Application of circular RNA-circUCK2 in treatment of hepatocellular carcinoma

Abstract

The invention provides an application of circular RNA (circUCK2) in treatment of hepatocellular carcinoma, and particularly, the content of circUCK2 in cancer cells is increased through a circUCK2 overexpression element or a mode of directly adding circUCK2, so that the sensitivity of hepatocellular carcinoma cells to combined treatment of a tyrosine kinase inhibitor and an EGFR (epidermal growth factor receptor) inhibitor is improved. Experiments show that under the condition of high expression of circUCK2, the combined treatment has a stronger killing effect on liver cancer cells.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and more specifically, the present invention relates to the use of circular RNA-circUCK2 in the treatment of hepatocellular carcinoma. Background Art

[0002] Hepatocellular carcinoma (HCC) is a malignant tumor originating from liver parenchymal cells, accounting for more than 85% of primary liver cancer cases. According to the latest epidemiological statistics, the incidence and mortality of liver cancer remain high both globally and in China. Since early liver cancer usually has no obvious symptoms, or the symptoms are mild, and liver cancer progresses rapidly, many liver cancer patients are already in the advanced stage when diagnosed. And due to the inherent insensitivity of liver cancer to traditional radiotherapy and chemotherapy, the treatment effect is poor. At present, targeted therapy and immunotherapy have become one of the main treatments for patients with advanced liver cancer.

[0003] Lenvatinib is an oral multi-target tyrosine kinase inhibitor, mainly used to treat various types of cancer. It exerts its anti-tumor effect by inhibiting multiple tyrosine kinases associated with tumor growth and metastasis, such as vascular endothelial growth factor receptor (VEGFR), fibroblast growth factor receptor (FGFR) and other receptors. Currently, lenvatinib has been approved as a first-line targeted therapy for advanced liver cancer. Compared with the traditional first-line targeted therapy sorafenib, lenvatinib showed non-inferiority in clinical trials (REFLECT trial) and had better performance in objective response rate, progression-free survival, etc. It is suitable for patients with high-risk characteristics such as large tumor burden and vascular invasion. However, there are individual differences in lenvatinib treatment (such as the molecular characteristics of the tumor and the type of gene mutation), and with the large-scale application of lenvatinib, clinical drug resistance has also emerged.

[0004] A high-throughput screening study based on CRISPR-CAS9 gene editing technology found that high EGFR expression or EGFR pathway activation is one of the main causes of lenvatinib resistance. A clinical trial of lenvatinib combined with EGFR inhibitors (NCT04642547) showed that the combined treatment showed good efficacy for more than half of patients with advanced liver cancer with high EGFR expression. However, some patients did not respond to the combined treatment of lenvatinib and EGFR inhibitors. Therefore, it is urgent to understand the causes of resistance to combined treatment and solve its resistance problem. Summary of the invention

[0005] The object of the present invention is to provide a method for improving the sensitivity of liver cancer cells to the combined treatment of tyrosine kinase inhibitors and EGFR inhibitors.

[0006] In a first aspect of the present invention, there is provided a use of an active ingredient for preparing a preparation or a pharmaceutical composition, wherein the preparation or the pharmaceutical composition is used to increase the sensitivity of liver cancer cells to a combined treatment with a tyrosine kinase inhibitor and an epidermal growth factor receptor (EGFR) inhibitor,

[0007] Wherein, the active ingredient is selected from the following group:

[0008] (a) circUCK2;

[0009] (b) expressing circUCK2 mRNA; and / or

[0010] (c) Vector expressing circUCK2.

[0011] In another preferred embodiment, the circUCK2 is a circular RNA transcribed from the 2nd to 3rd exons of the gene UCK2, and its corresponding DNA sequence is shown as SEQ ID NO1.

[0012] In another preferred embodiment, the active ingredient is a circUCK2 overexpression plasmid.

[0013] In another preferred embodiment, the plasmid includes the target gene shown as SEQ ID NO1.

[0014] In another preferred embodiment, the plasmid includes primers shown as SEQ ID NO2 and SEQ ID NO3.

[0015] In another preferred embodiment, the tyrosine kinase inhibitor is selected from the following group: lenvatinib, sorafenib, regorafenib, donafenib, imatinib, sorafenib, sunitinib, lapatinib, and dasatinib.

[0016] In another preferred embodiment, the EGFR inhibitor is selected from the following group: pelitinib, gefitinib, erlotinib, icotinib, afatinib, dacomitinib, osimertinib, and ametinib.

[0017] In another preferred embodiment, the combination therapy of the tyrosine kinase inhibitor and the epidermal growth factor receptor (EGFR) inhibitor is a combination therapy of lenvatinib and pelitinib.

[0018] In another preferred embodiment, the liver cancer cells are SNU398 cells.

[0019] In another preferred embodiment, the liver cancer cells are liver cancer cells that low-express, normally-express or highly-express circUCK2.

[0020] In another preferred embodiment, the normal expression refers to that the expression level of circUCK2 is the average level of circUCK2 expression in all liver cancer patients.

[0021] In another preferred embodiment, circUCK2 binds to miR-149-5p to release the inhibition of CNIH4 by miR-149-5p, and the released inhibition of CNIH4 enhances TGFa secretion, thereby activating EGFR.

