Heart-targeted extracellular vesicle, extracellular vesicle for treating cardiovascular diseases as well as preparation method and application of extracellular vesicle

Abstract

The invention provides a heart-targeted extracellular vesicle, an extracellular vesicle for treating cardiovascular diseases and a preparation method and application of the extracellular vesicle, and belongs to the technical field of biomedicine. The extracellular vesicle contains a fusion sequence of Lamp-2b and heart targeting peptide CMP, and research finds that the heart targeting extracellular vesicle has a heart targeting effect and can be used as a novel delivery tool system for heart targeting therapy. According to the invention, miR-30d is loaded on the heart targeted extracellular vesicle to obtain the extracellular vesicle for treating cardiovascular diseases, so that the extracellular vesicle has obvious effects of treating cardiovascular diseases such as heart ischemia reperfusion injury and cardiac hypertrophy, and a new treatment mode is provided for clinical treatment of cardiovascular diseases. Meanwhile, targeted delivery of therapeutic drugs is performed by using the cardiac targeted extracellular vesicles, so that the purpose of efficiently preventing and treating heart diseases is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a heart-targeted extracellular vesicle, an extracellular vesicle for treating cardiovascular diseases, and a preparation method and application thereof. Background Art

[0002] Cardiovascular disease is the leading cause of death worldwide. With the aging of the population and the widespread prevalence of cardiovascular disease risk factors, the prevalence of cardiovascular disease will continue to rise. Among them, diseases such as cardiac ischemia-reperfusion injury and myocardial hypertrophy have a high incidence and lack of treatment.

[0003] Extracellular vesicles are nanoparticles with endogenous membrane structures secreted by cell culture, containing substances such as proteins, nucleic acids and lipids, and are used as delivery tools to participate in biological processes such as intercellular communication. Since extracellular vesicles are endogenous biological molecules, they have the characteristics of low immunogenicity and good safety. Natural extracellular vesicles lack targeting, but giving extracellular vesicles targeting is the key to achieving targeted delivery of extracellular vesicles. At present, targeted modification on the surface of extracellular vesicles is divided into biological modification and chemical modification. Biological modification can fuse specific polypeptide sequences or ligand sequences into the surface of extracellular vesicles through genetic engineering methods, so that the surface of extracellular vesicles has targeting peptides. This method makes up for the lack of targeting of natural extracellular vesicles. Chemical modification uses natural or synthetic ligands to modify them to the surface of extracellular vesicles through coupling reactions or lipid assembly, but this method will be affected by the complex structure of the membrane surface, the modification efficiency is low, and this assembly method may also destroy the membrane surface structure of extracellular vesicles.

[0004] MicroRNA (miRNA) is a class of widely expressed endogenous non-coding RNA molecules with a length of about 22 nucleotides. MiRNA can participate in many biological processes. MiRNA can inhibit the translation of mRNA or cause transcript degradation by incompletely complementary pairing with mRNA sequences. In the field of cardiovascular research, miRNA has been shown to be associated with cardiovascular diseases such as myocardial infarction, myocardial hypertrophy, and arrhythmia. However, there are no reports on the use of miRNA to prepare heart-targeted extracellular vesicles. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a heart-targeted extracellular vesicle, an extracellular vesicle for treating cardiovascular diseases, and a preparation method and application thereof. The heart-targeted extracellular vesicle described in the present invention serves as a targeted delivery tool for the treatment of cardiovascular diseases, and by loading miR-30d, the heart-targeted delivery of miR-30d is achieved, thereby achieving the effect of treating cardiovascular diseases.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a heart-targeted extracellular vesicle, wherein the extracellular vesicle contains a fusion sequence of Lamp-2b and a heart-targeted peptide CMP; the fusion sequence of Lamp-2b and the heart-targeted peptide CMP is shown as SEQ ID No.11.

[0008] The present invention also provides a method for preparing heart-targeted extracellular vesicles, comprising the following steps:

[0009] Inserting the cardiac targeting peptide CMP sequence into the pcDNA GNSTM-3-RVG-10-Lamp2b-HA plasmid to obtain a recombinant plasmid, transfecting the recombinant plasmid into a host cell to obtain a recombinant cell, culturing the recombinant cell to secrete, and isolating to obtain cardiac targeting extracellular vesicles;

[0010] The host cell is HEK293T cell.

[0011] Preferably, the nucleotide sequence of the cardiac targeting peptide CMP is shown as SEQ ID No.12; the amino acid sequence of the cardiac targeting peptide CMP is shown as SEQ ID No.13.

[0012] Preferably, the usage ratio of the recombinant plasmid to the host cells is 8-12 μg: 2.8-3.2 million cells.

[0013] The present invention also provides an application of the above-mentioned heart-targeted extracellular vesicles or the above-mentioned preparation method in the preparation of heart-targeted products.

[0014] The present invention also provides an extracellular vesicle for treating cardiovascular diseases. The extracellular vesicle for treating cardiovascular diseases is obtained by loading the above-mentioned heart-targeted extracellular vesicle with miR-30d.

[0015] The present invention also provides a method for preparing extracellular vesicles for treating cardiovascular diseases, comprising the following steps:

[0016] Inserting the cardiac targeting peptide CMP sequence into the pcDNA GNSTM-3-RVG-10-Lamp2b-HA plasmid to obtain a recombinant plasmid, transfecting the recombinant plasmid into a host cell to obtain a recombinant cell, and culturing and secreting the recombinant cell to obtain extracellular vesicles for treating cardiovascular diseases;

[0017] The host cell is a HEK293T cell stably transfected with miR-30d;

[0018] The HEK293T cells stably transfected with miR-30d are prepared by co-transfecting HEK293T cells with a plasmid overexpressing miR-30d and a lentiviral packaging plasmid.

