A dual-drug nanoparticle for treating Alzheimer's disease, its preparation method and application
By preparing nanoparticles H151@PEPA-G containing Aβ inhibitors and STING inhibitor H151, the problems of poor water solubility and blood-brain barrier penetration of existing STING inhibitors in the treatment of Alzheimer's disease were solved, achieving effective clearance of brain Aβ plaques and suppression of inflammation, thus improving the symptoms of Alzheimer's disease.
Patent Information
- Application Number
- CN202510081983.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-20
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-01-20
AI Technical Summary
Existing STING inhibitors have problems such as poor water solubility, easy degradation, and poor blood-brain barrier penetration when treating Alzheimer's disease, resulting in insignificant effects in inhibiting brain inflammation.
The study employs dual-drug nanoparticles containing an Aβ inhibitor and a STING inhibitor, H151, and uses the amphiphilic polymer PEPA as a carrier to form H151@PEPA-G nanoparticles. This enables the dissociation of Aβ aggregates and inhibition of the STING pathway, thereby enhancing the binding strength and stability of the drugs in the brain.
It improved the binding strength and drug loading of Aβ inhibitors and STING inhibitors, prolonged their residence time in the brain, reduced the inflammatory environment in the brain, improved the memory and spatial recognition abilities of mice, and significantly inhibited the activation of the STING pathway and the production of inflammatory factors.
Smart Images

Figure CN119837843B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a pharmaceutical composition containing a STING inhibitor, its preparation method, and its application in the treatment of Alzheimer's disease. Background Technology
[0002] Alzheimer's disease (AD) is an insidious neurodegenerative disease characterized by progressive cognitive impairment and loss of independence in daily life. It is one of the most difficult diseases to cure in the world. In 2021, my country had 16.99 million AD patients, accounting for approximately 29.8% of the global total. With population aging, the incidence of AD is expected to rise further each year, with the number of global patients projected to reach 78 million by 2030. Studies have shown that the pathological features of AD mainly include: cholinergic neurodegeneration, extracellular aggregation of amyloid (Aβ) protein to form senile plaques (Aβ plaques), an inflammatory brain environment, and neurofibrillary tangles.
[0003] The pathogenesis of Alzheimer's disease (AD) is complex and likely the result of multiple interacting factors. The "Aβ cascade hypothesis" is considered the most classic AD pathogenesis, which posits that neurons in the brain of AD patients produce amyloid precursor protein, which is incorrectly cleaved by β-secretase and γ-cleavagease to generate Aβ monomers. These monomers are secreted into the extracellular space, accumulating to form Aβ aggregates, ultimately evolving into insoluble fibers and plaques, causing neurotoxicity. Aβ monoclonal antibodies represent a major breakthrough in AD drug development, as they can target and eliminate toxic Aβ aggregates. Aβ-targeting peptides possess similar functions to Aβ monoclonal antibodies in targeting and dissociating Aβ aggregates; some even inhibit Aβ aggregation. Due to their low cost and simple preparation process, they have become popular research targets for AD treatment drugs. Recent clinical trial results show that while Aβ monoclonal antibodies and Aβ-targeting peptides can reduce Aβ plaques in the brain, they do not show significant inhibitory effects on brain inflammation in the later stages of AD. Further mechanistic studies have shown that Aβ-targeting peptides can enhance the ability of microglia to take up Aβ. When microglia take up too much Aβ but cannot effectively degrade it, they will activate interferon gene-stimulating protein (STING), thereby causing the release of downstream inflammatory factors.
[0004] Interferon gene-stimulating protein (STING) is a core member of the immune system's defense against pathogen invasion. It activates upstream cyclic GMP-AMP synthase (cGAS) to recognize exogenous double-stranded DNA in the cytoplasm, recruiting serine-threonine protein kinase 1 (TBK1) to activate downstream interferon regulatory factor 3 (IRF3), inducing the secretion of IFN-γ and various pro-inflammatory factors. Recent studies have demonstrated increased DNA fragmentation in the brains of spontaneous AD mouse models, indicating abnormal activation of the cGAS-STING signaling pathway.
[0005] Microglia may damage mitochondria and cause mitochondrial DNA (mtDNA) leakage when they take up excessive Aβ. Once in the cytoplasm, mtDNA binds to cGAS to form cGAMP. cGAMP acts as an agonist of STING, activating the STING protein and triggering a series of downstream reactions and the generation of a large number of inflammatory factors. These extracellular inflammatory factors cause neuronal inflammatory toxicity and further damage microglia. Currently, many drugs with preclinical benefits for inhibiting brain inflammation have been reported, some of which have entered clinical trials, but no STING inhibitors with proven efficacy have been marketed. Based on the crucial role of the cGAS-STING signaling pathway in inflammation, the development of various STING inhibitors is considered a promising strategy for the treatment of Alzheimer's disease (AD).