[0022] In another preferred embodiment, circUCK2 is used as a biological marker to predict the sensitivity of liver cancer patients to combined treatment with tyrosine kinase inhibitors and EGFR inhibitors, and to guide clinical medication.

[0023] In another preferred embodiment, the expression of circUCK2 in liver cancer cells is increased, and the sensitivity of the liver cancer cells to the combined treatment of tyrosine kinase inhibitors and EGFR inhibitors is improved.

[0024] In another preferred embodiment, the expression of circUCK2 in liver cancer cells is increased, and the expression of miR-149-5p is decreased, and the sensitivity of the liver cancer cells to the combined treatment of tyrosine kinase inhibitors and EGFR inhibitors is improved.

[0025] In another preferred embodiment, the expression of circUCK2 in liver cancer cells is increased, the expression of miR-149-5p is decreased, and the expression of CNIH4 is increased, and the sensitivity of the liver cancer cells to the combined treatment of tyrosine kinase inhibitors and EGFR inhibitors is improved.

[0026] In another preferred embodiment, the expression of circUCK2 in liver cancer cells is increased, the expression of miR-149-5p is decreased, the expression of CNIH4 is increased, and the expression of TGFa is increased, and the sensitivity of the liver cancer cells to the combined treatment of tyrosine kinase inhibitors and EGFR inhibitors is improved.

[0027] In another preferred embodiment, the expression of circUCK2 is increased, the expression of miR-149-5p is decreased, the expression of CNIH4 is increased, the expression of TGFa is increased, and the expression of phosphorylated EGFR is increased in liver cancer cells, and the sensitivity of the liver cancer cells to the combined treatment of tyrosine kinase inhibitors and EGFR inhibitors is improved.

[0028] In another preferred embodiment, the increase means that the content of circUCK2 is 1 / 3 higher than the content of normally expressed circUCK2, preferably 1 / 2, and more preferably 2 / 3 or more.

[0029] In another preferred embodiment, the reduction means that the content of circUCK2 is 1 / 3 lower than the content of normally expressed circUCK2, preferably 1 / 2, and more preferably 2 / 3 or more.

[0030] In a second aspect of the present invention, a pharmaceutical composition is provided, comprising:

[0031] (1) Tyrosine kinase inhibitors;

[0032] (2) epidermal growth factor receptor (EGFR) inhibitors; and

[0033] (3) circUCK2, mRNA expressing circUCK2, or vector expressing circUCK2.

[0034] In another preferred embodiment, the tyrosine kinase inhibitor is selected from the following group: lenvatinib, sorafenib, regorafenib, donafenib, imatinib, sorafenib, sunitinib, lapatinib, and dasatinib.

[0035] In another preferred embodiment, the EGFR inhibitor is selected from the following group: pelitinib, gefitinib, erlotinib, icotinib, afatinib, dacomitinib, osimertinib, and ametinib.

[0036] In another preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0037] In another preferred embodiment, the pharmaceutical composition is used to reverse the drug resistance of liver cancer cells to (A) and / or (B).

[0038] In another preferred embodiment, the pharmaceutical composition is used to enhance the sensitivity of liver cancer cells to the combined treatment of tyrosinase inhibitors and EGFR inhibitors.

[0039] In another preferred embodiment, the pharmaceutical composition is used to treat liver cancer.

[0040] In a third aspect of the present invention, a method for improving the sensitivity of liver cancer cells to combined treatment with a tyrosinase inhibitor and an EGFR inhibitor is provided, the method comprising the steps of:

[0041] (Z1) preparing a circUCK2 overexpression element; and

[0042] (Z2) Co-culturing the circUCK2 overexpression element with liver cancer cells.

[0043] In another preferred embodiment, the circUCK2 overexpression element is circUCK2, mRNA expressing circUCK2, or a vector expressing circUCK2.

[0044] In another preferred embodiment, the circUCK2 overexpression element is a plasmid that transiently overexpresses circUCK2.

[0045] In another preferred embodiment, the circUCK2 overexpression element is a gene editor that stably overexpresses circUCK2.

[0046] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0047] In another preferred embodiment, the method is also used to reverse the resistance of liver cancer cells to tyrosinase inhibitors and / or EGFR inhibitors.

[0048] In a fourth aspect of the present invention, a medicine kit is provided, comprising:

[0049] (A) a first pharmaceutical composition, comprising: a tyrosine kinase inhibitor as an active ingredient, and a pharmaceutically acceptable carrier;

[0050] (B) a second pharmaceutical composition comprising: an EGFR inhibitor as an active ingredient, and a pharmaceutically acceptable carrier; and

[0051] (C) A third pharmaceutical composition, comprising: circUCK2, mRNA expressing circUCK2, or a vector expressing circUCK2 as an active ingredient, and a pharmaceutically acceptable carrier.

[0052] In another preferred embodiment, the kit further comprises (D) a detection reagent, wherein the detection reagent comprises:

[0053] (D1) Detection reagent for detecting the content of circUCK2 in liver cancer cells;

[0054] (D2) a detection reagent for detecting the content of hsa-miR-149-5p in liver cancer cells;

[0055] (D3) a detection reagent for detecting the content of CNIH4 in liver cancer cells;

[0056] (D4) a detection reagent for detecting the content of TGFa in liver cancer cells; and / or

[0057] (D5) A detection reagent for detecting the content of phosphorylated EGFR in liver cancer cells.

