Molecular marker related to leukoderma resistance on corn chromosome 4 and application of molecular marker

Abstract

The invention belongs to the technical field of molecular marker assisted breeding, particularly relates to a molecular marker related to white spot resistance on a corn chromosome 4 and application, and particularly provides the molecular marker related to the corn white spot resistance, the gene of the molecular marker is a Zm00001eb168510 gene and / or a sequence as shown in SEQ ID NO: 1, the CDs sequence of the Zm00001eb168510 gene is as shown in SEQ ID NO: 2, and the CDs sequence of the Zm00001eb168510 gene is as shown in SEQ ID NO: 1. According to the invention, through many years of multi-site experiments, the white spot resistance QTL qMWS4-4 interval and the resistance SNP: 4-14146725 and the associated gene Zm00001eb168510 thereof are jointly localized on the corn chromosome 4, the SNP locus can be localized in different environments through QTL linkage analysis and GWAS association analysis, and 15.14% of phenotypic variation can be explained; the associated candidate functional gene mainly encodes cysteine protease superfamily protein, and a cysteine protease large family contains deubiquitination enzyme which plays an important role in plant development and stress response.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular marker-assisted breeding, and specifically relates to an application of a molecular marker site SNP: 4-14146725 related to white spot disease resistance on maize chromosome 4 and a candidate functional gene Zm00001eb168510 associated therewith in improving maize white spot disease resistance. Background Art

[0002] Maize (Zea mays L.), as a key food crop, directly impacts global food security and the development of animal husbandry. In recent years, maize white spot blight, caused by Pantoea ananatis, is a foliar disease that severely impacts maize production. First reported in India in 1965, the disease became prevalent in Brazil and the United States during the 1980s and 1990s. Severe cases of white spot blight have reportedly reduced maize yields by over 60% in Brazil. Since mid-July 2020, white spot blight has erupted in my country's southwestern maize ecosystem, particularly in Yunnan, resulting in widespread corn yield losses of 10% to 50% in some areas. This has severely impacted maize production and caused a significant drop in farmers' incomes. Since 2023, the disease has spread to the main maize-producing regions in northern China and has now become a nationwide maize disease. In the early stages of the disease, lesions appear on the base of the leaves, rapidly spreading to the upper part of the plant. In the later stages of the disease, the leaves become chlorotic, impacting plant carbon cycling and photosynthesis. If some leaves are infected before the corn filling stage, the net photosynthetic rate may drop sharply by 40%, leading to the premature end of the reproductive maturity stage, and ultimately causing the corn ears to be deformed and the seed rate to be low, seriously reducing the yield and quality of corn.

[0003] At present, the prevention and control of white spot disease mainly focuses on measures such as optimizing field farming systems and the use of agricultural chemicals. Research in recent years has shown that white spot disease resistance depends largely on its genetic factors. Therefore, breeding varieties resistant to white spot disease from a genetic perspective is the most economical and effective way to control the disease. However, since white spot disease is a newly emerging corn disease in my country, functional genes related to white spot disease resistance have not yet been cloned. Based on whole-genome association analysis and QTL mapping, the present invention utilizes tropical corn inbred lines (YML32, TRL418, CML171, TML139, YML226, NK40-1) as resistant parents, hybridizes them with the temperate susceptible excellent inbred line Ye107, and after 9 consecutive generations of single-seed self-pollination, 6 F9 recombinant inbred lines (RILs) were selected. These RILs were planted in Yanshan County, Yunnan Province for three consecutive years to carry out phenotypic identification. Combined with the high-quality SNPs of the RIL population, functional genes significantly associated with corn white spot disease resistance were identified through GWAS analysis and linkage analysis. Summary of the Invention

[0004] The main purpose of the present invention is to provide a molecular marker site SNP: 4-14146725 related to white spot disease resistance on corn chromosome 4 and its associated candidate functional gene Zm00001eb168510 in improving corn white spot disease resistance, so as to assist in improving corn white spot disease resistance, avoid the complicated and time-consuming resistance screening process, shorten the breeding period, and improve the efficiency of molecular breeding of corn white spot disease resistance.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] On one hand, the present invention provides a molecular marker related to corn white spot resistance, wherein the molecular marker gene is the Zm00001eb168510 gene and / or the sequence shown in SEQ ID NO: 1, and the CDs sequence of the Zm00001eb168510 gene is shown in SEQ ID NO: 2.