[0006] STING inhibitors are mainly divided into two categories: covalent inhibitors and non-covalent inhibitors. Covalent inhibitors inhibit STING activation by binding to Cys88 or Cys91 residues in the transmembrane region of the STING protein, blocking palmitoylation of STING. Non-covalent inhibitors target the C-terminal ligand-binding region of STING, competitively binding to STING's endogenous ligands and inhibiting the activation of STING-mediated downstream signaling pathways. STING inhibitors have shown promise as therapeutic agents for Alzheimer's disease (AD) in preclinical studies; however, many drugs, such as H151, suffer from poor water solubility, easy degradation, and poor BBB penetration, requiring formulation methods to improve their drug-likeness.
[0007] Therefore, there is an urgent need to address the inflammatory environment caused by the Aβ cascade mechanism that leads to AD and the abnormal activation of STING in the brain. Summary of the Invention
[0008] The purpose of this invention is to address the shortcomings of the prior art and provide a dual-drug nanoparticle for the treatment of Alzheimer's disease, its preparation method, and its application. This invention improves the memory and spatial recognition abilities of mice, enhances the inflammatory microenvironment of the brain, and provides favorable conditions for targeting the STING pathway in microglia and promoting Aβ clearance in the treatment of Alzheimer's disease.
[0009] To achieve the above objectives, the present invention is implemented through the following technical solution:
[0010] In a first aspect, the present invention provides a dual-drug nanoparticle comprising an Aβ inhibitor, a STING inhibitor, and an amphiphilic polymer, wherein the Aβ inhibitor is selected from Aβ antibodies or hydrophobic targeting peptides that dissociate and inhibit Aβ aggregation and their derivatives, and the STING inhibitor is a STING covalent inhibitor H151.
[0011] Preferably, the Aβ inhibitor is Aβ. 42The core hydrophobic region of the GKLVFF peptide.
[0012] Preferably, the amphiphilic polymer is PEPA.
[0013] Preferably, the mass ratio of the amphiphilic polymer to the STING inhibitor is 10:1-3; the molar mass ratio of the amphiphilic polymer to the Aβ inhibitor is 1:2-5.
[0014] Secondly, the present invention provides a method for preparing dual-drug nanoparticles, the method being as follows: an Aβ inhibitor is chemically bonded to an amphiphilic polymer, the amphiphilic polymer with the Aβ inhibitor is mixed with a STING inhibitor, and the mixture is slowly added dropwise to water under ultrasound. Then, the mixture is ultrasonicated, filtered, and the upper layer is collected to obtain dual-drug nanoparticles.
[0015] Preferably, the method is characterized by:
[0016] Step (1): Weigh 6.30 mg EDC, 1.51 mg NHS and 0.825 mg TK and dissolve them in 200 μL DMF. Vortex until completely dissolved, then stir magnetically and activate in an ice bath for 3 hours.
[0017] Step (2): PEPA-AMA is synthesized via atom transfer radical polymerization.
[0018] Step (3): Weigh 10 mg of PEPA-AMA and dissolve it in 100 μL of DMF. Vortex until completely dissolved and mix it with the system in step (1). React in a metal bath at 43 °C for 24 h.
[0019] Step (4): Dilute the mixture in step (3) with 2.1 mL of methanol, centrifuge, remove the supernatant, and remove the remaining methanol by vacuum distillation at 90 rpm and 49 °C to obtain PEPA-TK;
[0020] Step (5): Weigh 2.33 mg of GKLVFF peptide and dissolve it in 200 μL of DMF. Mix it with the PEPA-TK liquid in step (4) and react in a metal bath at 43 °C with magnetic stirring for 24 h.
[0021] Step (6): Dilute the mixture in (5) with 2.0 mL of methanol, centrifuge, and collect the liquid as PEPA-G. Use methanol to determine the concentration as 10 mg / mL.
[0022] Step (7): Weigh 1 mg of H151 and dissolve it in DMSO. Mix the H151 solution with the PEPA-G solution in step (6) until homogeneous. Under the condition of ultrasound probe, dropwise add the mixed solution into 3 mL of ice bath ultrapure water to form uniform drug-loaded micelles. Centrifuge to remove methanol, and add ultrapure water to the inner tube micelles and retain the outer tube solution to obtain dual-drug nanoparticles.
[0023] Thirdly, the present invention provides a pharmaceutical composition comprising the aforementioned dual-drug nanoparticles.