[0058] In another preferred embodiment, the drug kit can also be used to determine whether a liver cancer patient is suitable for combined treatment:

[0059] If the detection values ​​C1, C2, C3, C4, and C5 of circUCK2 content, hsa-miR-149-5p content, CNIH4 content, TGFa content and / or phosphorylated EGFR content in liver cancer patients are compared with the average values ​​C01, C02, C03, C04, and C05 of the corresponding indexes in the overall liver cancer patients,

[0060] If the ratios of C1 / C01, C02 / C2, C3 / C03, C4 / C04, and C5 / C05 are >1.5, preferably >2, and more preferably >3, it is suggested that (A) and (B) in the kit can be used directly for combined treatment;

[0061] If the ratio of C1 / C01, C02 / C2, C3 / C03, C4 / C04, and C5 / C05 is ≤2 / 3, preferably ≤1 / 2, and more preferably ≤1 / 3, it is suggested that (C) of this drug kit should be used first to increase the circUCK2 content of liver cancer patients, and then (A) and (B) in this drug kit should be used for combined treatment.

[0062] In another preferred embodiment, the kit can also be used to determine the effect of combined therapy:

[0063] If after administration of the drug of the present invention, the detection values ​​H1, H2, H3, H4, and H5 of the circUCK2 content, the hsa-miR-149-5p content, the CNIH4 content, the TGFa content, and the phosphorylated EGFR content in the patient's liver cancer cells are compared with the detection values ​​H01, H02, H03, H04, and H05 of the corresponding indicators before administration, if the ratios of H1 / H0, H02 / H2, H3 / H03, H4 / H04, and H5 / H05 are ≤2 / 3, preferably ≤1 / 2, and more preferably ≤1 / 3, it means that the drug of the present invention has a therapeutic effect on liver cancer and can continue to be used.

[0064] In another preferred embodiment, the medicine kit further comprises instructions for guiding the use of the pharmaceutical composition or detection reagent.

[0065] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 A mechanistic diagram showing how circUCK2 affects liver cancer progression and drug treatment.

[0067] Figure 2The following are shown: (A) the characteristic structure of circUCK2 in a specific embodiment of the present invention, and the first-generation sequencing map of the splicing site of the circUCK2 amplification product; (B) circUCK2 is highly expressed in liver cancer; (C) the expression level of circUCK2 is correlated with the age of liver cancer patients, history of HBV infection, and degree of tumor differentiation; (D) the expression level of circUCK2 is negatively correlated with the tumor-free survival rate of liver cancer patients within 5 years after surgery; (E) the expression level of circUCK2 is negatively correlated with the tumor-free survival rate of liver cancer patients within 1 year after surgery; (F) univariate and multivariate analyses showed that circUCK2 can be used as an independent risk factor for predicting tumor-free survival in liver cancer patients after surgery.

[0068] Figure 3 It shows that: (AB) knocking down the expression of circUCK2 inhibits the growth of liver cancer cells; (C) knocking down the expression of circUCK2 inhibits the migration and infiltration of liver cancer cells; (DE) knocking down the expression of circUCK2 inhibits the tumorigenesis of liver cancer; (F) knocking down the expression of circUCK2 inhibits the lung metastasis of liver cancer.

[0069] Figure 4 The following are shown: (A) Bioinformatics analysis showed that circUCK2 may bind to hsa-miR-149-5p and hsa-miR-580-3p; (B) circular RNA pull-down experiments showed that only hsa-miR-149-5p could bind to circUCK2; (C and D) luciferase reporter gene experiments confirmed that circUCK2 could bind to circUCK2; (EG) knockdown of circUCK2 reduced the expression of CNIH4 and the secretion of TGFa; (HJ) overexpression of circUCK2 enhanced the expression of CNIH4 and the secretion of TGFa; (K) knockdown or overexpression of circUCK2 could reduce or increase the activity of EGFR, respectively.

[0070] Figure 5 The results show that: (A) Hepatocellular carcinoma cells overexpressing circUCK2 are sensitive to pelitinib combined with lenvatinib treatment; (BE) Among the four primary hepatocellular carcinoma tumors, PDX#1 and PDX#2 showed high expression of circUCK2, CNIH4, and TGFa and activated EGFR, while PDX#3 and PDX#4 showed low expression of circUCK2, CNIH4, and TGFa and inactivated EGFR; (F) The PDX model showed that primary hepatocellular carcinoma tissues with high expression of circUCK2 were sensitive to pelitinib combined with lenvatinib treatment. DETAILED DESCRIPTION

[0071] After extensive and in-depth research, the inventors have developed a use of circular RNA-circUCK2 in the treatment of hepatocellular carcinoma. More specifically, by overexpressing circUCK2 elements or directly adding circUCK2, the sensitivity of hepatocellular carcinoma cells to the combined treatment of tyrosine kinase inhibitors and EGFR inhibitors is increased. Experiments have shown that in the case of high expression of circUCK2, the combined treatment has a stronger killing effect on hepatocellular carcinoma cells. On this basis, the present invention was completed.

[0072] the term

[0073] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because such methods and conditions can be changed.