[0019] The present invention also provides an application of the extracellular vesicles for treating cardiovascular diseases or the preparation method in preparing drugs for treating cardiovascular diseases.

[0020] The present invention also provides an application of the extracellular vesicle for treating cardiovascular diseases or the preparation method in preparing drugs for targeted treatment of cardiovascular diseases.

[0021] The present invention also provides a drug for treating cardiovascular diseases, which comprises the extracellular vesicles described above or the extracellular vesicles obtained by the above preparation method, and also comprises pharmaceutically acceptable excipients.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention provides a heart-targeted extracellular vesicle, an extracellular vesicle for treating cardiovascular diseases, and a preparation method and application thereof. The present invention modifies a heart-targeted peptide onto the surface of an extracellular vesicle through a Lamp-2b protein to obtain a heart-targeted extracellular vesicle. Studies have found that the heart-targeted extracellular vesicle of the present invention has a heart-targeted effect, and the heart-targeted extracellular vesicle can be used as a new delivery tool system for heart-targeted treatment. The present invention loads miR-30d onto the heart-targeted extracellular vesicle to obtain an extracellular vesicle for treating cardiovascular diseases, which has significant effects on treating cardiovascular diseases such as cardiac ischemia-reperfusion injury and myocardial hypertrophy, and provides a new treatment method for clinical treatment of cardiovascular diseases. At the same time, the present invention uses heart-targeted extracellular vesicles for targeted delivery of therapeutic drugs to achieve the purpose of efficiently preventing and treating heart diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of the principle of constructing a fusion plasmid for homologous recombination;

[0025] Figure 2 Schematic diagram of the structure of pcDNAGNSTM-3-RVG-10-Lamp2b-HA plasmid;

[0026] Figure 3 It is the agarose gel electrophoresis diagram of the linearized product of the plasmid vector amplified by PCR;

[0027] Figure 4 It is the agarose gel electrophoresis diagram of homologous recombination ligation products;

[0028] Figure 5The sequencing results of the target sequences of pcDNAGNSTM-3-EGFP-10-Lamp2b-HA and pcDNAGNSTM-3-CMP-10-Lamp2b-HA;

[0029] Figure 6 Flow chart for the preparation of cardiac-targeted extracellular vesicles using differential centrifugation;

[0030] Figure 7 The results of the nanoparticle tracking analyzer on the particle size of EVs-EGFP and EVs-CMP extracellular vesicles;

[0031] Figure 8 The results of western blotting for detection of EVs-EGFP and EVs-CMP extracellular vesicle surface marker proteins;

[0032] Fig. 9 The results of uptake of EVs-EGFP and EVs-CMP extracellular vesicles by H9C2 cells, HepG2 cells, BEAS-2B cells, and HEK293T cells, respectively;

[0033] Fig.10 The results of H9C2 cells' uptake of EVs-EGFP and EVs-CMP extracellular vesicles detected by flow cytometry, ***p<0.001;

[0034] Fig.11 The enrichment of PBS, EVs-EGFP and EVs-CMP extracellular vesicles in the mouse heart. The left picture shows the fluorescence image of PBS, EVs-EGFP and EVs-CMP extracellular vesicles enriched in the mouse heart. The right picture shows the radiation efficiency of PBS, EVs-EGFP and EVs-CMP extracellular vesicles in the mouse heart. ***p<0.001;

[0035] Fig.12 The results of real-time fluorescence quantitative PCR detection of miR-30d expression in cell lines stably transcribing miR-30d, ***p<0.001;

[0036] Fig.13 The results of real-time fluorescence quantitative PCR detection of miR-30d expression in extracellular vesicles of EVs-CMP-Scramble, EVs-CMP-miR-30d and EVs-EGFP-miR-30d, **p<0.01;

[0037] Fig.14 Transmission electron microscopy was used to detect the size and morphology of EVs-CMP-miR-30d and EVs-EGFP-miR-30d extracellular vesicles;

[0038] Fig.15 Real-time fluorescence quantitative PCR was used to detect the level of miR-30d in cardiac tissues after treatment in different groups, **p<0.01;

[0039] Fig.16 This is a fluorescent image of immunofluorescence staining to detect the level of cardiomyocyte apoptosis;

[0040] Fig.17 Statistical results of immunofluorescence staining to detect cardiomyocyte apoptosis, ***p<0.001;

[0041] Fig.18 Western blotting was used to detect the levels of apoptosis-related proteins Bax / Bcl2 and Caspase3 after extracellular vesicle treatment with EVs-CMP-miR-30d and EVs-EGFP-miR-30d, ***p<0.001;

[0042] Fig.19 Results of detection of miR-30d levels in cardiac tissues after treatment with different extracellular vesicles, **p<0.01, ***p<0.001;

[0043] Fig. 20 The results of echocardiography for detecting cardiac function of mice after treatment with different extracellular vesicles, A is a static picture captured from the cardiac ultrasound dynamic image of Example 5; B is the ejection fraction (EF) measured by the cardiac ultrasound instrument of Example 5; C is the short-axis contraction fraction (FS) measured by the cardiac ultrasound instrument of Example 5, ***p<0.001;

[0044] Fig.21 Masson staining was used to detect the cardiac fibrosis level of mice after treatment with different extracellular vesicles. A is the Masson staining image of the heart tissue of mice after treatment with different extracellular vesicles. B is the statistical result of the cardiac fibrosis area of ​​mice after treatment with different extracellular vesicles. ***p<0.001.