[0024] Fourthly, the present invention provides the use of the dual-drug nanoparticles or the pharmaceutical composition thereof in the preparation of drugs for treating Alzheimer's disease.
[0025] The present invention has the following beneficial effects: (1) The nanocarriers of the two therapeutic drugs encapsulated in the dual-drug nanoparticles of the present invention can dissociate Aβ aggregates in the brain, reduce extracellular Aβ plaques, and achieve combined administration of STING pathway inhibition and Aβ dual-target, thereby reducing the inflammatory environment and Aβ plaques in the brain; achieving co-delivery of the two drugs to the brain and improving their combined therapeutic effect may lead to a breakthrough in the clinical efficacy of Aβ-targeting peptides and STING inhibitors in the treatment of AD.
[0026] (2) The dual-drug nanoparticles (H151@PEPA-G) of the present invention use the amphiphilic nanomaterial PEPA as a carrier, which greatly increases the binding strength and drug loading of STING inhibitors (such as H151) and Aβ targeting peptides (such as GKLVFF) in the nanoparticles, forming nanoparticles with extremely small particle size, thus avoiding the extracellular degradation of the two gene drugs.
[0027] (3) The dual-drug nanoparticles described in this invention improve the properties of free H151 and GKLVFF, enhance their stability, prolong their retention time in the brain, and enhance the therapeutic effect.
[0028] (4) The dual-drug nanoparticles of the present invention can dissociate Aβ fibers, inhibit Aβ aggregation, and reduce the accumulation of extracellular Aβ fibers and plaques.
[0029] (5) The dual-drug nanoparticles described in this invention can inhibit the activation of the STING pathway in microglia, reduce the production of downstream CXCL-9, CXCL-10 and IFN-β in the STING pathway, and thereby reduce the production of downstream IL-6, IL-1β and TNF-α.
[0030] (6) The dual-drug nanoparticles described in this invention can improve the memory ability of 5xFAD (spontaneous AD mice) and improve cognitive impairment. Attached Figure Description
[0031] Figure 1The preparation process of the dual-drug nanoparticles H151@PEPA-G prepared in Example 1 of this invention ( Figure 1 -A) and particle size distribution diagram ( Figure 1 -B);
[0032] Figure 2 The in vitro cumulative release curves of H151 and GKLVFF in Example 2 of this invention are shown below. Figure 2 -A represents the in vitro cumulative release curve of H151; Figure 2 -B is the in vitro cumulative release curve of GKLVFF. One-way ANOVA was used, mean ± SEM. **P<0.01, ***P<0.001, and ****P<0.0001;
[0033] Figure 3 Figure 1 shows the in vitro hemolysis experiment of H151@PEPA-G dual-drug nanoparticles at different concentrations prepared in Example 1. Figure 3 -A) and toxicity assay diagrams for BV2 on microglia ( Figure 3 -B);
[0034] Figure 4 In Example 4 of this invention, in vivo and ex vivo brain imaging of mice 24 hours after tail vein administration of DIR@PEPA-G were performed. Figure 4 Confocal images of C6@PEPA-G being taken up by cells (-A) and C6@PEPA-G (-A) Figure 4 -B);
[0035] Figure 5 The figure shows the FRET experimental results of the affinity of PEPA-G and other components for Aβ fibers in Example 5 of this invention. Figure 5 -A), ThT fluorescence experimental results of dissociated Aβ fibers ( Figure 5 -B), FRET experimental results on affinity for Aβ monomers ( Figure 5 Figure 1 shows the ThT fluorescence results for inhibiting Aβ monomer aggregation (-C) and (-C). Figure 5 -D);
[0036] Figure 6 In Example 6 of this invention, on in vitro cells ( Figure 6 -A) and in vivo 5xFAD mouse hippocampus ( Figure 6 -B) Statistical chart of STING-related gene expression levels. One-way ANOVA was used, mean ± SEM. **P<0.01, ***P<0.001, and ****P<0.0001;
[0037] Figure 7The above is a statistical graph showing the expression levels of inflammatory factors in the hippocampus of 5xFAD mice in Example 7 of this invention. One-way ANOVA was used, mean ± SEM. **P<0.01, ***P<0.001, and ****P<0.0001;
[0038] Figure 8 This is a representative image of the nesting experiment in WT and 5xFAD mice in Example 8 of the present invention. Figure 8 -A) and scoring results statistics chart ( Figure 8 -B), one-way ANOVA was used, mean ± SEM. **P<0.01, and ****P<0.0001;
[0039] Figure 9 This is a representative image of the Morris water maze experiment in WT and 5xFAD mice in Example 8 of the present invention. Figure 9 -A), training latent mice ( Figure 9 -B), testing the incubation period ( Figure 9 -C), Number of times traversing platforms ( Figure 9 -D) and target quadrant time ( Figure 9 -E) Results Statistical chart, one-way ANOVA was used, mean ± SEM. **P<0.01, and ****P<0.0001. Detailed Implementation
[0040] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.
