel (excluding the weight of the empty tube), 100 mg of gel is equivalent to 100 μL volume, which is considered as a gel volume.

[0059] (2) Add an equal volume of Buffer GDP. Incubate at 50-55°C in a water bath for 7-10 minutes. Adjust the time appropriately according to the size of the gel to ensure that the gel blocks are completely dissolved. Invert and mix twice during the water bath to accelerate the gelation. (Adding 1-3 times the volume of Buffer GDP does not affect the DNA recovery rate. If the DNA fragment is less than or equal to 100 bp, add 3 times the volume of Buffer GDP. After the gelation is completed in a water bath, add 1 times the volume of isopropanol, mix well, and then proceed to step 3.)

[0060] (3) Briefly centrifuge to collect droplets on the tube wall. Place the FastPure DNAMini Columns-G adsorption column in the Collection Tubes 2ml collection tube, transfer ≤700μL of sol to the adsorption column, and centrifuge at 12000rpm (13,400×g) for 30-60sec. If the sol volume is greater than ≤700μL, place the adsorption column back into the collection tube, transfer the remaining sol to the adsorption column, and centrifuge at 12,000rpm (13,400×g) for 30-60sec.

[0061] (4) Discard the filtrate and place the adsorption column in a collection tube. Add 300 μl of Buffer GDP to the adsorption column. Let stand for 1 min. Centrifuge at 12,000 rpm (13,400 × g) for 30-60 sec.

[0062] (5) Discard the filtrate and place the adsorption column in a collection tube. Add 700 μl of Buffer GW (with anhydrous ethanol) to the adsorption column. Centrifuge at 12,000 rpm (13,400 × g) for 30-60 seconds.

[0063] (Please add Buffer GW along the sides of the adsorption column, or cover the column and mix it upside down 2-3 times after adding Buffer GW to help completely wash away the salt adhering to the wall.)

[0064] (6) Repeat step 5. (Rinsing twice with Buffer GW ensures that the salt is completely removed and eliminates the impact on subsequent experiments.)

[0065] (7) Discard the filtrate and place the adsorption column back into the collection tube. Centrifuge at 12,000 rpm (13,400 × g) for 2 min.

[0066] (8) Place the adsorption column in a 1.5 mL sterilized centrifuge tube, add 20-30 μl Elution Buffer to the center of the adsorption column, and place for 2 min. Centrifuge at 12,000 rpm (13,400 x g) for 1 min. Discard the adsorption column and store the DNA at -20°C.

[0067] (If you need to obtain the highest yield, it is recommended to add the obtained solution back to the centrifugal adsorption column and repeat step 8 for secondary elution. When recovering fragments larger than 3kb, it is recommended to preheat the Elution Buffer to 55℃ to improve the recovery efficiency.)

[0068] b. Ligation and transformation of COI-pMD 19-T recombinant plasmid

[0069] Prepare LB liquid medium and LB solid medium in advance.

[0070] Connect the purified DNA product in 1 to the pMD 19-T plasmid vector (TaKaRa), and transform it into DH5α competent cells to construct the COI-pMD 19-T recombinant plasmid. The specific experimental steps are as follows:

[0071] (1) Add the following solutions to a PCR tube in sequence: 1 μL pMD 19-T Vector, 1 μL purified DNA product, 5 μL solution I, 3 μL ddH2O, and ligate at 16°C for 30 min.

[0072] (2) Take 100 μL of Trelief5α competent cells melted on ice and add 10 μL of pUC19 (1 pg / uL, Amp R ), gently blow to mix, and let stand on ice for 5 minutes. Heat shock in 42℃ water bath for 45-60 seconds, quickly transfer to ice bath, and let stand for 2 minutes;

[0073] (3) Add 700 μL of non-resistant LB culture medium to the centrifuge tube, and directly aspirate 80 μL (equivalent to 1 pg plasmid) without recovery and evenly spread it on the Amp-resistant culture medium. Incubate the plate upright in a 37°C incubator for 10 min, and then invert it for 14 h.