[0007] Furthermore, the molecular marker described in the present invention, as shown in SEQ ID NO: 1, presents a T / C polymorphism at the 201st base from the 5′ end; the Zm00001eb168510 gene sequence corresponds to the corn Chr4: 14186915-14205314 sequence, and presents a T / C polymorphism at the 14187198th base from the 5′ end; and / or the expression level of the Zm00001eb168510 gene or its translated protein is positively correlated with corn white spot resistance.

[0008] In another aspect, the present invention provides molecular markers associated with corn white spot resistance, wherein the molecular markers are SNP sites, including 14187198, 14187379, 14189243, 14189271, 14189273, 14189298, 14190223, 14190242, 14190268, 14190492, 14190497, 14190498, 14193823, 14193854, 14193910, 14193911, 14193925, 14194315, 14194384, 14194394 , 14194412, 14194456, 14194500, 14194562, 14194574, 14194666, 14194669, 14194670, 14194759, 14194837, 14194851, 14199719, 14199734, 14199742, 14199751, 14201833, 14201844, 14201888, 14201909 or 14202725, and the reference genome version where the SNP site is located is Zm-B73-REFERENCE-NAM-5.0.

[0009] Furthermore, the present invention provides any of the following applications of any of the molecular markers:

[0010] a) Genetic diversity analysis of white spot disease-resistant maize; b) Construction of molecular genetic map of white spot disease-resistant maize; c) Genome-wide association analysis of white spot disease-resistant maize; d) Identification of white spot disease-resistant maize varieties; e) Molecular marker-assisted selection breeding of white spot disease-resistant maize; f) Whole-genome selection breeding of white spot disease-resistant maize.

[0011] Furthermore, the present invention provides a product for detecting any of the molecular markers, comprising a reagent, a kit or a gene chip, and detecting the genotype of the molecular marker, or detecting the expression level of the sequence shown in SEQ ID NO: 2 or its translated protein.

[0012] Furthermore, the present invention provides products for detecting any of the molecular markers, including products prepared using PCR, qPCR, Sanger sequencing, high-throughput sequencing, fluorescence in situ hybridization, TaqMan probe method, ARMS-PCR method or KASP method, and the product detects the genotype of the molecular marker, or detects the expression level of the sequence shown in SEQ ID NO: 2 or its translated protein.

[0013] Furthermore, the present invention provides any of the following applications of the product:

[0014] a) Genetic diversity analysis of white spot disease-resistant maize; b) Construction of a molecular genetic map of white spot disease-resistant maize; c) Genome-wide association analysis of white spot disease-resistant maize; d) Identification or assisted identification of white spot disease-resistant maize varieties; e) Molecular marker-assisted selection breeding of white spot disease-resistant maize; f) Whole-genome selection breeding of white spot disease-resistant maize.

[0015] In another aspect, the present invention provides a method for screening corn with resistance to white spot disease. A corn sample to be tested is taken, and the gene sequence shown in SEQ ID NO: 1 is detected. When the base at the 201st position from the 5′ end of the sequence shown in SEQ ID NO: 1 is C, a corn variety with resistance to white spot disease is obtained.

[0016] On the other hand, the present invention provides a method for screening corn with resistance to white spot disease. The method comprises taking a corn sample to be tested and detecting the molecular marker. If the sequence shown in SEQ ID NO: 2 or its translated protein is overexpressed; and / or the base at position 14187198 from the 5′ end of the Zm00001eb168510 gene presents C, the corn variety is judged to be resistant to white spot disease.

[0017] In another aspect, the present invention provides a method for screening corn resistant to white spot disease, taking a corn sample to be tested, detecting the molecular markers, and when the SNP sites of the molecular markers appear in sequence

[0018] When CCACTAGTAGGGGCTGTTCGGGCGCGAGTAAAGATAGGGC, it is judged to be a corn variety resistant to white spot disease.