[0041] The terminology used in this invention, unless otherwise specified, generally has the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments, accompanying drawings, and data. It should be understood that these embodiments are merely illustrative and not intended to limit the scope of the invention in any way. Various processes and methods not described in detail in the following embodiments are conventional methods known in the art. Unless otherwise specified, the materials, reagents, apparatuses, instruments, equipment, etc., used in the following examples are commercially available.
[0042] GKLVFF was purchased from Nanjing Jietai Biotechnology Co., Ltd.
[0043] H151 was purchased from MedChemExpress.
[0044] 1-Ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) was purchased from Shanghai Maclean Biochemical Technology Co., Ltd.
[0045] N-hydroxysuccinimide (NHS) was purchased from Bid Pharmaceutical Technology Co., Ltd.
[0046] 3,3'-(propane-2,2-diylbis(thionidyl))dipropionic acid (TK) was purchased from Shanghai Maclean Biochemical Technology Co., Ltd.
[0047] PEPA-AMA is synthesized spontaneously via atom transfer radical polymerization.
[0048] Example 1
[0049] Preparation of H151@PEPA-G peptide-loaded nanomicelles:
[0050] (1) Accurately weigh 6.30 mg EDC, 1.51 mg NHS, and 0.825 mg 3,3'-(propane-2,2-dimethylbis(thionediyl))dipropionic acid (TK) and dissolve them in 200 μL of N,N-dimethylformamide (DMF). Vortex until completely dissolved. Activate in an ice bath for 3 hours with magnetic stirring.
[0051] (2) Dissolve 2-(propylamino)ethanol in acetonitrile, then add potassium carbonate, bromoethane and potassium iodide in sequence, heat to 78°C and react for 24 h; post-treatment: filter and rotary evaporate to remove acetonitrile, add water, saturated sodium bicarbonate aqueous solution and saturated sodium chloride aqueous solution, extract with ethyl acetate and rotary evaporate to obtain EPA (2-(ethylpropylamino)ethanol).
[0052] (3) Methacryloxychloromethyl chloride was dissolved in 30 ml of mass spectrometry grade dichloromethane (DCM), and EPA, Et3NHCl, and 2,6-di-tert-butyl-p-cresol were dissolved in 170 ml of mass spectrometry grade DCM. The methacryloxychloromethyl chloride dissolved in DCM was slowly added dropwise to the above mixed solution with stirring in an ice bath. The acylation reaction was carried out in an ice bath for 6 hours to obtain a yellow solid. The solid was removed by filtration, and the filtrate was transferred to a rotary evaporator and evaporated to dryness to obtain a milky white solid with a slightly yellow tinge. After evaporation to dryness, ethyl acetate was added to completely dissolve the solid, and then saturated NaHCO3 was added for extraction twice. The ethyl acetate phase was taken and extracted once more with saturated NaCl. The ethyl acetate phase was evaporated to dryness to obtain a transparent liquid. The liquid was distilled to obtain EPA-MA. EPA-MA (0.43 g, 2 mmol), PMDETA (12 μL, 0.05 mmol), MeO-PEO113-Br (0.25 g, 0.05 mmol), and AMA (2-aminoethyl methacrylate hydrochloride, 0.1 mmol) were packed into a polymerization tube. A mixture of 2-propanol (1 mL) and DMF (1 mL) was then added to dissolve the solids. After three cycles of freeze-pump-thaw deoxygenation, CuBr (7 mg, 0.05 mmol) was added to the polymerization tube under a nitrogen atmosphere, and the tube was vacuum-sealed. Polymerization was carried out at 40 °C for 8 hours. After polymerization, the reaction mixture was diluted with 10 mL of THF, and the catalyst was removed by passing it through a neutral Al2O3 column. The THF solvent was removed by rotovap. The residue was dialyzed in distilled water and lyophilized to obtain a white powder, which was identified as PEPA-AMA.
[0053] (4) Accurately weigh 10 mg of PEPA-AMA and dissolve it in 100 μL of DMF. Vortex it to dissolve it completely and mix it with the system in (1). React in a metal bath at 43°C for 24 h.