[0074] As used herein, the terms "comprise", "include", and "contain" are used interchangeably and include not only closed definitions, but also semi-closed and open definitions. In other words, the terms include "consisting of", "consisting essentially of".

[0075] As used in the present invention, "circUCK2" and "circUCK2 (2,3)" are used interchangeably to indicate the RNA circularized from the second to the third exon of the gene UCK2.

[0076] As used herein, "hepatocellular carcinoma", "HCC" and "liver cancer" are used interchangeably.

[0077] circUCK2

[0078] circUCK2 is a circular RNA that contains the second to third exons of the UCK2 gene, and its circularized nucleotide sequence has 257 bases.

[0079] Circular RNAs (circRNAs) and their linear host mRNAs are generated from the same precursor mRNA by reverse splicing and classical splicing, respectively, which suggests that their expression may be in a competitive splicing mode, and theoretically their expression levels should be negatively correlated. This assumption is based on the premise that the production of circular RNA is determined only by the efficiency of reverse splicing. However, in reality, multiple factors can affect the expression of circular RNA, including reverse splicing efficiency, transcription elongation rate (TER) of RNA polymerase II (Pol II), the presence of intron reverse splicing signals (ICSs), spliceosomes, RNA binding proteins, and epigenetic modifications. Under the combined action of all these specific regulatory factors, the expression correlation between circular RNA and its host gene is usually weak. In the present invention, it was found that the correlation between circUCK2 (2,3) and its host gene UCK2 was weak.

[0080] miR-149-5p

[0081] The function of miR-149-5p has been studied in a variety of diseases, including cancer. In hepatocellular carcinoma (HCC), miR-149-5p has been reported to inhibit tumor progression. Through bioinformatics analysis, ChIRP experiments and dual luciferase reporter experiments, the present invention verified the direct binding between circUCK2 (2,3) and miR-149-5p.

[0082] Furthermore, miR-149-5p mimics or inhibitors reversed the promoting or inhibiting effects of circUCK2(2,3) overexpression or knockdown on HCC cells, respectively. In addition, circUCK2(2,3) mutants with mutations in the miR-149-5p binding site lost the ability to promote cell proliferation, migration, and invasion in vitro, as well as tumor growth and metastasis in vivo. Therefore, these findings strongly suggest that circUCK2(2,3) exerts its pro-oncogenic role in HCC by acting as a “sponge” for miR-149-5p.

[0083] CNIH4

[0084] CNIH4 is a member of the CORNICHON family and plays an evolutionarily conserved role in the transport and secretion of TGFα and the intracellular trafficking of G protein-coupled receptors (GPCRs) from the endoplasmic reticulum (ER) to the plasma membrane. Although high expression of CNIH4 was observed in mouse germ cells, genetic knockout of Cnih4 did not affect the reproductive development and fertility of mice. The role of CNIH4 in HCC and its underlying mechanisms have not been explored.

[0085] The present invention demonstrates that CNIH4 expression is upregulated in HCC tissues and positively correlated with the expression of circUCK2(2,3). In HCC patients, high CNIH4 expression is associated with lower overall survival and disease-free survival. In addition, downregulation of CNIH4 inhibits the proliferation and migration of HCC cells, suggesting that CNIH4 may play an important role in HCC progression and may serve as a potential therapeutic target.

[0086] TGFα

[0087] TGFα is a membrane-bound or soluble ligand of EGFR. Overexpression of TGFα or activation of its signaling pathway is closely associated with the initiation and progression of HCC. For example, spontaneous HCC development was observed in transgenic mice expressing human TGFα; co-expression of TGFα significantly accelerated HCC formation in c-Myc transgenic mice. Although both TGFα and EGF are high-affinity ligands for EGFR, elevated secretion of TGFα was observed in 65% of HCC patients, while only 16% of HCC patients showed increased EGF secretion. This suggests that TGFα may play a major role in EGFR signaling activation in HCC.

[0088] The present invention demonstrates that circUCK2(2,3) releases CNIH4 by adsorbing miR-149-5p, thereby protecting it from the inhibition of miR-149-5p, thereby increasing the secretion of TGFα and activating EGFR signaling.

[0089] circUCK2-hsa-miR-149-5p-CNIH4-TGFa-EGFR pathway

[0090] This invention proves a protein pathway related to liver cancer: circUCK2 is highly expressed in liver cancer, and by binding to miR-149-5p, it relieves the inhibition of miR-149-5p on CNIH4, and the relieved inhibition of CNIH4 enhances TGFa secretion, thereby activating EGFR. On the one hand, it can promote the proliferation, migration and infiltration of liver cancer, and on the other hand, it makes liver cancer more sensitive to the treatment of EGFR inhibitors combined with lenvatinib.

[0091] Tyrosine kinase inhibitors

[0092] The tyrosine kinase inhibitor described in the present invention refers to a multi-target tyrosine kinase inhibitor, which is mainly used to treat various types of cancer. It inhibits multiple receptor tyrosine kinases related to tumor growth and metastasis, such as vascular endothelial growth factor receptor (VEGFR), fibroblast growth factor receptor (FGFR) and other receptors, inhibits cell signal transduction, thereby inhibiting the growth and proliferation of tumor cells and promoting cell apoptosis.

