Nanometer antibody for broad-spectrum recognition of quinolones and preparation method and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a nano antibody of a broad-spectrum recognizable quinolone medicine as well as a preparation method and application of the nano antibody. According to the invention, camelidae animals are immunized by using artificial antigens of quinolones, a phage display nano antibody library is constructed, and a high-sensitivity nano antibody capable of broad-spectrum recognition of quinolones is obtained through a conformation superposition screening method. The nano antibody can recognize at least 39 quinolones drugs. In addition, the antibody has strong environmental adaptability, and can tolerate an alkaline solution with a pH value of 12, 80% methanol and 40% acetonitrile solution. Therefore, the prepared quinolone medicine nano antibody with wide recognition spectrum, high affinity and good tolerance has important significance on establishment of a quinolone medicine multi-residue immunoassay technology and product development.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nano antibody capable of broadly recognizing quinolone drugs, and a preparation method and application thereof. Background Art

[0002] Quinolones (QNs) are a class of broad-spectrum antibacterial drugs with a 4-quinolone ring. Due to their low price, broad antibacterial spectrum, strong antibacterial activity, and high bioavailability, they are widely used in animal husbandry, aquaculture, and human disease treatment. However, once the accumulation of such drugs in the human body exceeds the safe range, it can cause central nervous system toxicity, skin toxicity, and phototoxicity. In addition, low-concentration quinolone drug residues in animal foods can easily induce drug resistance in a variety of pathogens, posing a serious threat to public health safety. Therefore, it is particularly important to establish a highly sensitive and rapid detection technology that can uniformly identify quinolones across a broad spectrum, and to monitor the residues of such drugs in a timely and accurate manner.

[0003] At present, the detection technologies for quinolone drug residues mainly include instrumental analysis and immunoassay. The instrumental analysis method has the advantage of high accuracy, but the instrument is expensive and difficult to operate, and is not suitable for rapid screening of large-scale samples on site. The immunoassay based on antigen-antibody specific reaction has the advantages of low price, simplicity, rapidity, high sensitivity, etc., and is widely used in the field of rapid detection of harmful compounds. Antibodies are the core reagents in immunoassays and determine the sensitivity, specificity and stability of the analytical method. However, the existing antibodies have the disadvantages of uneven affinity, low stability, difficulty in transformation and high production cost, and it is urgent to develop new antibody materials. In the prior art, "Characterization, specific recognition, and the performance in fish matrix of a shark-derived single-domain antibody against enrofloxacin" discloses a shark-derived quinolone drug nanoantibody, but the nanoantibody can only recognize enrofloxacin and does not have broad-spectrum recognition.

[0004] Therefore, it is urgent to develop a nanobody with broad-spectrum recognition for quinolone drugs. Summary of the invention

[0005] The present invention separates lymphocytes from the peripheral blood of camels immunized with quinolone drugs, extracts RNA, constructs a quinolone nano-antibody phage display library, and obtains a nano-antibody with strong stability, high sensitivity, and uniform recognition of multiple quinolone drugs through a screening method of quinolone drug conformation classification superposition. The antibody of the present invention is derived from camels and has the advantages of high tolerance, simple structure, and convenient modification.

[0006] Based on this, in the first aspect, the present invention provides a nanobody or a quinolone-specific recognition fragment with broad-spectrum recognition of quinolone drugs, comprising the following complementary determining regions: CDR-H1:NYPMT; CDR-H2:TIDSGGSSTYYADAVKG; CDR-H3: DRYIGDDYRGNP.

[0007] Preferably, the amino acid sequence of the quinolone nanobody or quinolone specific recognition fragment is: (1) as shown in SEQ ID NO.1; or

[0008] (2) An amino acid sequence obtained by connecting a tag peptide to the N-terminus and / or C-terminus of the sequence shown in SEQ ID NO.1.

[0009] In a second aspect, the present invention provides a nucleic acid molecule encoding a nanobody or a quinolone-specific recognition fragment of the quinolone drug.

[0010] Since the genetic code is degenerate, the nucleic acid molecule can be different according to different application purposes.

[0011] Preferably, the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO.2.

[0012] The nucleic acid molecules of the present invention can be expressed by a suitable expression system to obtain the corresponding protein or polypeptide, including but not limited to bacteria, yeast, filamentous fungi, animal cells, insect cells, plant cells or cell-free expression systems.