[0045] Fig. 22 This is an experimental flow chart of the effects of extracellular vesicles on cardiac hypertrophy;

[0046] Fig.23 To detect the level of miR-30d in the heart tissue of mice with myocardial hypertrophy treated with cell vesicles, **p<0.01;

[0047] Fig.24 The results of the effect of injection of cell vesicles on cardiac function in mice with myocardial hypertrophy detected by echocardiography, A is a static picture captured by the cardiac ultrasound dynamic image of Example 6; B is the ejection fraction (EF) measured by the cardiac ultrasound instrument of Example 6; C is the short-axis contraction fraction (FS) measured by the cardiac ultrasound instrument of Example 6, ***p<0.001;

[0048] Fig.25 A in the middle is the result of the cross-sectional area of ​​cardiomyocytes after treatment with different extracellular vesicles; B is the statistical result of the cross-sectional area of ​​cardiomyocytes after treatment with different extracellular vesicles, *p<0.05, ***p<0.001;

[0049] Fig.26 Masson staining was used to detect the cardiac fibrosis level in mice with myocardial hypertrophy treated with different extracellular vesicles. *p<0.05, ***p<0.001;

[0050] Fig. 27 HE detection of the effects of different extracellular vesicles on mouse cardiomyocytes, ***p<0.001;

[0051] Fig.28 The results of WGA detection of the effects of different extracellular vesicles treatment on the myocardial size of mice, ***p<0.001. DETAILED DESCRIPTION

[0052] The present invention provides a heart-targeted extracellular vesicle, wherein the extracellular vesicle contains a fusion sequence of Lamp-2b and a heart-targeted peptide CMP; the fusion sequence of Lamp-2b and the heart-targeted peptide CMP is shown as SEQ ID No.11.

[0053] The present invention modifies the surface of the extracellular vesicle by fusing the sequence of the cardiac targeting peptide CMP to the N-terminus of the Lamp-2b protein, thereby making the extracellular vesicle have cardiac targeting property.

[0054] The present invention also provides a method for preparing heart-targeted extracellular vesicles, comprising the following steps:

[0055] The cardiac targeting peptide CMP sequence is inserted into the pcDNA GNSTM-3-RVG-10-Lamp2b-HA plasmid to obtain a recombinant plasmid, the recombinant plasmid is transfected into a host cell to obtain a recombinant cell, and the recombinant cell is cultured, secreted, and separated to obtain cardiac targeting extracellular vesicles; the host cell is a HEK293T cell.

[0056] The heart-targeted extracellular vesicles of the present invention are achieved by gene modification.

[0057] In the present invention, the cardiac targeting peptide CMP sequence is inserted into the pcDNAGNSTM-3-RVG-10-Lamp2b-HA plasmid to obtain a recombinant plasmid. The fusion sequence of Lamp-2b and the cardiac targeting peptide CMP is shown in SEQ ID No.11. The nucleotide sequence of the cardiac targeting peptide CMP is shown in SEQ ID No.12; the amino acid sequence of the cardiac targeting peptide CMP is shown in SEQID No.13. The cardiac targeting peptide CMP sequence is inserted in such a way that the cardiac targeting peptide CMP sequence replaces the RVG fragment. In the present invention, the recombinant plasmid is also called a fusion plasmid, abbreviated as pcDNAGNSTM-3-CMP-10-Lamp2b-HA plasmid. The pcDNAGNSTM-3-RVG-10-Lamp2b-HA plasmid of the present invention is purchased from addgene, catalog number 71294.

[0058] In the present invention, after obtaining the recombinant plasmid, the recombinant plasmid is transfected into the host cell to obtain the recombinant cell. The transfection is assisted by polyethyleneimine (PEI), and the transfection time is preferably 10 to 14 hours, and more preferably 12 hours. The host cell is a HEK293T cell, which is a human embryonic kidney cell. The present invention does not specifically limit the source of HEK293T cells, and commercially available products known in the art can be used. The usage ratio of the recombinant plasmid to the host cell is preferably 8 to 12 μg: 2.8 to 3.2 million cells, more preferably 9 to 11 μg: 2.9 to 3.1 million cells, and more preferably 10 μg: 3 million cells.

[0059] In the present invention, after obtaining the recombinant cells, the recombinant cells are cultured, secreted, and separated to obtain cardiac-targeted extracellular vesicles. The culture is cultured for 48 hours using a 10% fetal bovine serum (FBS) DMEM high-glucose medium (purchased from corning) that does not contain extracellular vesicles. The separation preferably uses a differential centrifugation method, and the specific method is to collect the cell supernatant a by centrifuging the cells at 300×g for 10 minutes after culturing for 48 hours, and centrifuge the collected supernatant a at 4°C, 300×g for 10 minutes to remove live cells and collect supernatant b; in order to remove dead cells, supernatant b is placed in a new centrifuge tube and centrifuged at 4°C, 2000×g for 10 minutes to obtain supernatant c; supernatant c is placed in a new centrifuge tube and centrifuged at 4°C, 10000×g for 30 minutes to remove cell debris to obtain supernatant d; supernatant d is centrifuged at 4°C, 100000×g for 70 minutes using an ultracentrifuge to obtain a precipitate, that is, cardiac-targeted extracellular vesicles are obtained respectively.

[0060] Through research, it is found that the heart-targeted extracellular vesicles of the present invention have heart-targeted function. Therefore, the present invention also provides an application of the above-mentioned heart-targeted extracellular vesicles or the above-mentioned preparation method in the preparation of heart-targeted products.

[0061] In the present invention, the product includes a reagent, a kit or a medicine.

[0062] The present invention also provides an extracellular vesicle for treating cardiovascular diseases. The extracellular vesicle for treating cardiovascular diseases is obtained by loading the above-mentioned heart-targeted extracellular vesicle with miR-30d.

[0063] In the present invention, the extracellular vesicles for treating cardiovascular diseases are also called heart-targeted extracellular vesicles loaded with miR-30d.