[0093] Lenvatinib used in the embodiments of the present invention is one of the multi-target tyrosine kinase inhibitors and has been approved as a first-line targeted therapeutic drug for advanced liver cancer.

[0094] EGFR inhibitors

[0095] EGFR is a member of the transmembrane receptor tyrosine kinase family and consists of three different domains, including the extracellular domain, the transmembrane domain, and the intracellular domain. EGFR is easily bound to its ligand, which usually leads to receptor dimerization, activates the activity of intracellular tyrosine protein kinase, phosphorylates the C-terminal tyrosine residue, triggers downstream enzymes such as Ras, Raf, and PI3K, and thus initiates a series of complex and cross-signal transduction pathways downstream. EGFR regulates cell growth, differentiation, and apoptosis by mediating these signaling pathways.

[0096] The pelitinib used in the embodiment of the present invention is one of the EGFR inhibitors. Since lenvatinib has developed drug resistance, and studies have found that high EGFR expression or EGFR pathway activation is one of the main causes of lenvatinib resistance. Therefore, EGFR inhibitors are combined with lenvatinib for treatment to enhance the ability to kill cancer cells.

[0097] Combination therapy

[0098] The combined treatment of the present invention refers to the combined treatment of liver cancer patients with tyrosine kinase inhibitors and EGFR inhibitors. In a specific embodiment of the present invention, the tyrosine kinase inhibitor lenvatinib and the EGFR inhibitor pelitinib are used for combined treatment. Lenvatinib is effective as a first-line treatment for unresectable HCC, but it has problems such as drug resistance, significant side effects, and limited efficacy in certain patient subgroups. Studies have shown that the combination of lenvatinib and EGFR inhibitors may enhance the therapeutic effect of HCC.

[0099] In the present invention, overexpression of circUCK2(2,3) can further enhance the synergistic killing effect of lenvatinib in combination with multiple EGFR inhibitors, and this effect has been verified in both HCC cells and PDX clinical models.

[0100] Compared with the prior art, the advantages of the present invention are as follows:

[0101] 1. The present invention discovered a new molecular mechanism for regulating liver cancer progression: circUCK2 is highly expressed in liver cancer and releases the inhibition of CNIH4 by miR-149-5p by binding to miR-149-5p. The released CNIH4 enhances TGFa secretion, thereby activating EGFR, thereby promoting the proliferation, migration and infiltration of liver cancer.

[0102] 2. The present invention also proves that: although high expression of circUCK2 is associated with promoting liver cancer proliferation, its high expression also increases the sensitivity of liver cancer cells to combined treatment with EGFR inhibitors and lenvatinib, providing a new idea for liver cancer treatment.

[0103] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0104] Experimental methods

[0105] 1. Construction of circUCK2 overexpression plasmid

[0106] circUCK2 contains the second to third exons of the UCK2 gene, and its circularized nucleotide sequence has 257 bases.

[0107] The DNA sequence corresponding to circUCK2 is:

[0108] TCTTCCGTGTGTGCTAAGATCGTGCAGCTCCTGGGGCAGAATGAGGTGGACTATCGCCAAGCAGGTGGTCATCCTGAGCCAGGATAGCTTCTACCGTGTCCTTACCTCGGAGCAGAAGGCCAAAGC CCTGAAGGGCCAGTTCAACTTTGACCACCCGGATGCCTTTGACAATGAACTCATTCTCAAAACACTCAAAGAAATCACTGAAGGGAAAACAGTCCAGATCCCCGTGTATGACTTTGTCTCCCATTCCCG

[0109] The reagent used for quantitative detection of circular RNA includes primers for amplifying the circular RNA, and the primers include:

[0110] F: 5'-TTGAATTCCAGGATAGCTTCTACCGTGTCC-3'

[0111] R: 5'-TTGGATCCGATAGTCCACCTCATTCTGCCC-3'.

[0112] Plasmid construction: Using Novozyme Phanta Max Super-Fidelity DNA Polymerase, PCR amplified the DNA fragment of circUCK2. The specific PCR reaction system is as follows:

[0113] Water: 18ul, 2×Phanta Max Buffer: 25ul, dNTP Mix (10mM each): 1ul, upstream primer (F, 10μM): 2ul, downstream primer (R, 10μM): 2ul, Phanta Max Super-Fidelity DNA Polymerase: 1ul, cDNA template: 1ul.

[0114] The specific PCR amplification procedure is as follows:

[0115] ①95℃3min, ②95℃15s, ③60℃15s, ④72℃15s, steps ② to ④ are cycled 35 times. ⑤72℃5min, ⑥cool down to room temperature.

[0116] After obtaining the PCR amplification product, EcoR1 and BamH1 were used to digest the PCR product and the circRNA overexpression plasmid pLC5-ciR, respectively, and T4 ligase was used to ligate the circUCK2 fragment into pLC5-ciR.

[0117] siRNA sequences used to downregulate circUCK2:

[0118] siNC sequence: UUCUCCGAACGUGUCACGUTT,

[0119] si-1 sequence: CCAUUCCCGUCUUCCGUGUTT,

[0120] si-2 sequence: UCCCGUCUUCCGUGUGUGCTT.