[0013] In a third aspect, the present invention provides a biomaterial, wherein the biomaterial contains the nano-antibody or quinolone-specific recognition fragment of the quinolone drug, or the nucleic acid molecule; the biomaterial includes at least one of recombinant DNA, an expression cassette, a plasmid vector, a viral vector, an engineered bacterium, and a transgenic cell line.

[0014] In a fourth aspect, the present invention provides a quinolone drug detection reagent or kit, wherein the detection reagent or kit contains the quinolone drug nanoantibody or quinolone drug specific recognition fragment, or the nucleic acid molecule, or the biological material.

[0015] In a fifth aspect, the present invention provides a medicine, which contains the nano-antibody of the quinolone drug or the specific recognition fragment of the quinolone drug, or the nucleic acid molecule, or the biological material.

[0016] In a sixth aspect, the present invention provides an ELISA detection kit for the analysis of quinolone drug residues, the ELISA detection kit comprising a box body, a detachable ELISA plate disposed in the box body, and reagents disposed in the box body; each well of the ELISA plate is coated with an artificial quinolone drug antigen, the reagents comprising a nano-antibody of the quinolone drug or a quinolone drug-specific recognition fragment, as well as a quinolone drug standard solution, an enzyme-labeled secondary antibody, a buffer solution (e.g., PBS), a washing solution (e.g., PBST), a color developing solution, and a reaction stopping solution.

[0017] In a seventh aspect, the present invention provides the use of the nanobody of quinolone drugs or the specific recognition fragment of quinolone drugs, the nucleic acid molecule, the biological material, the reagent or kit, the drug or the ELISA detection kit in at least one of the following aspects: (1) Detection of quinolone drugs; (2) Preparation of quinolone drug detection reagents or kits; (3) Enrichment and purification of quinolone drugs; (4) Preparation of enrichment and / or purification reagents for quinolone drugs.

[0018] In an eighth aspect, the present invention provides a method for preparing the nanoantibodies for quinolone drugs or the specific recognition fragments of quinolone drugs, characterized in that it comprises: preparing a phage antibody library and then performing five rounds of panning in sequence, wherein the first round of panning adopts acid elution, the elution standards adopted in the second round of panning are standard products I and standard products II, the standard product I is norfloxacin and sarafloxacin, and the standard product II is ofloxacin and enrofloxacin; the third round of panning adopts standard product III, the standard product III is danofloxacin, moxifloxacin, pazufloxacin and garenoxacin; the fourth round of panning adopts standard product IV, the standard product IV is oxolinic acid, flumequine, nalidixic acid and pipemidic acid; the fifth round of panning adopts standard products I to standard products IV.

[0019] When the nanoantibodies or quinolone-specific recognition fragments of the present invention are used to detect the specific binding ability with quinolone drugs, it includes but is not limited to enzyme-linked immunosorbent assay (ELISA), chemiluminescence immunoassay (CLIA), fluorescence immunoassay (FIA), immunochromatography (LFIA), immunochip method, and affinity chromatography.

[0020] In the specific implementation process, the nanoantibody of the quinolone drug shown in SEQ ID NO.1 can also be used as a precursor and modified by random or site-directed mutagenesis technology to obtain mutants with better properties (water solubility, stability, affinity and specificity, etc.), and these mutants all fall within the scope of protection of the present invention.

[0021] Compared with the prior art, the present invention has the following beneficial effects: The nanoantibodies against quinolone drugs provided by the present invention can accurately and sensitively detect multiple quinolone drug residues in samples. 50 The antibody has the characteristics of simple structure, resistance to alkaline solutions, resistance to organic solvents and easy production, which is of great significance for the on-site detection of quinolone drug residues in low-cost and large-volume samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the structural diagram of the hapten of quinolone drugs.

[0023] Figure 2 Structural analysis of nanobodies against quinolones.

[0024] Figure 3 This is the standard curve established for the detection of norfloxacin using the indirect competitive ELISA method in Example 4 of the present invention.

[0025] Figure 4 This is the pH tolerance test result of the quinolone drug nanobody in Example 5 of the present invention.