[0054] (5) Dilute the mixture in (4) above with 2.1 mL of methanol (7 times), transfer the liquid to the inner tube of a 10 k ultrafiltration tube, centrifuge at 3500 rpm for 40 min, aspirate the liquid from the inner tube to a 5 mL EP tube, and remove the remaining methanol by vacuum distillation at 90 rpm and 49 °C to obtain PEPA-TK.
[0055] (6) Accurately weigh 2.33 mg of GKLVFF peptide and dissolve it in 200 μL of DMF. Mix it with the remaining PEPA-TK liquid in (5) above, and react in a 43°C metal bath with magnetic stirring for 24 h.
[0056] (7) Dilute the mixture in (6) with 2.0 mL of methanol (7 times), transfer the liquid to the inner tube of a 10k ultrafiltration tube, centrifuge at 3500 rpm for 40 min, collect the remaining liquid in the inner tube as PEPA-G, and set the concentration to 10 mg / mL using methanol.
[0057] (8) Accurately weigh 1 mg of H151 and dissolve it in an appropriate amount of DMSO (vortex to completely dissolve). Mix the H151 solution with the PEPA-G solution from (7) above. Under the condition of probe ultrasound, dropwise add the mixed solution into 3 mL of ultrapure water in an ice bath to form uniform drug-loaded micelles. Remove methanol by centrifugation at 3500 rpm for 30 min using a 10 kJ ultrafiltration tube. Make up the volume of the micelles in the inner tube with ultrapure water and retain the solution in the outer tube to obtain H151@PEPA-G. A schematic diagram of the preparation of nanomicelles is shown below. Figure 1 As shown.
[0058] The particle size was measured using a Malvern particle size analyzer to investigate micelle morphology, and the encapsulation efficiency and drug loading were investigated using high-performance liquid chromatography (HPLC). The results showed that the particle size was 24 nm. Figure 1 -B), PDI less than 0.02, zeta potential of +20mV, HPLC was used to detect the H151 content in the outer tube solution and the micelle solution after demulsification, and the H151 drug loading was calculated to be 8% and the encapsulation efficiency was 85%.
[0059] Example 2 investigated the in vitro release characteristics of H151@PEPA-G nanomicelles.
[0060] The nanomicelles H151@PEPA-G prepared in Example 1 were added to a dialysis bag (MW: 3500) and placed in a 50 mL centrifuge tube. 20 mL of pH 7.4 PBS and pH 5.4 PBS were added respectively, and H151 was released in a shaker at 37 °C. 200 μL of the release solution was taken at 0, 1, 2, 3, 4, 8, 10, 12, 24, 30, 36, 48, 60, 72, and 96 h, and 200 μL of release medium was added to each. The H151 content was determined by HPLC, and the release curve was plotted.
[0061] The results are as follows Figure 2 As shown, the in vitro release of H151 exhibits pH responsiveness; drug release accelerates and the total release increases under acidic conditions, which is related to the transition point of the pH-responsive material PEPA. The release of H151 peaks at 72 hours, releasing over 80% of the drug, indicating that H151 can be successfully released in vitro, demonstrating the sustained-release properties of this nanomicelle. Furthermore, the release efficiency of GKLVFF from the micelles is less than 5%, indicating that GKLVFF is stably attached to the micelles.
[0062] Example 3 investigated the in vitro safety of H151@PEPA-G nanomicelles.
[0063] Take 0.5 mL of fresh rat blood (6-8 weeks old, SD rat, 180-220 g, Vitaliva) and add 0.5 mL of 5% glucose injection solution. Mix well and wash repeatedly until the red color in the supernatant disappears. Take 0.1 mL of the blood cell precipitate and add glucose injection solution to obtain a 2% erythrocyte suspension. Mix equal volumes of 5% glucose injection solutions of H151@PEPA-G at concentrations of 1, 4, 16, 128, and 256 μg / mL with the 2% erythrocyte suspension. Let stand for 1 hour and observe the hemolysis phenomenon. Detect the hemolysis status using a multi-functional microplate reader.
[0064] Microglia BV2 were cultured in 96-well plates in vitro. When the cell density reached 50%, microglia were co-cultured with preparations at concentrations of 0, 1, 4, 16, 64, 128, and 256 μg / mL in serum-free medium for 24 h. 10 μL of CCK-8 solution was added to each well and incubated at 37 °C and 5% CO2 for 2 h. The absorbance (OD) at 450 nm was measured using a multi-mode microplate reader.
[0065] The results are as follows Figure 3 As shown, different concentrations of nanomicelles did not cause hemolysis, and different concentrations of micelle formulations did not have obvious cytotoxicity. Even at 256 μg / mL, the survival rate of microglia was still 90%.