[0064] The present invention also provides a method for preparing extracellular vesicles for treating cardiovascular diseases, comprising the following steps:

[0065] Inserting the sequence of the cardiac targeting peptide CMP into the pcDNAGNSTM-3-RVG-10-Lamp2b-HA plasmid to obtain a recombinant plasmid, transfecting the recombinant plasmid into a host cell to obtain a recombinant cell, culturing the recombinant cell to secrete, and isolating to obtain extracellular vesicles for treating cardiovascular diseases;

[0066] The host cell is a HEK293T cell stably transfected with miR-30d;

[0067] The HEK293T cells stably transfected with miR-30d are prepared by co-transfecting HEK293T cells with a plasmid overexpressing miR-30d and a lentiviral packaging plasmid.

[0068] In the present invention, the backbone plasmid of the plasmid overexpressing miR-30d is preferably pLKO.1-TRC vector, and the lentiviral packaging plasmid can be pSPAX2 and pMD2.G. The mass ratio of the plasmid overexpressing miR-30d, pSPAX2 and pMD2.G of the present invention is 4:3:1.

[0069] The present invention also provides an application of the extracellular vesicles for treating cardiovascular diseases or the preparation method in preparing drugs for treating cardiovascular diseases.

[0070] The present invention also provides an application of the extracellular vesicle for treating cardiovascular diseases or the preparation method in preparing drugs for targeted treatment of cardiovascular diseases.

[0071] In the present invention, the cardiovascular disease includes one or more of heart failure and myocardial hypertrophy, and the heart failure is heart failure induced by acute cardiac ischemia and re-injury.

[0072] The present invention also provides a drug for treating cardiovascular diseases, which comprises the extracellular vesicles described above or the extracellular vesicles obtained by the above preparation method, and also comprises pharmaceutically acceptable excipients.

[0073] In the present invention, the active ingredient of the drug includes the extracellular vesicles for treating cardiovascular diseases, and the auxiliary materials include one or more of diluents, excipients, flavoring agents, preservatives and surfactants, etc. The mass ratio of the extracellular vesicles for treating cardiovascular diseases in the drug is 30% to 70%.

[0074] In the present invention, the raw materials or components used in the present invention are all products known in the art or commercially available products unless otherwise specified.

[0075] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0076] Example 1

[0077] A method for preparing heart-targeted extracellular vesicles, the preparation method comprising the steps of:

[0078] 1. Construction of a fusion plasmid of the cardiac targeting peptide CMP nucleic acid sequence and the Lamp-2b nucleic acid sequence

[0079] In the construction of the fusion plasmid of the present invention, the nucleic acid sequence of the cardiac targeting peptide CMP and the nucleic acid sequence of Lamp-2b are fused by homologous recombination to obtain the fusion plasmid.

[0080] The present invention uses a homologous recombination method to recombine the linearized vector and the target sequence to obtain a fusion plasmid. The schematic diagram of the homologous recombination method is shown in Figure 1 .

[0081] During homologous recombination, the target sequence and the sequences at both ends of the linearized vector need to be exactly the same as the homology arms. According to the requirements, the 5' and 3' ends of the nucleic acid sequence of the cardiac targeting peptide CMP are respectively designed with the same sequences as the corresponding ends of the plasmid vector. The 5' end sequence is: TGGGCAGTGGATACACCATT (SEQ ID No. 1) and the 3' end sequence is: AATAGCAGAGGGAAGAGAGC (SEQ ID No. 2). At the same time, the ATG sequence is added after the 5' end homology arm, and the GGAGGA sequence is added before the 3' end homology arm. Therefore, the design template of the final synthetic sequence is: 5'-TGGGCAGTGGATACACCATTATG (SEQ ID No. 3)-target sequence-GGAGGAAATAGCAGAGGGAAGAGAGC (SEQ ID No. 4)-3'.

[0082] In the present invention, when constructing a fusion plasmid, the nucleic acid sequence synthesized by the cardiac targeting peptide CMP is as follows:

[0083] CMP-F: TGGGCAGTGGATACACCATTATGTGGCTGAGCGAGGCCGGCCCCGTGGTGACCGTGAGGGCCCTGAG

[0084] GGGCACCGGCAGCTGGGGAGGAAATAGCAGAGGGAAGAGAGC (SEQ ID No. 5);

[0085] CMP-R: GCTCTCTTCCCTCTGCTATTTCCTCCCCAGCTGCCGGTGCCCCTCAGGGCCCTCACGGTCACCACGGGGCCGGCCTCGCTCAGCCACATAATGGTGTATCCACTGCCCA (SEQ ID No. 6).

[0086] At the same time, the present invention also modifies the enhanced green fluorescent protein (Enhanced Green Fluorescent Protein, EGFP) to the surface of the extracellular vesicle as a negative control, so the EGFP nucleic acid sequence is also fused with the Lamp-2b nucleic acid sequence, and a fusion plasmid (EGFP) is constructed by homologous recombination. The nucleic acid sequence of the EGFP is as follows:

[0087] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAA

[0088] CGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTG

[0089] CACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCG

[0090] CTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCAT

[0091] CTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCA

[0092] TCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGC

[0093] CACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAG

[0094] GACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCATCGGCGACGGCCCCGTGCTGCTGCCCGA

[0095] CAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGG

[0096] AG (SEQ ID No. 7).

[0097] The target sequence described in the present invention (ie, CMP and EGFP nucleic acid sequences) is synthesized by conventional synthesis methods in the art. After annealing, the synthesized sequence can be recombined and connected.

[0098] The vector plasmid of the fusion plasmid in the present invention is: pcDNAGNSTM-3-RVG-10-Lamp2b-HA plasmid, the plasmid map is shown in Figure 2 Primers were designed from both ends of the RVG sequence of the vector plasmid, and the plasmid vector was linearized by PCR amplification. The primers designed for the linearization of the plasmid vector are as follows:

[0099] PCR-F: AATAGCAGAGGGAAGAGAGCATCC (SEQ ID No. 8);

[0100] PCR-R: AATGGGTATCCACTGCCCATAG (SEQ ID No. 9).