[0026] Figure 5 This is the methanol tolerance test result of the quinolone drug nanobody in Example 5 of the present invention.

[0027] Figure 6 This is the acetonitrile tolerance test result of the quinolone drug nanobody in Example 5 of the present invention. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] If no specific techniques or conditions are specified in the examples, all of them are conventional methods or are carried out according to the techniques or conditions described in the literature in this field, or according to the product instructions. If no manufacturer is specified for the reagents and instruments used, all of them are conventional products that can be purchased through regular channels. The conventional methods refer to Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or follow the conditions recommended in the manufacturer's instructions.

[0030] Example 1 Construction of anti-quinolone nanobody immune library

[0031] 1. Norfloxacin (NOR) Figure 1 ) were coupled with ovalbumin (OVA) and keyhole limpet hemocyanin (KLH) by the active ester method to obtain artificial antigens NOR-OVA and NOR-KLH.

[0032] 2. Take 300 μg NOR-KLH and emulsify it with an equal volume of Freund's complete adjuvant, and then inject it subcutaneously at multiple points in the neck of Bactrian camels for immunization. Perform booster immunization every 3 weeks, using 150 μg NOR-KLH mixed with an equal volume of Freund's incomplete adjuvant for emulsification. Seven days after each immunization, venous blood was collected to separate the heavy chain antibodies from the traditional antibodies in the serum. The specificity and sensitivity of the heavy chain antibodies were determined by indirect competitive ELISA, and the blood samples with the best sensitivity were selected for lymphocyte separation.

[0033] 3. The total RNA of lymphocytes was extracted by Trizol method, and the first-chain cDNA was synthesized according to the instructions of the reverse transcription kit of Invitrogen Company.

[0034] 4. Using Taq Mix DNA polymerase, obtain the variable region encoding gene of the heavy chain antibody by two rounds of PCR. The upstream primer sequence of the first round of PCR is F1: 5′- GTCCTGGCTGCTCTTCTACAAGG -3′ (SEQ ID NO.3), and the downstream primer sequence is R1: 5′- GGTACGTGCTGTTGAACTGTTCC -3′ (SEQ ID NO.4). The PCR reaction conditions are: 95°C 5min; 95°C 30 s, 55°C 30 s, 72°C 1 min, 30 cycles; 72°C 10 min. The PCR product was subjected to 1% agarose gel electrophoresis, and the target fragment of 650bp-750bp was recovered by DNA fragment recovery kit. The recovered target fragment was used as a template for the second round of PCR. The upstream primer sequence of the second round of PCR was F1: 5′- CATGCCATGACTGTGGCCCAGGCGGCCGAGTCTGGGGGAGR -3′ (SEQ ID NO.5, R represents a degenerate primer, which is A or G), and the downstream primer sequence was R1: 5′-CATGCCATGACTCGCGGCCGGCCTGGCCTGAGGAGACGGTGACCTGGGT -3′ (SEQ ID NO.6). The PCR product was subjected to 1% agarose gel electrophoresis, and the target fragment of 400-500 bp was recovered by DNA fragment recovery kit, and then quantified and stored at -20 °C for later use. The phagemid pcomb3x and the second round of PCR amplification product were digested with sfiI endonuclease at 50 °C for 3 hours. After identification by 1% agarose gel electrophoresis, the target fragment was excised and recovered. The target fragment was ligated at 16 °C overnight using T4 DNA ligase. The ligation product was dialyzed to remove salt ions, and the concentration was measured and stored at -20 °C for later use.

[0035] 5. Take 100 ng of the ligation product and place it in the E. coli ER2738 electroporation competent cells for electroporation transformation (a total of 10 tubes). Gradient dilution of the transformed bacterial solution, spread it on a plate containing ampicillin, culture it at 37 °C overnight, and count the colonies to calculate the library capacity of the transformation library. Randomly pick the single clones on the plate and send them to the biological company for sequencing to identify the diversity of the library capacity. Centrifuge the remaining bacterial solution and discard the supernatant. Spread all the precipitates on the ampicillin plate and culture it at 37 °C overnight. Scrape the bacterial lawn on the culture plate with 2×YTG medium to obtain the quinolone drug nanoantibody gene library. Add glycerol at a final concentration of 20% and then aliquot it and store it at -80 °C for later use.