[0019] The technical effects achieved by the present invention are:

[0020] The present invention confirms through research that the white spot disease resistance QTL qMWS4-4 interval on corn chromosome 8 is co-localized with the resistance SNP: 4-14146725 (i.e., the 201bp site from the 5′ end of the sequence shown in SEQ ID NO: 1), and both have a strong phenotypic explanation rate for corn white spot disease resistance. Its associated gene Zm00001eb168510 (CDs sequence is shown in SEQ ID NO: 2) is highly expressed in corn leaves, proving that it is associated with corn leaf spot disease. Corn white spot disease resistance is a quantitative trait regulated by multiple genes. The technical solution provided by the present invention provides a new method for breeding new white spot disease-resistant corn varieties using modern molecular breeding technology to assist in improving corn white spot disease resistance, avoid the complicated and time-consuming resistance screening process, shorten the breeding period, and improve the efficiency of molecular breeding of corn white spot disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1Images of leaves with different grades of white spot disease on corn; HR: highly resistant to white spot disease, R: resistant to white spot disease, M: moderately resistant to white spot disease, S: susceptible to white spot disease, HS: highly susceptible to white spot disease.

[0022] Figure 2 Correlation heat map of white spot disease resistance in six populations; describes the correlation of the overall performance of RILs in the six populations under different environments. The narrower the circle and the redder the color, the stronger the correlation.

[0023] Figure 3 SNP density and LD decay plots; (a) Chromosome-specific SNP density within 1 Mb intervals. The ordinate represents chromosomes, and the abscissa represents positions on each chromosome. Redder positions indicate more variant sites. (b) Genome-wide LD decay (r²) across all chromosomes in 941 maize RILs as a function of physical distance (kb).

[0024] Figure 4 Co-localization analysis of white spot disease resistance QTL qMWS4-4 and resistance site SNP:4-14146725;

[0025] Figure 5 .Three haplotypes of the candidate gene Zm00001eb168510 for white spot disease resistance are shown;

[0026] Figure 6 .Analysis of the candidate gene Zm00001eb168510 for white spot resistance; (a) Overall differences in resistance levels to maize white spot among the three haplotypes, * indicates p < 0.05, **** indicates p < 0.0001; (b) Relative positions of Zm00001eb168510 and SNP: 4-14146725, as well as base and amino acid variations in the resistant parents TRL418 and TML139; (c) Expression levels of the Zm00001eb168510 gene in different tissues of maize, with the red box indicating the expression of the Zm00001eb168510 gene in leaves. DETAILED DESCRIPTION

[0027] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0028] The present invention is based on genome-wide association analysis and QTL mapping, uses tropical white spot disease-resistant maize inbred lines (YML32, TRL418, CML171, TML139, YML226, NK40-1) as resistant parents, hybridizes them with the temperate disease-susceptible elite inbred line Ye107, and selects six F9 recombinant inbred lines (RILs) after nine consecutive generations of single-seed self-pollination. These RILs were planted in Yanshan County, Yunnan Province for three consecutive years for phenotypic identification. Combined with the high-quality SNPs of the RIL population, GWAS analysis and linkage analysis were used to identify the SNP site SNP: 4-14146725 (i.e., the 201bp site from the 5′ end of the sequence shown in SEQ ID NO: 1) that is significantly associated with corn white spot resistance and its associated functional gene Zm00001eb168510 (Chr4: 14186915-14205314). The CDs sequence is shown in SEQ ID NO: 2. Molecular breeding can be used to subsequently apply this resistance gene to corn white spot resistance breeding.