[0101] The linearized product obtained by PCR was initially identified by agarose gel electrophoresis, where Control (+) indicated a positive control, containing a correctly sequenced target fragment of about 7000 bp in length, and Control (-) indicated a negative control, containing no target fragment DNA. The correctly identified product was then recovered using an agarose gel recovery kit (see Figure 3 ) to obtain the linear pcDNAGNSTM-3-Lamp2b-HA plasmid.

[0102] Figure 3

[0103] The nucleic acid sequence of the synthesized cardiac targeting peptide CMP as shown in SEQ ID No.5 and the nucleic acid sequence of EGFP as shown in SEQ ID No.8 were annealed according to the following procedures to obtain the insertion target fragment (i.e., the nucleic acid sequence of the cardiac targeting peptide CMP or the nucleic acid sequence of EGFP):

[0104] According to the annealing system described in Table 1, add each reagent into a 1.5mL centrifuge tube, put it into a 94℃ water bath, heat it for 5 minutes, turn off the water bath, and wait for it to cool naturally to room temperature. After annealing, the annealed product can be stored in a -20℃ refrigerator for later use. The annealing system is as follows:

[0105] Table 1 Annealing system

[0106] Reagents Dosage Forward target sequence (10nM) 5μL Reverse target sequence (10nM) 5μL 10×NEBBuffer 5μL Ultrapure water 35μL

[0107] Among them, the forward target sequence F: 5'-TGGGCAGTGGATACACCATTATG-3' (SEQ ID No. 14);

[0108] Reverse target sequence R: 5'-GGAGGAAATAGCAGAGGGAAGAGAGC-3' (SEQ ID No. 15).

[0109] According to the homologous recombination reaction system described in Table 2, add the reagents into a 1.5 mL centrifuge tube and mix by pipetting. Prepare the homologous recombination reaction system on ice. The insertion target fragments in Table 2 are respectively the EGFP nucleic acid sequence shown in SEQ ID No. 8 or the CMP nucleic acid sequence shown in SEQ ID No. 5:

[0110] Table 2 Homologous recombination reaction system

[0111]

[0112] The homologous recombination reaction system prepared above was placed in a metal bath at 37°C for 30 minutes, and then placed on ice or frozen for storage. After the homologous recombination reaction was completed, the obtained recombinant product was transformed, cloned, and plasmid extracted, and then the plasmid was preliminarily identified by agarose gel electrophoresis (see Figure 4 ), followed by Sanger sequencing, the sequencing results are shown in Figure 5 .

[0113] Figure 4-5

[0114] The cardiac targeting peptide CMP nucleic acid sequence is as follows:

[0115] TGGCTGAGCGAGCCGGCCCCGTGGTGACCGTGAGGGCCCTGAGGGGCACCGGCAGCTGG (SEQ ID No. 12);

[0116] The amino acid sequence of the heart-targeting CMP is: WLSEAGPVVTVRALRGTGSW (SEQ ID No. 13).

[0117] 2. Packaging, purification and characterization of extracellular vesicles

[0118] HEK293T cells were seeded in a 10 cm cell culture dish. When the cell density reached 3 million cells per dish, 10 μg of the target plasmid (i.e., pcDNA GNSTM-3-CMP-10-Lamp2b-HA or pcDNA GNSTM-3-EGFP-10-Lamp2b-HA) or 10 μg of PBS was added to each dish of cells, and 1 mg / mL polyethyleneimine (PEI) was used to assist in transfection. After transfection for 12 hours, the medium was replaced with 10% FBSDMEM high-glucose medium without extracellular vesicles (preparation of 10% FBS without extracellular vesicles: ultracentrifugation at 100,000 × g, centrifugation at 4 ° C for 10 hours to collect the supernatant, and strict aseptic operation was required throughout the process). After continuing to culture for 48 hours, the cells were centrifuged at 300 × g for 10 minutes to collect the cell supernatant. The collected supernatant a was centrifuged at 4°C, 300×g for 10 min to remove live cells and collect supernatant b; in order to remove dead cells, supernatant b was placed in a new centrifuge tube and centrifuged at 4°C, 2000×g for 10 min to obtain supernatant c; supernatant c was placed in a new centrifuge tube and centrifuged at 4°C, 10000×g for 30 min to remove cell debris and obtain supernatant d; supernatant d was centrifuged at 4°C, 100000×g for 70 min using an ultracentrifuge to obtain a precipitate, namely, cardiac-targeted extracellular vesicles (abbreviated as EVs-CMP), EGFP-modified extracellular vesicles (abbreviated as EVs-EGFP) and extracellular vesicles (abbreviated as PBS, PBS was purchased from Yuanzu Medical and did not contain extracellular vesicles), the supernatant was discarded, the extracellular vesicles were resuspended in 1×PBS and transferred to a 1.5 mL centrifuge tube, and the preparation flow chart of the cardiac-targeted extracellular vesicles is shown in Figure 6 .

[0119] Determination of extracellular vesicle size and particle number: Use a nanoparticle tracking analyzer (Particle Metrix) to detect the particle size and particle number of EVs-CMP and EVs-EGFP. First, use first-level ultrapure water filtered by a 0.22μm filter and 1×PBS to clean the instrument, then dilute the PS beads standard 250,000 times to calibrate the instrument. After calibration, use 1×PBS to clean the instrument, dilute the sample to be tested 5000 times and measure it, and then obtain the particle size and particle number of extracellular vesicles (see Figure 7 ).

[0120] Figure 7 The results showed that the particle size of EVs-CMP was 167.37±0.59nm, and the particle size of EVs-EGFP was 178.10±0.69nm.