[0074] c. Bacterial liquid PCR

[0075] Pick 4 single bacteria from each plate, and add each single bacteria to 1 mL of LB liquid culture medium containing ampicillin. After placing it in a shaker for 5 hours, take 1 μL of bacterial solution for PCR. The PCR reaction uses a 15 μL system, including 5 μL of 2×Accurate TaqMaster Mix, 2 μL of bacterial solution, 0.8 μL of forward and reverse primers (F / R), and 6.4 μL of ddH2O. The PCR reaction program is set as follows: (1) 94℃ pre-denaturation for 30 seconds; (2) 98℃ denaturation for 10 seconds, 59℃ annealing for 30 seconds, 72℃ extension for 1 minute, and amplification for 35 cycles; (3) 72℃ for 2 minutes. The PCR amplification product is detected by 1% agarose gel electrophoresis. The bacterial solution that meets the target band is retained, and the rest is discarded. Take 30 μL of bacterial solution and send it to Xiamen Qingke Biotechnology for sequencing to screen out the bacterial solution of the connection transformation result and then expand the culture. The remaining bacterial solution was reserved as the culture medium and sealed with 100 μL of 60% glycerol.

[0076] d. Preparation of plasmid standard DNA

[0077] Experimental materials: anhydrous ethanol, 1.5mL and 2mL sterile centrifuge tubes, etc.

[0078] According to the sequencing results, the successfully connected and transformed bacterial solution was selected for expansion culture. After shaking culture in a shaker (37°C, 150rpm) for 12-16 hours, the plasmid standard DNA was extracted using the EndoFree Plasmid Mini Kit-BOX2 Vazyme Cat plasmid extraction kit. The specific steps are as follows:

[0079] (1) Column equilibration: Place the FastPure DNAMini ColumnsⅡ column in the Collection Tubes 2mL collection tube. Add 100μL Buffer QB to the FastPure DNAMini ColumnsⅡ column, centrifuge at 12000rpm (13400×g) for 1min, and discard the filtrate (use the column that has been processed on the same day).

[0080] (2) Take 1-5 mL of overnight culture solution and centrifuge at 12000 rpm (13400 × g) for 1 min to collect the cells. Remove the remaining supernatant as much as possible.

[0081] (3) Add 250 μL of Buffer P1 (please check whether RNase A Solution has been added first) and vortex until completely resuspended.

[0082] (4) Add 250 μL Buffer P2, mix gently by inverting up and down 8-10 times, and leave at room temperature for 3 minutes. (This step should be mixed gently, not violently shaken, to avoid genomic DNA contamination. At this time, the bacterial solution should become clear and viscous. The time used should not exceed 5 minutes to avoid plasmid damage. If it does not become clear, it may be due to excessive bacteria and incomplete lysis. The amount of bacteria should be reduced.)

[0083] (5) Add 125 μL of Buffer P5 and immediately and gently invert the tube 12-15 times to completely neutralize Buffer P2. A white flocculent precipitate should appear at this time. Centrifuge at 12000 rpm (13400 × g) for 10 min. (After adding Buffer P5, mix it immediately to avoid local precipitation. The supernatant should be clear after centrifugation. If there is a tiny white precipitate in the supernatant, it will not affect subsequent operations.)

[0084] (6) Transfer the supernatant (about 600 μL) to a new 1.5 mL sterile centrifuge tube (self-prepared), add an equal volume of Buffer ERB, and mix by inverting 10 times. (Buffer ERB reagent is prone to foaming, so avoid vigorous shaking after adding it.)

[0085] (7) Transfer the mixture in step 6 to the FastPure DNA Mini Columns II adsorption column (already placed in the collection tube), centrifuge at 12000 rpm (13400 × g) for 1 min, and discard the filtrate. (The maximum volume of the adsorption column is 750 μL. If the mixture exceeds this volume, please load it onto the column several times.

[0086] (8) Repeat step 7 until all the mixed solution is loaded onto the column.

[0087] (9) Add 500 μL of Buffer ERW to the adsorption column, centrifuge at 12000 rpm (13400 × g) for 1 min, and discard the filtrate.

[0088] (10) Add 500 μL of Buffer PW1 to the adsorption column, centrifuge at 12000 rpm (13400 × g) for 1 min, and discard the filtrate.

[0089] (11) Add 700 μL of Buffer PW2 (please check whether anhydrous ethanol has been added) to the adsorption column, centrifuge at 12000 rpm (13400 × g) for 1 min, and discard the filtrate.

[0090] (12) Place the adsorption column back into the collection tube and centrifuge at 12000 rpm (13400 × g) for 2 min.