[0029] Example 1

[0030] 1. Experimental Materials and Design

[0031] In this experiment, six tropical maize inbred lines (YML32, TRL418, CML171, TML139, YML226, and NK40-1) with wide genetic variation and resistance to white spot disease were selected as female parents. They were hybridized with the excellent temperate maize inbred line Ye107 susceptible to white spot disease as the common parent (the pedigrees, heterotic groups, ecological groups, and related resistance levels of the seven parents are detailed in Table 1). Through the single-seed transmission method, nine consecutive generations of self-pollination were used to generate six recombinant inbred line (RIL) populations: pop1 (YML32×Ye107), pop2 (TRL418× Initially, each population contained 200 RILs. However, due to environmental selection, inbreeding depression, and other factors, a total of 904 RILs were used for this study (pop1: 145; pop2: 141; pop3: 147; pop4: 160; pop5: 152; and pop6: 159). These RILs were planted in Yanshan County, Yunnan Province (23°19'-23°59'N, 103°35'-104°45'E) in 2021, 2022, and 2023. A complete randomized block design was used, with 14 plants per row, 4 m in length, and 25 cm plant spacing. Standard farmland management was followed.

[0032] Table 1. Pedigrees, ecotypes, and white spot disease resistance of the seven parents used in the experiment

[0033]

[0034] 2. Disease grade score

[0035] Phenotypic identification of white spot disease was conducted on RILs from a multi-parent population in Yanshan County, Yunnan Province, China in 2021, 2022, and 2023 (the corresponding years are abbreviated as 21YS, 22YS, and 23YS). White spot disease outbreaks occur from early August to late September each year, when corn is in the grain filling and maturity stages, making it suitable for resistance assessment. The severity of white spot disease was graded according to the symptom identification criteria outlined in the Maize Pest and Disease Manual, and the average disease severity of individual plots was evaluated on a scale of 1 to 9, such as Figure 1 , as shown in Table 2.

[0036] Table 2. Classification criteria for corn white spot disease

[0037]

[0038] 3. Phenotypic Identification and Statistical Analysis

[0039] Descriptive analyses of phenotypic data were performed using SPSS Statistics and ORIGIN (Origin 2022) software. Mean, minimum, maximum, standard deviation (SD), coefficient of variation (CV), skewness, and kurtosis were calculated. Frequency distributions of phenotypic data were also analyzed using SPSS software. Kurtosis and skewness were used to assess the normality of the frequency distributions, and broad-sense heritability was calculated according to the methods outlined by Knapp et al.

[0040] 4. Whole-genome resequencing

[0041] DNA was extracted from maize seedling leaves using a modified CTAB method and subjected to whole-genome resequencing. DNA libraries were prepared according to standard procedures and sequenced using Illumina Hi Seq TM The filtered reads were then aligned to the maize reference genome B73_RefGen_v5 (full name: Zm-B73-REFERENCE-NAM-5.0) to identify SNP markers, which were then annotated using the SNPeff software.

[0042] 5. Population structure analysis and LD decay

[0043] The distance matrix was calculated using TreeBeST (version: Treebest-1.9.2) software, and a phylogenetic tree was constructed based on this distance matrix using the neighbor-joining method (NJ). To ensure accuracy, bootstrap values ​​were calculated up to 1000 times. PCA analysis was performed using GCTA. After obtaining the PCA results, the values ​​of the first two PCs were used to perform a two-dimensional display of the samples involved in the analysis. The degree of linkage disequilibrium (r) between each pair of markers was calculated using PopLDdecay software. 2 ) and used the software's own script Plot_OnePop.pl to plot LD decay.

[0044] 6. Genome-wide Association Analysis

[0045] A genome-wide association study (GEMMA) was performed using 6,390,967 high-quality single-nucleotide polymorphisms (SNPs) analyzed using GEMMA software (http: / / www.xzlab.org / software.html). This analysis employed a mixed linear model (MLM) for GWAS, targeting phenotypes across all environments and best unbiased linear estimates (BLUPs). A significance threshold of -log10(p)>5 was used to identify significant SNPs associated with maize white spot resistance. Bedtools v1.7 was used to extract SNPs that met or exceeded the threshold. Candidate genes associated with maize white spot resistance were identified within a 50 kb interval upstream and downstream of the significant SNPs, based on the Zm-B73-REFERENCE-NAM-5.0 reference genome and annotation information.