[0036] 6. Take 1 mL of the nanoantibody gene library and add it to 200 mL of 2×YTG liquid culture medium containing ampicillin. Culture at 37 °C and 240 rpm until OD600 ≈0.6, add helper phage M13KO7 at a multiplicity of infection of 20:1, stand at 37 °C for 30 min, shake at 240 rpm for 30 min, centrifuge at 5000 rpm for 10 min, discard the supernatant, resuspend the bacteria in 2×YT medium containing kanamycin and ampicillin, and culture overnight at 37 °C and 240 rpm. Centrifuge the overnight bacteria at 4000 rpm for 20 min, take the supernatant and add 1 / 5 volume of 20% PEG-NaCl solution, and culture overnight at 4 °C. Centrifuge at 12000 rpm for 20 min, add 1 mL PBS to resuspend the precipitate, and filter with a 0.45 μm membrane to obtain the quinolone drug phage display nanoantibody library. Take 10 μL of the phage display nanoantibody library for gradient dilution, stand at 37 °C for 30 min to infect Escherichia coli in the logarithmic phase, and count the colonies to calculate the library capacity of the phage display nanoantibody library.

[0037] Example 2 Screening and identification of anti-quinolone nanobodies

[0038] Nanobodies against quinolone drugs were selected from the quinolone drug phage display nanobody library prepared in Example 1 by a panning method of conformational classification superposition. The specific panning scheme is shown in Table 1.

[0039] 1. Add 100 μL of the prepared NOR-OVA coating to each well of the microplate and coat at 37 °C for 2 h; discard the liquid in the wells, wash 3 times with PBST, and spin dry; add 300 μL of 5% skim milk to each well, block at 37 °C for 1.5 h; discard the liquid in the wells, wash 3 times with PBST, spin dry for later use.

[0040] 2. First round of panning: Add 5% OVA solution to the prepared phage antibody library, block at 37 °C for 1 h. Add 100 μL / well of the blocked phage antibody library to the coated plate (the original coating concentration is 10 μg / mL), incubate at 37 °C for 1 h; discard the liquid in the well, wash 10 times with PBST, then wash 5 times with PBS, and spin dry. Add 100 μL of eluent (0.2M glycine, pH 2.2) to each well, place on a shaker, react at 25 °C for 8 min, and add 30 μL Tris-HCl (1 M, pH 8.0). Take 10 μL for titer determination, and the rest of the eluate infects Escherichia coli ER2738 in the logarithmic phase, and prepare the next round of phage library according to the method of Example 1.

[0041] Second to fifth rounds of panning: In order to obtain nanobodies that can broadly recognize quinolone drugs, 39 quinolone drugs were divided into four categories according to the different conformations of quinolone drugs, and representative quinolone drugs were selected for competitive elution. The prepared phage antibody library was blocked according to the method of the first round. 100 μL / well of the blocked phage antibody library was added to the coated plate (the original coating concentration was 1 μg / mL), incubated at 37°C for 1 h; the liquid in the well was discarded, washed 10 times with PBST, then washed 5 times with PBS, and dried. 100 ng / mL of quinolone drug standards Ⅰ (norfloxacin and sarafloxacin) and Ⅱ (ofloxacin and enrofloxacin) were added to each well, incubated at 37°C for 1 h for competitive elution. 10 μL was taken for titer determination, and the remaining eluate was used to infect Escherichia coli ER2738 in the logarithmic phase, and the next round of phage library was prepared according to the method of Example 1. The third and fourth rounds of panning were the same as the second round. The third round used quinolone drug standard III (danofloxacin, moxifloxacin, pazufloxacin and garenoxacin), the fourth round used quinolone drug standard IV (oxolinic acid, flumequine, nalidixic acid and pipemidic acid), and the fifth round reduced the coating original concentration to 0.1 μg / mL and used 1 ng / mL quinolone drug standards I-IV.

[0042] 3. After five rounds of panning, randomly select single clones and use indirect competitive phage-ELISA to determine the titer, sensitivity and cross-reaction rate of phage-displayed nanoantibodies. The positive clones with wide sensitivity and cross-reaction spectrum in phage-ELISA were sent to a biotechnology service company for sequencing to obtain the base sequence of the quinolone nanoantibody (SEQ ID NO.2), and the amino acid sequence encoded by it is shown in SEQ ID NO.1. The structural analysis of the quinolone nanoantibody is shown in Figure 2 As shown, the domain of its amino acid sequence includes four framework regions (FR) and three complementarity-determining regions (CDR).