[0066] Example 4 investigated the in vivo brain penetration and cellular uptake capabilities of H151@PEPA-G nanomicelles.
[0067] DIR@PEPA-G (PEPA-G encapsulating DIR) was prepared according to the method in Example 1 and administered via tail vein to AD mice (containing 1 μg DIR). After 24 hours, in vivo imaging (Tanon-ABLX6) was used to detect the fluorescence of the mouse brain. Subsequently, the mouse brain was removed and the fluorescence intensity was measured in vitro. Figure 4 -A).
[0068] 1 mg of PEPA-G and an appropriate amount of C6 were dissolved in methanol. The mixture was then added dropwise to ultrapure water under ultrasonic conditions of 80 W in an ice bath to form C6@PEPA-G nanomicelles. The methanol was removed by centrifugation at 3500 rpm for 30 min, and the volume was adjusted to ultrapure water.
[0069] bEnd3 cells were seeded in the lower chamber of a Transwell plate. Electrical resistance was measured daily. When the resistance stabilized at approximately 300 Ω, BV2 microglia were seeded in the lower chamber. Once the cell density reached 50%, 500 μL of C6@PEPA-G nanomicelles resuspended in incomplete culture medium (MEM Gibco) was added to each well in the upper chamber and incubated in the dark for 3 hours. Cells from the lower chamber were then collected and washed three times with PBS. After fixation with paraformaldehyde for 10 min, the supernatant was aspirated and washed three times with PBS. Diluted HOECHST 33342 staining was then performed for 10 min. An anti-fluorescence quencher was added, and the C6 and HOECHST 33342 channels of a laser confocal microscope (LSM800) were activated for observation under a microscope. The confocal results are shown below. Figure 4 As shown in Figure -B, intracellular fluorescence was evident after 3 hours, indicating that the micelle formulation can cross the blood-brain barrier and be taken up by cells.
[0070] Example 5 investigated the ability of H151@PEPA-G nanomicelles to exhibit Aβ affinity, depolymerization, and aggregation inhibition in vitro.
[0071] H151@PEPA-G, Aβ monomer (mAβ), and GKLVFF were coupled with the fluorescent group Cy5. On another portion of the Aβ fiber (oAβ), a paired fluorescent group Cy3 was coupled. The host with Cy5 and the guest oAβ-Cy3 were co-incubated for 4 hours. Fluorescence resonance energy transfer (FRET) was used to detect the fluorescence of Cy5 using a multi-functional microplate reader. A FRET effect occurred when the distance between GKLVFF-Cy3 and Aβ-Cy5 was less than 10 nm, reflecting the intermolecular affinity between GKLVFF and Aβ fibers. Similarly, Aβ monomer (mAβ) coupled with the paired fluorescent group Cy3 was prepared, and the host with Cy5 and the guest mAβ-Cy3 were co-incubated. The affinity of each substance for mAβ was then detected.
[0072] H151@PEPA-G nanomicelles were co-incubated with aggregated Aβ and monomeric Aβ at 37℃ and 200rpm for 24h. The ThT fluorescence intensity was detected (ex 450nm, em 485nm) using a multi-functional microplate reader to determine the degree of Aβ aggregation.
[0073] The results are as follows Figure 5 As shown, Figure 5 -A, 5-B shows that the fluorescence intensity of H151@PEPA-G nanomicelles Cy5 is stronger than that of Aβ aggregates. The ThT fluorescence intensity of H151@PEPA-G nanomicelles after co-incubation with Aβ aggregates is lower, indicating that H151@PEPA-G nanomicelles have better affinity with Aβ aggregates and can depolymerize Aβ aggregates. Figure 5-C,5-D shows that the fluorescence intensity of H151@PEPA-G nanomicelles Cy5 is stronger than that of Aβ monomer. The ThT fluorescence intensity of the co-incubated system of H151@PEPA-G nanomicelles and Aβ monomer is lower, indicating that the nanomicelles inhibit the re-aggregation of Aβ monomer and depolymers.
[0074] Example 6 investigated the in vitro and in vivo inhibition of STING activation by H151@PEPA-G nanomicelles.
[0075] Microglia BV2 cells were treated with 5 μM Aβ aggregates, PEPA-G micelles, and 5 μM H151 or H151@PEPA-G micelles for 24 h. Intracellular RNA was then extracted, and the expression levels of IFN-β, CXCL-9, and CXCL-10 genes in the cells were detected using qPCR. The reaction mixture was prepared according to the kit instructions (Universal Blue qPCR SYBR Green Master Mix, Novizan Biotechnology Co., Ltd.).