[0046] 7. Construction of genetic linkage map

[0047] The linkage map was constructed using JoinMap4.0 software, and the LOD threshold was determined using 1000 random permutation tests. If the LOD threshold was ≥2.5, the QTL was considered significant. Linkage groups were defined according to the standard of LOD critical value ≥2.5, and a genetic linkage map was constructed using SNP markers that met the criteria. Offspring genotyping was filtered based on 0.8 completeness and 0.001 partial separation to obtain six population markers. Then, bins were drawn based on population markers every 15 markers without linkage to obtain the final population markers. The bin markers of each population were sorted using Joinmap4.0, and the genetic distance (cM) between markers was calculated using the Kosambi function.

[0048] 8QTL positioning analysis

[0049] QTL mapping was performed using the composite interval mapping (CIM) method in Windows QTL Cartographer 2.0. Phenotypic data for white spot disease were integrated into a high-density genetic linkage map. Single-nucleotide polymorphisms (SNPs) with a missingness ratio ≥ 0.2 and loci with a minor allele frequency less than 0.05 were excluded, and a threshold of 0.21 cM was used to identify parental polymorphic QTLs. A 95% confidence interval threshold was determined using 1000 random permutations. A LOD threshold of 2.5 was set for flanking markers to identify QTLs controlling MWS.

[0050] 9 Candidate gene analysis

[0051] Haploview v4.2 software was used to perform haplotype analysis of candidate genes. The corresponding gene sequences were extracted from the reference genome Zm-B73-REFERENCE-NAM-5.0 according to the candidate gene IDs. The sequences were aligned with those of the parents TRL418 and TML139, and the corresponding coding regions and amino acid variation information were extracted. The functional gene motifs were predicted using MEME online software (https: / / meme-suite.org / meme / tools / meme).

[0052] Result Analysis

[0053] 1 Phenotypic data analysis

[0054] The white spot disease resistance phenotypic data of six RIL groups were collected for three years in Yanshan, and descriptive statistical analysis was performed. The results showed that the coefficient of variation of the six RIL groups in Yanshan was between 0.25-0.79, indicating that there were differences between the samples. At the same time, the average disease level of white spot disease in the six RIL groups was between 2.9-5.81, and the absolute values ​​of the skewness and kurtosis coefficients of the six groups in three years were close to 1, indicating that the white spot disease resistance phenotypes of the test groups in the three-year resistance identification were in line with the normal distribution and the quantitative trait characteristics. Further analysis showed that the heritability of the severity of white spot disease of each RIL group ranged from 76.47-98.79%, and there was a strong correlation between the resistance phenotypes of the same group under different environments (0.46-0.98) ( Figure 2 ), indicating that the RIL lines had strong consistency in resistance to white spot disease under different environments. The phenotypic identification results showed that the resistance to corn white spot disease has a high heritability and is mainly determined by genes.

[0055] 2SNP density and LD decay

[0056] Through whole genome resequencing, a total of 6,390,967 high-quality SNPs were identified throughout the genome. These SNPs were evenly distributed on the 10 chromosomes of maize ( Figure 3a) The number of SNPs identified on chromosomes 1 to 10 is as follows: 1,354,402, 699,661, 716,354, 880,880, 668,865, 485,243, 563,392, 545,220, 472,482, and 462,679. The highest number of SNPs is on chromosome 1, and the lowest is on chromosome 10. The 6,390,967 identified SNPs were used to assess linkage disequilibrium (LD) decay in the association mapping population. Figure 3 As shown in b, when r 2 When the decline rate tends to be flat, the physical distance is about 50kb. Therefore, we selected the range of 50kb upstream and downstream of the significant SNP site as the standard for screening candidate genes.

[0057] 3 Group structure analysis

[0058] Phylogenetic tree analysis using TreeBeST divided the 941 RIL lines into six subgroups. Principal component analysis (PCA) using GCTA also divided the 941 RIL lines into six subgroups, which corresponded well with the six RIL populations we assembled. The analysis revealed some admixture or overlapping family lines, likely due to the common parent, Ye107, among the six subgroups and introgression during breeding. Therefore, the possibility that population structure could lead to false positives in GWAS should be considered in subsequent analyses.