[0121] Western blotting was used to detect the expression of extracellular vesicle surface marker proteins CD63, CD9, Tsg101, GAPDH, Tom20, Calnexin and APOA1 in HEK293T cells, EVs-CMP and EVs-EGFP.

[0122] The results showed that CD63, CD9 and Tsg101 were expressed in EVs-CMP and EVs-EGFP, while GAPDH, Tom20, Calnexin and APOA1 were only expressed in HEK293T cells as negative controls (see Figure 8 ).

[0123] Figure 7-Figure 8 The results showed that the present invention successfully constructed heart-targeted extracellular vesicles and EGFP-modified extracellular vesicles.

[0124] Example 2

[0125] The cardiac targeting function of the extracellular vesicles of the cardiac targeting peptide CMP prepared in Example 1 was investigated.

[0126] 1. Extracellular vesicle fluorescent dye labeling: First, EVs-CMP extracellular vesicles were labeled with Did fluorescent dye. The extracellular vesicles were diluted to 1 mL with 1×PBS, and 10 μL of 1 μg / μLDid dye was added to the centrifuge tube, and the tube was treated at room temperature and away from light for 30 minutes. In order to remove free dyes, ultracentrifugation was performed at 100,000×g and 4°C for 70 minutes, and then the supernatant was discarded. The precipitate at the bottom of the ultracentrifuge tube was resuspended with 200 μL 1×PBS to obtain EVs-CMP extracellular vesicles labeled with fluorescent dye (Did).

[0127] 2. Verification of the cardiac targeting of extracellular vesicles at the cellular level

[0128] PBS, Did-stained EVs-CMP extracellular vesicles or EVs-EGFP extracellular vesicles prepared above were added to the wells of H9C2 cells, HepG2 cells, BEAS-2B cells and HEK293T cells, respectively, with the added amount of 1×10 10 Particle number / mL, 50 μL was added to each well. After 3 hours of cell uptake, the culture medium in the well was removed, the cell nucleus was stained with a nuclear dye (Hoechst33342), and then a confocal microscope was used to take pictures to observe the cell uptake of extracellular vesicles. The uptake of extracellular vesicles by HepG2 cells, BEAS-2B cells, and HEK293T cells was used as the control group. The results are shown in Fig. 9 .

[0129] Furthermore, flow cytometry was used to detect the uptake of extracellular vesicles by H9C2 cells. Fig.10 .

[0130] Figure 9-10 The results showed that EVs-CMP could be taken up by H9C2 compared with PBS, HepG2 cells, BEAS-2B cells and HEK293T cells, as well as EVs-EGFP extracellular vesicles.

[0131] 3. Animal level verification of cardiac targeting of extracellular vesicles

[0132] The fluorescently labeled EVs-CMP extracellular vesicles, EVs-EGFP extracellular vesicles and EVs-PBS prepared above were injected into mice by tail vein injection (200 μL per mouse, 1×10 8 / μL), and the mouse hearts were taken out after 24 hours for fluorescence imaging.

[0133] Mouse heart in vivo imaging results showed that EVs-CMP can be enriched in the mouse heart (see Fig.11 ).

[0134] The above results indicate that extracellular vesicles modified with CMP on the surface exhibit good targeting properties at both the cellular and animal levels. Therefore, EVs-CMP is a good cardiac-targeted extracellular vesicle and can be used as a new cardiac-targeted delivery tool.

[0135] Example 3

[0136] 1. Construction of a cell line stably expressing miR-30d

[0137] The method for constructing a cell line stably expressing miR-30d is as follows:

[0138] (1) HEK293T cells were plated in a 10 cm cell culture dish and cultured in a 5% CO2, 37°C environment. When the cell density reached about 95%, transfection was started. Before transfection, the transfection solution was prepared in advance. 1.25 μg pMD2-G, 3.75 μg psPAX.2G, 5 μg miR-30d-OE target plasmid and 100 μg 1 mg / mL PEI were added to the serum-free DMEM culture medium in sequence. After sufficient vortexing, the mixture was allowed to stand for 15 min. Then, 1 mL of the mixture was evenly added to each culture dish. After the addition was completed, the culture dish was gently shaken. Construction of miR-30d-OE target plasmid: The sequence of miR-30d was queried on the miRDB website: UGUAAACAUCCCCGACUGGAAG (SEQ ID No. 16), and then the U in the sequence was rewritten to T to obtain a new sequence: TGTAAACATCCCCGACTGGAAG (SEQ ID No. 17). Then it was reversed and placed into the pLKO.1-TRC vector (purchased from addgene: #10878) sequence, and finally the miR-30d-OE destination plasmid was synthesized by Qingke Biotechnology Company.

[0139] 10 to 12 h after transfection, replace the complete medium;

[0140] (2) After 48 h of culture, the cell supernatant was collected into a 50 mL centrifuge tube;

[0141] (3) After another 24 h of culture, the supernatant can be collected again and placed in a 50 mL centrifuge tube;

[0142] (4) The lentivirus collected in the supernatant was filtered using a 0.22 μm filter and then stored at -20°C.

[0143] (5) HEK293T cells are cultured in advance, and when the cell density grows to about 70%, a stable transcription cell line can be constructed.

[0144] (6) The pre-packaged lentivirus is mixed in a 1:1 volume ratio with the culture medium without serum, and then added to the culture dish. Before mixing, polybrene is added to improve the lentiviral transfection efficiency.

[0145] (7) 12 h after adding the virus, replace the medium in the culture dish with complete medium.

[0146] (8) 48 hours after the culture medium is replaced, in order to allow the virus to express in the cells for a period of time, the cells are passaged again. During the passage, an appropriate amount of puromycin is added to the culture medium to treat the cells. Puromycin can kill HEK293T cells that are not infected with the lentivirus. After 2-3 passages using this method, the treatment is stopped when almost all cells in the control group have died.