[0043] Table 1 Five rounds of panning conditions for camels and the corresponding phage input / output and enrichment results

[0044] Example 3 Soluble expression, purification and identification of quinolone drug nanobodies

[0045] 1. The obtained quinolone drug nanoantibody sequence was sent to a biotechnology service company for synthesis. The synthetic nanoantibody and expression vector pJB33 were digested with restriction endonuclease sfiI. The quinolone drug nanoantibody gene and pJB33 vector gene were recovered by 1% agarose gel electrophoresis. The obtained quinolone drug nanoantibody gene fragment was connected with the expression vector pJB33 using T4 DNA ligase to obtain a recombinant expression plasmid, which was transformed into BL21 (DE3) competent cells. The transformed bacterial solution was spread on a 2×YT plate containing ampicillin and inverted at 37 °C for 16 h. A single colony was picked and shaken at 240 rpm for 12 h. The bacterial solution PCR was performed, and the bacterial solution of the positive clone with the correct band size was sent to a biotechnology service company for sequencing.

[0046] 2. Inoculate the positive clones with correct sequencing into 2×TY medium containing ampicillin and culture at 37 °C with shaking until OD 600 ≈0.6-0.8, add IPTG (0.1 mM), 150 rpm, 25 °C to induce expression for 16 h. After induction, the bacterial solution was centrifuged at 4000 rpm for 15 min and the supernatant was discarded. The periplasmic cavity protein was extracted by ultrasonic disruption. It was then purified by nickel column and gradient eluted with different concentrations of imidazole (100 mM, 150 mM, 200 mM, 250 mM, 300 mM). The purified nanoantibodies were identified by SDS-PAGE and indirect competitive ELISA.

[0047] Example 4: Use of quinolone nanoantibodies for the detection of quinolone drugs

[0048] 1. Determine the optimal antigen-antibody concentration by the chessboard method. Dilute the original NOR-OVA to different concentrations for coating. After blocking, add 50 μL PBS to each well, then add 50 μL of the diluted quinolone drug nanoantibody. After reacting for 30 minutes, wash and add enzyme-labeled secondary antibody. After incubation, add TMB colorimetric solution. After reacting for 10 minutes, add stop solution and read OD on the microplate reader. 450 The antigen-antibody concentrations corresponding to the wells with OD values ​​of 1.5-2.0 were selected as the optimal working concentrations of the coating source and antibody.

[0049] 2. According to the original coating concentration determined above, 100 μL / well, 37°C, 2h for coating; wash the plate 3 times with PBST and spin dry; add 5% skim milk (w / v), 150 μL / well, and block at 37°C for 1 h; wash the plate 3 times with PBST and spin dry; add 50 μL of gradient diluted quinolone drug standard solution to each well, and add 50 μL of quinolone drug nanoantibody prepared in Example 2 at the same time, and react at 37°C for 30 min. Wash the plate 3 times with PBST, pat dry, add horseradish peroxidase-labeled rabbit anti-C-MYC tag antibody, 100 μL / well, and incubate at 37°C for 30 min. Wash the plate 3 times with PBST, pat dry, add 100 μL / well TMB colorimetric solution, and color at 37°C in the dark for 10 min; add 50 μL / well stop solution (2 M H2SO4), and read the absorbance at 450 nm. The logarithm of each concentration of quinolone drugs was used as the abscissa, and the OD value corresponding to each concentration of quinolone drugs was used as the ordinate. Origin 8.5 software was used to draw a standard curve according to the four-parameter logarithmic fitting.

[0050] The results are as follows Figure 3 As shown, the IC of this antibody against norfloxacin 50 The concentration of quinolone agonist is 1.2 ng / mL, with a broad recognition spectrum, capable of identifying at least 39 quinolones including ofloxacin, norfloxacin, lomefloxacin, pefloxacin, enrofloxacin, ciprofloxacin, sarafloxacin, difloxacin, and sparfloxacin (Table 2).