[0059] 4. Genome-wide Association Analysis

[0060] GWAS analysis was performed using GEMMA (http: / / www.xzlab.org / software.html) software on 6,390,967 high-quality SNPs derived from whole-genome resequencing and phenotypic data of white spot disease resistance in 941 RIL lines from a multi-parent population collected over three years at Yanshan (YS). A mixed linear model (MLM) was used to simultaneously correct for both population structure and individual relatedness, resulting in the identification of multiple SNPs. Among the significant SNPs located, 4-14146725 were consistently significant SNPs that colocalized across three or more environments (21YS, 22YS, 23YS, and BLUP). Because artificial populations can lead to false positives in GWAS analysis, QTL analysis will be used to further identify candidate loci to improve identification accuracy.

[0061] 5. QTL Mapping

[0062] Using the white spot disease resistance phenotypes of each population under different environments, combined with the constructed high-density genetic map, QTL mapping for corn white spot disease resistance was performed. The mapping results were compared with the above GWAS analysis results. Finally, the corn white spot disease resistance QTL qMWS4-4 interval (Chr4:11404224-48099500) from the NK40-1×Ye107 population was identified to overlap with the resistance site SNP:4-14146725 located by GWAS ( Figure 4 ), this QTL can explain 6.55% of the resistance phenotypic variation. 6. Candidate gene mining

[0063] The present invention uses the Zm-B73-REFERENCE-NAM-5.0 reference genome to screen the 50Kb region upstream and downstream of the significant site SNP: 4-14146725 in the qMWS4-4 interval, and uses databases such as MaizeGDB, InterPro, UniProt and NCBI to annotate and perform functional prediction analysis on candidate genes, identifying the candidate functional gene Zm00001eb168510 (Chr4: 14186915-14205314). SNP: 4-14146725 is co-located in 21YS, 22YS, 23YS and BLUP, and the SNP explains a total of 15.14%% of the phenotypic variation, and the site is included in the QTL qMWS4-4 interval ( Figure 4 ), indicating that the SNP in the qMWS4-4 interval is a highly reliable molecular marker. The associated gene, Zm00001eb168510, encodes a protein in the cysteine ​​protease superfamily, which includes deubiquitinating enzymes (DUBs). These DUBs play important roles in plant development and stress response.

[0064] 7. Candidate Gene Analysis

[0065] In order to clarify that the selected candidate functional gene Zm00001eb168510 is related to the resistance to corn white spot disease, Zm00001eb168510 was analyzed and it was found that 14187198, 14187379, 14189243, 14189271, 14189273, 14189298, 14190223, 14190242, 14190268, 14190492, 14190497, 14190498, 14193823, 14193854, 14193910, 14193911, and 1419393 Mutations occurred at bases 925, 14194315, 14194384, 14194394, 14194412, 14194456, 14194500, 14194562, 14194574, 14194666, 14194669, 14194670, 14194759, 14194837, 14194851, 14199719, 14199734, 14199742, 14199751, 14201833, 14201844, 14201888, 14201909, and 14202725, resulting in the study population showing three major haplotypes ( Figure 5 )

[0066] Hap1:TCACTAGTAGGGATTGCCCCGGCGCTAGTAGAGATAAGAC,

[0067] Hap2: CCACTAGTAGGGGCTGTTCGGGCGCGAGTAAAGATAGGGC,

[0068] Hap3: CCGCTGACGAAAGCTGTCTCGTTGCGAGCGGAAAATAAGGA),

[0069] Among them, plants with haplotype Hap2 (CCACTAGTAGGGGCTGTTCGGGCGCGAGTAAAGATAGGGC) showed better resistance to corn white spot disease ( Figure 6 a). By comparing the sequences of this gene in the resistant materials TRL418 and TML139, a specific T / C mutation was found at base 14187198 in TRL418 and TML139, resulting in a mutation from cysteine ​​to arginine in the corresponding amino acid sequences of the resistant materials TRL418 and TML139, respectively ( Figure 6b), mutations in these amino acids change the protein motif. By studying the expression of this gene in different stages and tissues of corn, it was found that the expression level of Zm00001eb168510 gene in leaves was higher than that in other tissues ( Figure 6 c), further proving that this gene is closely related to resistance to corn leaf diseases and can be used as a molecular marker for breeding corn with white spot disease resistance.