[0076] Four-month-old 5xFAD mice (Alzheimer's disease transgenic mice, Ailingfei Biotechnology Co., Ltd.) were administered H151@PEPA-G nanomicelles, H151@PEPA micelles, PEPA-G micelles, and PBS via tail vein injection (100 μL, 1 mg / mL) every three days, as well as wild-type mice (WT) injected with PBS, for a total of 9 administrations. The brains of each mouse were removed, and the hippocampus was isolated. The tissues were cryogenically homogenized, and the expression levels of IFN-β, CXCL-9, and CXCL-10 genes in the hippocampus were detected using qPCR, following the kit instructions.
[0077] The reaction procedure is shown in Table 1:
[0078] Table 1 Reaction Procedure
[0079]
[0080]
[0081] Primer sequences:
[0082] IFN-β:
[0083] Forward primer (SEQ ID NO: 1): GCCTTTGCCATCCAAGAGATGC
[0084] Reverse primer (SEQ ID NO: 2): ACACTGTCTGCTGGTGGAGGTC
[0085] CXCL-9:
[0086] Forward primer (SEQ ID NO: 3): GGAGTTCGAGGAACCCTAGTG
[0087] Reverse primer (SEQ ID NO: 4): GGGATTTGTAGTGGATCGTGC
[0088] CXCL-10:
[0089] Forward primer (SEQ ID NO: 5): ATCATCCCTGCGAGCCTATCCT
[0090] Reverse primer (SEQ ID NO: 6): GACCTTTTTTGGCTAAACGCTTTC
[0091] GAPDH:
[0092] Forward primer (SEQ ID NO: 7): GCCTCAAGATCATCAGCAAT
[0093] Reverse primer (SEQ ID NO: 8): TTCAGGGATGACCTT
[0094] The primers mentioned above were from Shanghai Sangon Biotech.
[0095] The results are as follows Figure 6 As shown, Figure 6 -A represents in vitro data on STING pathway activation induced by the inhibition of Aβ by formulation 1, showing the gene expression levels of CXCL-9, CXCL-10, and IFN-β, respectively. Figure 6 -B represents the gene expression levels detected after extraction from the mouse hippocampus in vivo. Both free H151 and H151-containing nanomicelles were significantly downregulated compared to the Control group (PBS injection group) in both cells and the hippocampus. CXCL-9 levels decreased 5-fold, CXCL-10 levels decreased 2-fold, and IFN-β levels decreased 3-fold in the hippocampus. The PEPA-G group showed no significant STING inhibitory effect. This suggests that only the combined use of GKLVFF and the STING inhibitor H151 in vivo can significantly inhibit the STING pathway in Alzheimer's disease.
[0096] Example 7 investigated the ability of H151@PEPA-G nanomicelles to inhibit the release of inflammatory factors.
[0097] Microglia BV2 cells were treated with 5 μM Aβ fibers, PEPA-G micelles, and 5 μM H151 or H151@PEPA-G micelles for 24 h. Intracellular RNA was then extracted, and the expression levels of IL-6, IL-1β, and TNF-α genes in the cells were detected by qPCR.
[0098] Hippocampal bodies from mice in each group in Example 6 were frozen and homogenized into tissue homogenate. After centrifugation at 5000g for 5 minutes, the supernatant was collected and added to an ELISA plate pre-coated with capture antibodies (IL-6, IL1-β, TNF-α). A series of standards of known concentrations were added to some wells. Each well was incubated for 24 hours. Then, secondary antibody and HRP were added for color development. The absorbance of each well was measured sequentially at a wavelength of 450nm using a microplate reader. The amount of each inflammatory factor was quantitatively analyzed by standard curve.
[0099] The results of ELISA are as follows Figure 7 As shown in Figure B, H151@PEPA-G nanomicelles and H151@PEPA micelles significantly reduced the concentration of inflammatory factors in the hippocampus. This may be because H151 inhibits the STING pathway in microglia, reducing the release of inflammatory factors. Furthermore, the amount of inflammatory factors released from the hippocampus of mice treated with H151@PEPA-G nanomicelles was less than that of H151@PEPA, indicating that GKLVFF further reduced the activation of microglia by Aβ.
[0100] Example 8 examines the efficacy of H151@PEPA-G nanoparticles in treating Alzheimer's disease.
[0101] 5xFAD mice were treated according to the grouping (n=10 per group) and administration method described in Example 6. After administration, each group of mice was placed in a cage individually, with a 5cm x 5cm paper towel placed in the cage. The mice were removed 24 hours later, and photographs were taken of the degree of tearing on the towel. Ten independent researchers who were not involved in the test were invited to rate the towel on a 5-point scale: 0 points: no tearing marks, intact; 1 point: some tearing marks; 2 points: torn into large pieces, but not gathered together; 3 points: torn into large pieces and gathered together; 4 points: torn into small pieces and gathered together; 5 points: torn into fragments but gathered together very well, forming a perfect nest.