[0091] (13) Place the adsorption column in a new 1.5 mL sterile centrifuge tube (self-prepared), and add 30-100 μL Endotoxin-free Elution Buffer to the center of the membrane of the adsorption column. Let stand at room temperature for 1 min, centrifuge at 12000 rpm (13400 × g) for 1 min, and discard the adsorption column. (The elution volume is recommended to be no less than 30 μL. A smaller volume will reduce the elution efficiency. If ddH2O is used for elution, ensure that the pH of ddH2O is in the range of 7.0-8.5. A pH below 7.0 will reduce the elution efficiency. To increase the elution efficiency of the plasmid, the elution solution can be preheated at 65°C.)

[0092] (14) After the plasmid DNA was extracted, its quality and concentration were immediately tested, and its copy number was calculated. Finally, it was diluted 10 8 copies / μL, stored at -80℃ for future use.

[0093] Results The concentration of the plasmid standard was 73.3 ng / μL determined by the microplate reader. The copy number of the plasmid standard was calculated according to the concentration gradient from 10 8 Dilute to 10 copies / μL 1 The plasmid standards that were diluted sequentially were used as the reaction templates for qPCR. Three replicates were set for each concentration, and the standard curve of the logarithmic concentration and Ct value of the plasmid standards of Amphioxus dasyphylus was drawn. The reaction system of qPCR was: 2μL of Amphioxus dasyphylus DNA template DNA, 10μL of 2×Pro Taq HS Probe Mix, 0.4μL of 100nmol / L upstream primer, 100nmol / L downstream primer and 100nmol / L probe, 6.8μL of ddH2O; the reaction conditions were: 95℃30s; 95℃5s, 60℃30s, 40 cycles, and stored at 4℃.

[0094] The results showed that the logarithmic concentration of the standard sample of Amphioxus dasyphyllus plasmid and the Ct value generated a standard curve relationship, the curve equation is: y = -3.3036x + 38.011, where x is the logarithmic concentration of the standard sample of Amphioxus dasyphyllus plasmid, y is the Ct value of the corresponding concentration qPCR reaction, and the logarithmic base is 10. For details, see Figure 1 shown.

[0095] 3. Extraction of eDNA from water

[0096] Table 4 Specific parameters of the biomass, body mass, size, etc. of Amphioxus bai'sii

[0097]

[0098]

[0099] 31 lancelets were selected, and five gradients of 1, 2, 4, 8, and 16 were set, and one blank control was placed in six sterilized glass tanks of the same size. The amount of water added to each glass tank was 5L. Three groups were parallel. During the experiment, they were fed normally, and water samples were collected in 100mL sterilized beakers after 6 days (the first day was biological day 0, and the sixth day was biological day 5). The water samples were filtered through a 0.22μm pore size filter membrane. After filtration, the filter membrane was clamped from the edge with sterile tweezers and placed in a sterile centrifuge tube. The sampling was repeated three times, and the eDNA in the water was extracted according to the instructions of the animal tissue genomic DNA extraction kit. The eDNA concentration was determined by an enzyme marker.

[0100] 4. Relationship between eDNA concentration and density / biomass of Amphioxus whitingii

[0101] qPCR detection was performed using the eDNA of the water in each test group as a template, and the Ct value was recorded. The concentration of the eDNA of each group of Amphioxus dasyphyllus was calculated according to the standard curve of the concentration of the standard plasmid of Amphioxus dasyphyllus and the Ct value, and the eDNA concentration of Amphioxus dasyphyllus and its corresponding biomass of Amphioxus dasyphyllus were plotted into a corresponding curve. The qPCR reaction system was 20 μL: 2 μL of water DNA of Amphioxus bai'sii, 10 μL of 2×Pro Taq HS Probe Mix, 0.4 μL each of 100 nmol / L upstream primer (5'-TGGGAATTGATTAGTGCCTATGATG-3'), 100 nmol / L downstream primer (5'-GATAAACAGTTCATCCAGTCCCC-3') and 100 nmol / L probe (FAM-CCAGCCTCGACAGCAGAAGAAGCCAA-BHQ1), and 6.8 μL of ddH2O; the reaction conditions were: 95°C for 30 s, 95°C for 5 s, 60°C for 30 s, 40 cycles, and stored at 4°C.

[0102] The results showed that there was a linear relationship between the concentration of eDNA and its density: y = 3.825x + 0.7332, R 2 =0.9912( Figure 2 ), the density of Amphioxus bai's eDNA concentration in the water body increased accordingly; the concentration of Amphioxus bai's eDNA was linearly related to the biomass of Amphioxus bai's: y = 85.953x + 1.1949, R 2 =0.9711( Figure 3 ); In addition, the biomass of L. bai'sii is linearly related to the density of L. bai'sii in the water: y = 0.0438x-0.0008, R 2 =0.9941( Figure 4 ).