[0070] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A molecular marker associated with corn white spot disease resistance, characterized in that: The molecular marker gene is the Zm00001eb168510 gene and / or the sequence shown in SEQ ID NO:1, and the CDs sequence of the Zm00001eb168510 gene is shown in SEQ ID NO:

2.

2. The molecular marker according to claim 1, characterized in that As shown in SEQ ID NO:1, the base at the 201st position from the 5′ end of the sequence presents a T / C polymorphism; the Zm00001eb168510 gene sequence corresponds to the corn Chr4:14186915-14205314 sequence, and the base at the 14187198th position from the 5′ end presents a T / C polymorphism; and / or the expression level of the Zm00001eb168510 gene or its translated protein is positively correlated with corn white spot resistance.

3. A molecular marker associated with corn white spot disease resistance, characterized in that: The molecular markers are SNP sites, including 14187198, 14187379, 14189243, 14189271, 14189273, 14189298, 14190223, 14190242, 14190268, 14190492, 14190497, 14190498, 14193823, 14193854, 14193910, 14193911, 14193925, 14194315, 14194384, 14194394, 14194412, 14194413 At least one of the SNP sites 94456, 14194500, 14194562, 14194574, 14194666, 14194669, 14194670, 14194759, 14194837, 14194851, 14199719, 14199734, 14199742, 14199751, 14201833, 14201844, 14201888, 14201909 or 14202725, and the reference genome version where the SNP site is located is Zm-B73-REFERENCE-NAM-5.

0.

4. Any of the following uses of the molecular marker according to any one of claims 1 to 3, a) Genetic diversity analysis of maize resistant to white spot disease; b) Construction of molecular genetic map of maize resistant to white spot disease; c) Whole genome association analysis of maize resistant to white spot disease; d) Identification of maize varieties resistant to white spot disease; e) Molecular marker-assisted selection breeding of maize resistant to white spot disease; f) Whole genome selection breeding of maize resistant to white spot disease.

5. A method for detecting a product labeled with a molecule according to any one of claims 1 to 3, characterized in that: The product includes a reagent, a kit or a gene chip, and the product detects the genotype of the molecular marker, or detects the expression level of the sequence shown in SEQ ID NO: 2 or its translated protein.

6. A method for detecting a product labeled with a molecule according to any one of claims 1 to 3, characterized in that: The products include products prepared by PCR, qPCR, Sanger sequencing, high-throughput sequencing, fluorescence in situ hybridization, TaqMan probe method, ARMS-PCR method or KASP method, and the products detect the genotype of the molecular marker, or detect the expression level of the sequence shown in SEQ ID NO: 2 or its translated protein.

7. Any of the following uses of the product according to claim 5 or 6, a) Genetic diversity analysis of white spot disease resistant maize; b) Construction of molecular genetic map of white spot disease resistant maize; c) Whole genome association analysis of white spot disease resistant maize; d) Identification or auxiliary identification of white spot disease resistant maize varieties; e) Molecular marker-assisted selection breeding of white spot disease resistant maize; f) Whole genome selection breeding of white spot disease resistant maize.

8. A method for screening corn resistant to white spot disease, characterized in that: A corn sample to be tested is taken, and the gene sequence shown in SEQ ID NO: 1 is tested. When the base at the 201st position from the 5′ end of the sequence shown in SEQ ID NO: 1 is C, a corn variety with white spot disease resistance is obtained.

9. A method for screening corn resistant to white spot disease, characterized in that: A corn sample to be tested is taken to detect the molecular marker according to claim 2, and when the sequence shown in SEQ ID NO: 2 or its translated protein is overexpressed; and / or the base at the 14187198th position from the 5′ end of the Zm00001eb168510 gene is C, it is judged to be a corn variety with white spot disease resistance.

10. A method for screening corn resistant to white spot disease, characterized in that: A corn sample to be tested is taken, and the molecular marker according to claim 3 is tested. When the SNP sites of the molecular marker sequentially present CCACTAGTAGGGGCTGTTCGGGCGCGAGTAAAGATAGGGC, it is judged to be a corn variety with white spot disease resistance.

Images