[0121] 2. circUCK2 pull-down experiment

[0122] CircUCK2(2,3) pull-down assay was performed using ChIRP. HCC cells were first cross-linked with 4% glutaraldehyde for 10 min, and then cross-linked with 1 / 10 volume of 1.25 M glycine for 5 min at room temperature. 1 ml of cell lysis buffer (50 mM Tris-Cl pH 7.0, 10 mM EDTA, 1% SDS, fresh protease inhibitors, PMSF and RNase inhibitors) was added per 100 mg of cell pellet. After cell lysis and sonication, 1% of the cell lysate (10 μL) was removed.

[0123] Biotinylated DNA probes targeting circUCK2 (circ probe) or linear UCK2 (lin probe) (Ribobio Co, Shanghai, China) were added and incubated with cell lysate at 37°C for 4 h. Streptavidin-coupled immunomagnetic M-280 beads (Thermo Scientific, M-280) were then added to the mixture of cell lysate and probe and incubated at 37°C for 30 min. After incubation, half of the immunomagnetic beads were collected, washed and digested with proteinase K to remove proteins for subsequent qRT-PCR to detect the enrichment of circUCK2 or TaqMan miRNA assays to detect the binding of circUCK2 to miRNA. The other half of the immunomagnetic beads were boiled in loading buffer at 95-100°C for 5 min, followed by western blotting to detect the binding of circUCK2 (2,3) to AGO2.

[0124] 3. Patient-derived xenograft (PDX) model establishment

[0125] Hepatocellular carcinoma (HCC) specimens were removed and cut into 3 mm 3 The small pieces were then implanted into the subcutaneous tissue of the anterior flank of 6- to 8-week-old female BALB / c nude mice under anesthesia. The whole process was completed within 2 hours. 3 Mice were randomly assigned to receive treatment once every five days, with treatment regimens including: control group, lenvatinib (oral gavage at a dose of 4 mg / kg), pelitinib (oral gavage at a dose of 10 mg / kg), or a combination of the two. Each single drug in the combination treatment was administered at the same dose and dosing schedule as when used alone. Tumor volume was measured with a caliper and calculated according to the modified ellipsoid formula: tumor volume = 1 / 2 × length × (width)2. In the survival curve analysis, treatment continued until the tumor volume reached 2000mm 3 .

[0126] 4. Clinical HCC tissue samples

[0127] The research on human tissues used in the present invention was approved by the Institutional Ethics Review Committees of Jinling Hospital, Nanjing University Medical School (DZQH-KYLL-24-01) and Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine (XHEC-D-2023-109) and was conducted in accordance with the principles of the Declaration of Helsinki.

[0128] Methods: Forty paired HCC tissues and peritumoral tissues were collected from the Department of Transplantation Surgery, Xinhua Hospital, Shanghai Jiao Tong University, referred to as the Xinhua cohort. Seventy paired HCC tissues and peritumoral tissues were collected from the Department of Surgical Oncology, Jinling Hospital, Medical College of Nanjing University, referred to as the Jinling cohort. All patients had not received anticancer treatment before surgery. Written informed consent for the use of clinical information was obtained from all patients. All fresh tissues were quickly frozen in liquid nitrogen and then stored at -80°C for further research.

[0129] 5. circRNA Sequencing

[0130] Five paired HCC tissues and peritumoral tissues were selected for circRNA sequencing. Total RNA was isolated using TRIzol reagent. Ribosomal RNA was removed from the samples using the Ribo Zero Magnetic kit. Non-circular RNA was removed by RNase R treatment, and circular RNA was fragmented by magnesium-based RNA cleavage. Subsequently, RNA-seq libraries were prepared using the TruSeqTMStrand Total RNA Library Prep Kit and sent to Majorbio for deep sequencing on the Illumina HiSeq4000 system.

[0131] FASTQ reads were aligned to the human reference genome (hg38 / GRCh38). CIRI2 was used to identify circRNAs. In the first scan of the SAM alignment, CIRI2 detected junction reads with PCC signals that reflected a circRNA candidate. Preliminary filtering used paired-end mapping (PEM) and GT-AG splicing signals. After clustering junction reads and recording each circRNA candidate sequence, CIRI scanned the SAM alignment again to detect additional junction reads, while further filtering was performed to eliminate false positive candidates due to mis-positioned reads of homologous genes or repetitive sequences.

[0132] To identify DEcircRNAs (differentially expressed circRNAs) between HCC tissues and peritumoral tissues, the expression level of each circRNA was calculated according to the reads per million mapped reads (RPM) method. CircRNAs whose expression could be detected in all five HCC tissues were selected for differential expression analysis using DEGseq, and circRNAs with |log2(foldchange)|≥1 and p-adjust≤0.05 were considered to be significantly differentially expressed.

[0133] 6. RNA Immunoprecipitation (RIP)

[0134] AGO2 RIP detection was performed using the Magana RIP RNA-binding Protein Immunoprecipitation Kit (Millipore, USA) according to the manufacturer's protocol. 7 Cells were lysed in 200 μL lysis buffer containing protease inhibitors and RNase inhibitors. 0.5% of the cell lysate (1 ml) was transferred to a clean tube as input. Magnetic beads were pre-incubated with anti-ago2 antibody (CST#2897) or isotype control (CST#3900) at room temperature for 1 hour and then incubated with cell lysate at 4°C overnight. RNA precipitates were purified using miRNeasy Mini Kit and subjected to qRT-PCR analysis.