[0103] The eDNA collection method in eDNA technology adopts the filtration method, which means taking a certain amount of water sample and filtering it through a filter membrane, so that the eDNA is retained on the filter membrane, and the DNA collection amount is achieved by collecting the eDNA on the filter membrane. This experiment used the filtration method to collect water sample eDNA, and found that the amount of water eDNA collected by the filtration method was positively correlated with the density of white lancelet, indicating the feasibility of this method.

[0104] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications are also regarded as the protection scope of the present invention.

Claims

1. A specific primer and probe for biomass assessment of Amphioxus whitingii based on environmental DNA technology, characterized in that: The primers include upstream primer F: 5'-TGGGAATTGATTAGTGCCTATGATG-3', as shown in SEQ ID NO: 1 in the sequence table, downstream primer R: 5'-GATAAACAGTTCATCCAGTCCCC-3', as shown in SEQ ID NO: 2 in the sequence table, and the probe is CCAGCCTCGACAGCAGAAGAAGCCAA, as shown in SEQ ID NO: 3 in the sequence table.

2. The specific primers and probes for biomass assessment of Amphioxus whitingii based on environmental DNA technology according to claim 1, characterized in that: The 5' end of the probe SEQ ID NO: 3 is labeled with a reporter fluorescent group FAM, and the 3' end is labeled with a quencher fluorescent group BHQ1.

3. Use of the specific primers and probes as claimed in claim 1 in biomass assessment of Amphioxus whitingii.

4. A kit for evaluating the biomass of Amphioxus bai'sii, characterized in that: The method comprises the specific primers and probes as described in claim 1.

5. Use of the kit as claimed in claim 4 in biomass assessment of Amphioxus whitingii.

6. A method for evaluating the biomass of Amphioxus bai'sii based on environmental DNA technology, characterized in that: The following steps are involved: Step 1, preparing a DNA standard of Amphioxus bai'sii and calculating its copy number; After gradient dilution, use the primers and probes in claim 1 as a template for qPCR to establish a standard curve between DNA concentration and Ct value; Step 2, collecting water samples with a certain amount of Amphioxus bai's biomass, extracting environmental DNA and using it as a template for qPCR, and recording the Ct value; Step 3: Calculate the environmental DNA concentration based on the standard curve in step 1 and the Ct value in step 2, and establish a relationship curve between environmental DNA and biomass.

7. The method for evaluating the biomass of Amphioxus whitingii based on environmental DNA technology according to claim 6, characterized in that: The method for preparing a DNA standard of Amphioxus bai'sii comprises the following steps: Step 1.1, extracting DNA from Amphioxus bai'sii, performing PCR amplification using the primers as claimed in claim 1, recovering and purifying the PCR product to obtain a purified DNA product; Step 1.2, connecting the purified DNA product to the pMD 19-T plasmid vector, and transforming it into DH5α competent cells to construct the COI-pMD 19-T recombinant plasmid, and culturing; Step 1.3, collecting the single bacterial solution cultured in step 1.2, performing PCR amplification using the primers as described in claim 1, and detecting the PCR amplification product by 1% agarose gel electrophoresis, collecting the bacterial solution that meets the target band, and performing expansion culture; Step 1.4: Use a plasmid extraction kit to extract plasmid standard DNA from the expanded culture product in step 1.3 to obtain the Amphioxus whitingii DNA standard.

8. The method for evaluating the biomass of Amphioxus whitingii based on environmental DNA technology according to claim 6, characterized in that: In step 1, the serial dilution of DNA standard is 10 8 -10 1 copies / μL.

9. The method for evaluating the biomass of Amphioxus whitingii based on environmental DNA technology according to claim 6, characterized in that: The qPCR reaction system is: 2 μL DNA template, 10 μL 2×Pro Taq HS Probe Premix, 0.4 μL (0.2 μM) of upstream and downstream primers and probes, 6.8 μL ddH2O; the reaction conditions are: 95°C for 30 s; 95°C for 5 s, 59°C for 30 s, for a total of 40 cycles.

10. The method for evaluating the biomass of Amphioxus whitingii based on environmental DNA technology according to claim 6, characterized in that: In step 2, the water sample is filtered using a filter membrane with a pore size of 0.22 μm before extracting environmental DNA.

Images