[0147] (9) Then, the cells treated with lentivirus and not killed by puromycin were cultured using complete medium.

[0148] (10) The cell line can be subjected to real-time fluorescence quantitative PCR to detect the expression level of miR-30d-OE in the cell line to determine whether the stable transcription cell line is successfully constructed.

[0149] (11) When the density of HEK293T cells grows to more than 90%, the fusion plasmid (CMP) is transfected into the cell culture dish at a dose of 10 μg per well;

[0150] (12) 12 hours after transfection, replace with fresh complete medium (the serum used in this medium must be freed of extracellular vesicles in advance by ultracentrifugation at 100,000 × g, 4°C for 10 hours. The entire process of removing the medium must be performed under strict aseptic conditions.);

[0151] (13) After 24 hours of medium replacement, the cell supernatant was collected, which contained extracellular vesicles;

[0152] (14) Centrifuge the cell supernatant at 300 × g, 4°C for 10 min, retain the supernatant and discard the precipitate;

[0153] (15) The cell supernatant was centrifuged at 2000 × g at 4°C for 10 min, and the supernatant was retained and the precipitate was discarded;

[0154] (16) The cell supernatant was centrifuged at 10,000 × g at 4°C for 30 min, and the supernatant was retained and the precipitate was discarded;

[0155] (17) The supernatant was filtered using a 0.22 μm filter and then subjected to ultracentrifugation.

[0156] (18) The cell supernatant was ultracentrifuged at 100,000 × g and 4 °C for 70 min, and the supernatant was discarded. The precipitate at the bottom of the ultracentrifuge tube was resuspended with 1 mL of PBS (1×). The resuspended solution contained extracellular vesicles and was named EVs-CMP-miR-30d.

[0157] First, a plasmid pLKO.1-miR-30d capable of overexpressing miR-30d was constructed, and the plasmid was used to package lentivirus, and the lentivirus was used to construct a cell line that stably transcribed miR-30d (i.e., HEK293T cells stably transfected with miR-30d, referred to as miR-30d). Real-time fluorescence quantitative PCR was used to detect the level of miR-30d in HEK293T cells stably transfected with miR-30d, and HEK293T cells that were not transfected with miR-30d were used as the control group (i.e., Scramble). The results are shown in Fig.12 .

[0158] Fig.12 The results showed that compared with the control group, the level of miR-30d in HEK293T cells stably transfected with miR-30d was significantly higher than that in the control group, indicating that the present invention successfully obtained HEK293T cells stably transfected with miR-30d.

[0159] 2. Packaging, purification and detection of cardiac-targeted extracellular vesicles loaded with miR-30d

[0160] The cell lines stably transcribing miR-30d were cultured to an appropriate density and used to produce extracellular vesicles loaded with miR-30d. The specific groups were as follows: Group 1: Extracellular vesicles (EVs-CMP-Scramble) were packaged using a stable transfection strain constructed with a control lentivirus; Group 2: Extracellular vesicles (EVs-CMP-miR-30d) with surface modified CMP cardiac targeting peptides were produced using a stable transfection strain overexpressing miR-30d; Group 3: Extracellular vesicles (EVs-EGFP-miR-30d) with surface modified EGFP were packaged using a stable transfection strain overexpressing miR-30d.

[0161] The difference between the preparation of EVs-CMP-Scramble and the above-mentioned part "1" is that step (1) of EVs-CMP-Scramble is to add 5 μg of scramble target plasmid, and the remaining steps are the same as part "1". The sequence of scramble is GGCGGGTTAATCATTAACTACAAGGAACCC (SEQ ID No. 18), and the construction method of scramble target plasmid refers to the construction of fusion plasmid (EGFP) in Example 1.

[0162] The difference between the preparation of EVs-EGFP-miR-30d and the above-mentioned part "1" is that step (11) of EVs-EGFP-miR-30d is to transfect the fusion plasmid (EGFP) of Example 1 into the cell culture dish at a dose of 10 μg per well, and the remaining steps are the same as part "1".

[0163] Real-time fluorescence quantitative PCR was used to detect the level of miR-30d in extracellular vesicles of EVs-CMP-Scramble, EVs-CMP-miR-30d and EVs-EGFP-miR-30d.

[0164] The results showed that the level of miR-30d in EVs-CMP-miR-30d and EVs-EGFP-miR-30d extracellular vesicles was significantly increased compared with that in EVs-CMP-Scramble (see Fig.13 ).

[0165] At the same time, transmission electron microscopy was used to detect the size and morphology of EVs-CMP-miR-30d and EVs-EGFP-miR-30d extracellular vesicles.

[0166] Fig.14 The results showed that the size and morphology of heart-targeted extracellular vesicles loaded with miR-30d detected by transmission electron microscopy were consistent with expectations.

[0167] Figure 12 to Figure 14 The results show that the present invention constructs a cardiac-targeted extracellular vesicle loaded with miR-30d.

[0168] Example 4

[0169] Effects of cardiac-targeted extracellular vesicles loaded with miR-30d (EVs-CMP-miR-30d) on heart failure induced by acute ischemia-reperfusion injury

[0170] 1. Injection of Extracellular Vesicles into Mouse Tail Vein

[0171] The three extracellular vesicles EVs-CMP-Scramble, EVs-CMP-miR-30d, and EVs-EGFP-miR-30d prepared in Example 3 were injected into mice via tail vein injection at a rate of 2^10 10 The dose of the number of particles / mouse was directly injected into the mice. Twelve hours after the injection, the mice were subjected to the establishment of the acute cardiac ischemia-reperfusion injury model.