[0135] Example 1. circUCK2 affects liver cancer progression and drug treatment

[0136] Figure 1 A new molecular mechanism for regulating liver cancer progression was demonstrated: circUCK2 is highly expressed in liver cancer. It binds to miR-149-5p and releases the inhibition of CNIH4 by miR-149-5p. The released CNIH4 enhances TGFa secretion, thereby activating EGFR. On the one hand, it can promote the proliferation, migration and infiltration of liver cancer, and on the other hand, it makes liver cancer more sensitive to the treatment of EGFR inhibitors combined with lenvatinib.

[0137] Example 2. High expression of circUCK2 is associated with liver cancer

[0138] Analysis of the relationship between circUCK2 expression and clinical pathological characteristics of liver cancer patients revealed that circUCK2 was highly expressed in liver cancer, and the high expression of circUCK2 was associated with the age of liver cancer patients, history of HBV infection, and degree of tumor differentiation. Figure 2 AC)

[0139] The results of survival analysis showed that the expression level of circUCK2 in liver cancer patients was significantly negatively correlated with the recurrence-free survival rate of liver cancer patients. In addition, through univariate and multivariate analysis, it was found that increased expression of circUCK2 was considered to be an independent risk factor for recurrence-free survival, indicating that high circUCK2 expression level can be used as one of the important indicators for judging the prognosis of liver cancer patients. ( Figure 2 DF)

[0140] Example 3. circUCK2 promotes the proliferation and metastasis of liver cancer cells

[0141] Functional studies have shown that circUCK2 can promote the proliferation and metastasis of liver cancer cells. In vitro experiments have shown that knocking down circUCK2 can significantly inhibit the growth, migration and invasion of liver cancer cells ( Figure 3AC), in vivo experiments showed that knockdown of circUCK2 inhibited tumorigenesis and lung metastasis of liver cancer cells ( Figure 3 DF).

[0142] The above results indicate that circUCK2 can be used as a therapeutic target for liver cancer.

[0143] Example 4. circUCK2-hsa-miR-149-5p-CNIH4-TGFa-EGFR pathway analysis

[0144] The public databases: ENCORI, circBank, and CircInteractome were used to analyze the miRNAs that circUCK2 might bind to. By taking the intersection of the predictions from the three databases, it was found that circUCK2 might bind to hsa-miR-149-5p and hsa-miR-580-3p ( Figure 4 A).

[0145] Using RNA pull-down experiments targeting circUCK2, circUCK2 was enriched, and using the TaqMan miRNAassay kit (Thermo Fisher, USA), it was found that hsa-miR-149-5p could be enriched in the pull-down product of circUCK2, while hsa-miR-580-3p could not, indicating that hsa-miR-149-5p can bind to circUCK2 ( Figure 4 B).

[0146] To further demonstrate that hsa-miR-149-5p binds to circUCK2, a luciferase reporter gene with a normal circUCK2 sequence (WT) or a circUCK2 sequence with a mutation in the hsa-miR-149-5p binding site (MUT149) was constructed. Figure 4 C).

[0147] Luciferase reporter gene assays showed that hsa-miR-149-5p could inhibit the luciferase activity of circUCK2 with normal sequence (WT), but did not affect the luciferase activity of circUCK2 with mutation in hsa-miR-149-5p binding site (MUT149). Figure 4 D).

[0148] Since CNIH4 is a target of hsa-miR-149-5p, knockdown of circUCK2 at the cellular and tumor levels revealed that knockdown of circUCK2 could reduce the expression of CNIH4 ( Figure 4 E and 4F).

[0149] After overexpression of circUCK2 at the cell level and tumor level, it was found that overexpression of the normal circUCK2 sequence (WT) could upregulate the level of CNIH4, but overexpression of the circUCK2 sequence with a mutation in the hsa-miR-149-5p binding site (149-mut) had no effect on the level of CNIH4 ( Figure 4 H and 4I).

[0150] Since CNIH4 can help the secretion of TGFa, an ELISA kit (Neobioscience, EHC125a.96, China) was used to detect whether circUCK2 could affect the secretion of TGFa. The results showed that knocking down circUCK2 could significantly reduce the secretion of TGFa ( Figure 4 G), overexpression of circUCK2 but not overexpression of circUCK2 with hsa-miR-149-5p binding site mutation can significantly enhance the secretion of TGFa ( Figure 4 J).

[0151] Since TGFa is a high-affinity ligand for EGFR, we began to test whether circUCK2 could affect the activation of EGFR. The results showed that knockdown or overexpression of circUCK2 could inhibit or activate EGFR, respectively. Figure 4 K).

[0152] The above experimental results show that high expression of circUCK2 can relieve the inhibitory effect of hsa-miR-149-5p on CNIH4, thereby enhancing the secretion of TGFa in liver cancer cells (detected by ELISA), and TGFa can activate EGFR.

[0153] Example 5. High expression of circUCK2 increases the sensitivity of liver cancer cells to combined treatment with EGFR inhibitors pelitinib and lenvatinib

[0154] High expression of circUCK2 makes liver cancer cells more sensitive to treatment with the EGFR inhibitor pelitinib combined with lenvatinib.