[0102] Each mouse underwent the Morris water maze test, which consisted of three parts: Day 1: Mice were placed in a circular pool (120cm in diameter and 50cm deep) to familiarize themselves with the environment (1 minute). Days 2-6: A 5-day training phase, the pool was divided into four quadrants, with a platform 1cm underwater in the third quadrant. Mice were placed in each quadrant and explored for 60 seconds to find the platform, then stayed for 5 seconds. Mice that did not find the platform were given guidance and stayed on the platform for 15 seconds. The trajectory, number of times the platform was crossed, the time, and the latency were recorded. Day 7: The testing phase, the platform was removed. The mice's swimming trajectory, crossing time, and time spent in the target quadrant were collected and analyzed using instruments.
[0103] The results of the nest building experiment are as follows Figure 8As shown, the nests of H151@PEPA-G nanomicelles and H151@PEPA micelles are more aesthetically pleasing and have higher scores, significantly higher than the PEPA-G micelle group. However, the effect of H151@PEPA-G nanomicelles is better than that of H151@PEPA micelles, indicating that the combination of GKLVFF and the STING inhibitor H151 is more effective in treating Alzheimer's disease.
[0104] The results of the Morris water maze are as follows Figure 9 As shown, mice in the H151@PEPA-G nanomicelles and H151@PEPA micelles groups exhibited significantly better results than mice in the PEPA-G micelles group in terms of the number of times they crossed the platform, the time spent in the platform quadrant, and the latency. However, the H151@PEPA-G nanomicelles were more effective than the H151@PEPA micelles, indicating that the combined application of GKLVFF and the STING inhibitor H151 reduced the accumulation and deposition of Aβ in the brain, accelerated the degradation and clearance of Aβ by microglia, and inhibited the activation of the STING pathway in the brain, thus reducing the release of inflammatory factors from microglia that damage neurons. This provides beneficial assistance for the treatment of Alzheimer's disease.
[0105] This invention constructs a nanoparticle, H151@PEPA-G, conjugated with GKLVFF peptide and encapsulated with the STING inhibitor H151. This nanoparticle exhibits good biocompatibility and stability. H151@PEPA-G can cross the blood-brain barrier and simultaneously act on the Aβ and microglia STING pathways, depolymerizing Aβ and promoting Aβ clearance, inhibiting microglia STING pathway activation, and reducing the release of inflammatory factors that damage neurons. In a transgenic 5xFAD mouse model of Alzheimer's disease, H151@PEPA-G significantly reduced Aβ deposition in the brain and significantly inhibited the activation of the microglia STING pathway, significantly improving memory and spatial recognition abilities, and improving the inflammatory microenvironment in the brain. This provides favorable conditions for targeting the microglia STING pathway and promoting Aβ clearance in the treatment of Alzheimer's disease.
[0106] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. However, the above description is merely a specific embodiment of the present invention, and the technical features of the present invention are not limited thereto. Any other embodiments derived by those skilled in the art without departing from the technical solution of the present invention should be covered within the patent scope of the present invention.
Claims
1. A dual-drug nanoparticle, characterized in that, It comprises an Aβ inhibitor, a STING inhibitor, and an amphiphilic polymer, wherein the Aβ inhibitor is Aβ 42 The core hydrophobic region is the GKLVFF polypeptide, and the STING inhibitor is the STING covalent inhibitor H151.
2. The dual-drug nanoparticles according to claim 1, characterized in that, The mass ratio of the amphiphilic polymer to the STING inhibitor is 10:1-3; the molar mass ratio of the amphiphilic polymer to the Aβ inhibitor is 1:2-5.
3. The method for preparing dual-drug nanoparticles according to any one of claims 1-2, characterized in that, The method is as follows: an Aβ inhibitor is chemically bonded to an amphiphilic polymer, the amphiphilic polymer with the Aβ inhibitor is mixed with a STING inhibitor, and then slowly added dropwise to water under ultrasound. The mixture is then sonicated, filtered, and the upper layer is collected to obtain dual-drug nanoparticles.
4. A pharmaceutical composition, characterized in that, It includes the dual-drug nanoparticles as described in any one of claims 1-2.
5. The use of the dual-drug nanoparticles according to any one of claims 1-2 or the pharmaceutical composition according to claim 4 in the preparation of a drug for treating Alzheimer's disease.