[0051] Table 2 IC values ​​of nanobodies against 39 QNs 50 value

[0052] Example 5 Tolerance analysis of quinolone nanobodies

[0053] 1. The pH tolerance and organic solvent tolerance of quinolone nanoantibodies were determined in the same way as the indirect competitive ELISA standard curve. The antibodies were reacted in different pH solutions (5, 6, 7, 8, 9, 10, 11 and 12), different concentrations of methanol solutions (80%, 40%, 20%, 10%, 5% and 2.5%), and different concentrations of acetonitrile solutions (40%, 20%, 10%, 5% and 2.5%), and their IC values ​​under different conditions were determined. 50 value.

[0054] 2. The results are as follows Figure 4 , Figure 5 and Figure 6 As shown, the antibody can still work normally in PB solution with pH 12, 80% methanol and 40% acetonitrile, indicating that it has strong tolerance to alkaline solutions and organic solvents.

[0055] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A nanobody or a quinolone-specific recognition fragment, characterized in that: The complementarity determining regions include: CDR-H1:NYPMT; CDR-H2:TIDSGGSSTYYADAVKG; CDR-H3: DRYIGDDYRGNP.

2. The nanobody or quinolone-specific recognition fragment of claim 1, characterized in that: The amino acid sequence is: (1) as shown in SEQ ID NO.1; or (2) An amino acid sequence obtained by connecting a tag peptide to the N-terminus and / or C-terminus of the sequence shown in SEQ ID NO.

1.

3. A nucleic acid molecule encoding a nanobody or a quinolone-specific recognition fragment of the quinolone drug according to claim 1 or 2.

4. The nucleic acid molecule according to claim 3, characterized in that The nucleotide sequence is shown in SEQ ID NO.

2.

5. A biomaterial, characterized in that: The biological material contains the nano-antibody or quinolone-specific recognition fragment of claim 1 or 2, or the nucleic acid molecule of claim 3 or 4; the biological material includes at least one of recombinant DNA, expression cassette, plasmid vector, viral vector, engineered bacteria, and transgenic cell line.

6. A quinolone drug detection reagent or kit, characterized in that: The detection reagent or kit contains the nano-antibody or quinolone-specific recognition fragment of claim 1 or 2, or the nucleic acid molecule of claim 3 or 4, or the biological material of claim 5.

7. A medicine, characterized in that: The medicine contains the nano-antibody or quinolone-specific recognition fragment of claim 1 or 2, or the nucleic acid molecule of claim 3 or 4, or the biomaterial of claim 5.

8. An ELISA detection kit for quinolone drug residue analysis, characterized in that: The ELISA detection kit comprises a box body, a detachable enzyme-labeled plate arranged in the box body, and reagents arranged in the box body; each well of the enzyme-labeled plate is coated with an artificial antigen of quinolone drugs, and the reagents comprise the nano-antibody of quinolone drugs or the specific recognition fragment of quinolone drugs according to claim 1 or 2, as well as a quinolone drug standard solution, an enzyme-labeled secondary antibody, a buffer solution, a washing solution, a color developing solution, and a reaction stopping solution.

9. Use of the nanobody or quinolone-specific recognition fragment of claim 1 or 2, the nucleic acid molecule of claim 3 or 4, the biomaterial of claim 5, the reagent or kit of claim 6, the drug of claim 7 or the ELISA detection kit of claim 8 in at least one of the following aspects: (1) Detection of quinolone drugs; (2) Preparation of quinolone drug detection reagents or kits; (3) Enrichment and purification of quinolone drugs; (4) Preparation of enrichment and / or purification reagents for quinolone drugs.

10. The method for preparing the nanobody or quinolone-specific recognition fragment of claim 1 or 2, characterized in that: include: After the phage antibody library was prepared, five rounds of panning were carried out in sequence, wherein the first round of panning used acid elution, the second round of panning used elution standards of standard sample I and standard sample II, wherein standard sample I was norfloxacin and sarafloxacin, and standard sample II was ofloxacin and enrofloxacin; the third round of panning used standard sample III, wherein standard sample III was danofloxacin, moxifloxacin, pazufloxacin and garenoxacin; the fourth round of panning used standard sample IV, wherein standard sample IV was oxolinic acid, flumequine, nalidixic acid and pipemidic acid; the fifth round of panning used standard samples I to IV.

Images