[0155] Using a clone formation experiment, we tested whether circUCK2 could affect the sensitivity of liver cancer cells to the EGFR inhibitor pelitinib combined with lenvatinib. The results showed that when circUCK2 was not overexpressed, the liver cancer cell line SNU398 was insensitive to pelitinib combined with lenvatinib treatment, but circUCK2 overexpression could significantly enhance the sensitivity of SNU398 to pelitinib combined with lenvatinib treatment ( Figure 5 A).

[0156] In addition, this phenotype was confirmed in a patient-derived tumor xenograft model (PDX). Four patient-derived liver cancer xenograft models were constructed, and the results of qPCR detection showed that the expression level of circUCK2 in PDX#1 and PDX#2 was high, while the expression level of circUCK2 in PDX#3 and PDX#4 was low ( Figure 5 B).

[0157] Correspondingly, the qPCR test results showed that the expression level of CNIH4 in PDX#3 and PDX#4 was high, while the expression level of CNIH4 in PDX#3 and PDX#4 was low ( Figure 5 C).

[0158] The ELISA kit further demonstrated that TGFa was highly expressed in PDX#1 and PDX#2, but was less expressed in PDX#3 and PDX#4 ( Figure 5 D).

[0159] Immunoblotting experiments demonstrated that EGFR was activated in PDX#1 and PDX#2, but less activated in PDX#3 and PDX#4 ( Figure 5 E).

[0160] Finally, these four PDXs were inoculated subcutaneously into nude mice, and the tumors were treated with lenvatinib, pelitinib, and lenvatinib combined with pelitinib, respectively. The results showed that compared with lenvatinib alone, PDX#1 and PDX#2, which showed high expression of circUCK2, CNIH4, and TGFa and highly activated EGFR, were more sensitive to lenvatinib combined with pelitinib treatment, while PDX#3 and PDX#4, which showed low expression of circUCK2, CNIH4, and TGFa and weak EGFR activation, were not sensitive to lenvatinib combined with pelitinib treatment ( Figure 5 F).

[0161] The above results indicate that the expression levels of circUCK2, CNIH4, and TGFa and the activation level of EGFR in primary HCC can help clinicians develop personalized treatment strategies (using lenvatinib monotherapy or EGFR inhibitors combined with lenvatinib).

[0162] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A use of an active ingredient, characterized in that: For preparing a preparation or a pharmaceutical composition, wherein the preparation or the pharmaceutical composition is used to increase the sensitivity of liver cancer cells to the combined treatment of tyrosine kinase inhibitors and epidermal growth factor receptor (EGFR) inhibitors, Wherein, the active ingredient is selected from the following group: (a) circUCK2; (b) expressing circUCK2 mRNA; and / or (c) Vector expressing circUCK2.

2. The use according to claim 1, characterized in that The tyrosine kinase inhibitor is selected from the following group: lenvatinib, sorafenib, regorafenib, donafenib, imatinib, sorafenib, sunitinib, lapatinib, dasatinib.

3. The use according to claim 1, characterized in that The EGFR inhibitor is selected from the following group: pelitinib, gefitinib, erlotinib, icotinib, afatinib, dacomitinib, osimertinib, and ametinib.

4. The use according to claim 1, characterized in that The combination therapy of the tyrosine kinase inhibitor and the EGFR inhibitor is a treatment using lenvatinib and pelitinib in combination.

5. The use according to claim 1, characterized in that The circUCK2 binds to miR-149-5p, relieves the inhibition of miR-149-5p on CNIH4, and the relieved CNIH4 enhances TGFa secretion, thereby activating EGFR.

6. The use according to claim 1, characterized in that circUCK2 is used as a biomarker to predict the sensitivity of HCC patients to combined treatment with tyrosine kinase inhibitors and EGFR inhibitors.

7. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: (A) Tyrosine kinase inhibitors; (B) epidermal growth factor receptor (EGFR) inhibitors; and (C) circUCK2, mRNA expressing circUCK2, or vector expressing circUCK2.

8. A method for improving the sensitivity of liver cancer cells to combined treatment with a tyrosinase inhibitor and an EGFR inhibitor, characterized in that: The method comprises the steps of: (Z1) preparing a circUCK2 overexpression element; and (Z2) Co-culturing the circUCK2 overexpression element with liver cancer cells.

9. A medicine box, characterized in that: The medicine kit comprises: (A) a first pharmaceutical composition, comprising: a tyrosine kinase inhibitor as an active ingredient, and a pharmaceutically acceptable carrier; (B) a second pharmaceutical composition comprising: an EGFR inhibitor as an active ingredient, and a pharmaceutically acceptable carrier; and (C) A third pharmaceutical composition, comprising: circUCK2, mRNA expressing circUCK2, or a vector expressing circUCK2 as an active ingredient, and a pharmaceutically acceptable carrier.

10. The medicine box according to claim 9, characterized in that The kit further comprises (D) a detection reagent, wherein the detection reagent comprises: (D1) Detection reagent for detecting the content of circUCK2 in liver cancer cells; (D2) a detection reagent for detecting the content of hsa-miR-149-5p in liver cancer cells; (D3) a detection reagent for detecting the content of CNIH4 in liver cancer cells; (D4) a detection reagent for detecting the content of TGFa in liver cancer cells; and / or (D5) A detection reagent for detecting the content of phosphorylated EGFR in liver cancer cells.

Images