[0172] 2. Establishment of acute ischemia-reperfusion injury (IRI) model in mice

[0173] The mice were anesthetized with 4% chloral hydrate, and the skin, muscles and adipose tissue of the neck were first separated; after exposing the trachea, surgical scissors were used to cut the organ cartilage ring, and the opening was based on the insertion of the endotracheal tube, and the tube was fixed. The ventilator frequency was set to 120 times / min, and the tidal volume was set to 2mL; after checking the chest contour and breathing of the mouse, the subsequent surgery was performed. Subsequently, a transverse thoracotomy was performed between the fourth and fifth ribs on the left side of the mouse sternum, and the opening length was about 1cm. First, the skin and pectoral muscles were separated layer by layer with surgical scissors; then the intercostal muscles were bluntly separated to expose the heart, and the left anterior descending artery was ligated with 4-0 surgical sutures (the ligation was successful when the apex of the heart turned white after ligation). The cut skin was clamped with hemostatic forceps, the chest was temporarily closed, and ischemia was 30min. After 30min, the sutures used for heart ligation were cut. The intercostal muscles, pectoral muscles and skin were sutured layer by layer. The endotracheal tube was removed and the postoperative wound was disinfected with iodine. The mice were transferred to an electric blanket and allowed to breathe spontaneously until they regained consciousness and were able to crawl autonomously, and then they were returned to the cage. The sham operation group was the same as the operation group except that the left anterior descending artery was not ligated for 30 min.

[0174] The specific grouping was as follows: the mice were treated by tail vein injection using a disposable 1 mL sterile syringe, and the experimental groups were divided into 8 groups.

[0175] Group 1: PBS + sham operation group, all mice were injected with PBS at 200 μL / mouse, and sham operation was performed 12 h after injection;

[0176] Group 2, EVs-CMP-Scramble + sham operation group, all mice were injected with EVs-CMP-Scramble at 200 μL / mouse, and sham operation was performed 12 h after injection;

[0177] Group 3 EVs-CMP-miR-30d + sham operation group, mice were injected with EVs-CMP-miR-30d at 200 μL / mouse, and sham operation was performed 12 h after injection;

[0178] Group 4 EVs-EGFP-miR-30d + sham operation group, mice were injected with EVs-EGFP-miR-30d at 200 μL / mouse, and sham operation was performed 12 h after injection;

[0179] The fifth group, the PBS+surgery group, was injected with PBS at 200 μL / mouse, and underwent acute cardiac ischemia-reperfusion injury surgery 12 h after the injection;

[0180] Group 6 EVs-CMP-Scramble + surgery group, all mice were injected with EVs-CMP-Scramble at 200 μL / mouse, and acute cardiac ischemia-reperfusion injury surgery was performed 12 hours after injection;

[0181] Group 7 EVs-CMP-miR-30d+surgery group, all mice were injected with EVs-CMP-miR-30d at 200 μL / mouse, and acute myocardial ischemia-reperfusion injury surgery was performed 12 hours after injection;

[0182] Group 8 EVs-EGFP-miR-30d+surgery group, all mice were injected with EVs-EGFP-miR-30d at 200 μL / mouse, and acute myocardial ischemia-reperfusion injury surgery was performed 12 hours after injection;

[0183] The experiment ended 24 hours after the injection, and the mouse hearts were dissected. Tissue samples were taken, and total RNA of the heart tissue was extracted. Real-time fluorescence quantitative PCR was used to detect the changes in miR-30d. The heart samples were then subjected to immunofluorescence staining to detect the rate of cardiomyocyte apoptosis, and the apoptosis of cardiomyocytes was counted. At the same time, total protein of the tissue was extracted, and changes in apoptosis-related proteins were detected using protein immunoblotting.

[0184] The results showed that the level of miR-30d in heart tissue was increased in mice injected with EVs-CMP-miR-30d ( Fig.15 ); Immunofluorescence staining results showed that cardiomyocytes underwent apoptosis in the cardiac ischemia-reperfusion injury model, but myocardial cell apoptosis was protected after mice were injected with EVs-CMP-miR-30d (see Figure 16-17 ). Western blotting results showed that the increased levels of apoptosis-related proteins Bax / Bcl2 and Caspase3 were also alleviated after injection of EVs-CMP-miR-30d ( Fig.18 ). Therefore, cardiac-targeted extracellular vesicles loaded with miR-30d (EVs-CMP-miR-30d) can protect the heart from acute ischemia-reperfusion injury-induced heart failure.

[0185] Example 5

[0186] Effects of cardiac-targeted extracellular vesicles loaded with miR-30d (EVs-CMP-miR-30d) on ventricular remodeling induced by ischemia-reperfusion injury

[0187] 1. Construction of a 3-week induced ventricular remodeling model in mice

[0188] The acute ischemia-reperfusion injury surgery of mice was performed in the manner of Example 4, and the mice were injected with extracellular vesicles regularly after the surgery (Day 1, Day 2, Day 4, Day 6, Day 9, Day 12, Day 15, Day 18 and Day 21 after surgery, with an injection dose of 2^10 10 The number of particles / mouse, the injection volume was 200 μL), and the experiment ended 3 weeks after the operation, and the mouse heart was dissected. Tissue samples were taken, and the total RNA of the heart tissue was extracted. Real-time fluorescence quantitative PCR was used to detect the changes of miR-30d, echocardiography was used to detect the cardiac function of the mice, and Masson staining was used to detect the level of cardiac fibrosis. Among them, the extracellular vesicles are EVs-CMP-Scramble, EVs-CMP-miR-30d, and EVs-EGFP-miR-30d prepared in Example 3. The specific experimental groups are as follows:

[0189] Group 1: PBS + sham operation group, all mice were injected with PBS at 200 μL / mouse;

[0190] Group 2: EVs-CMP-Scramble + sham operation group, EVs-CMP-Scramble was injected into mice at 200 μL each time;

[0191] Group 3: EVs-CMP-miR-30d+sham operation group, mice were injected with EVs-CMP-miR-30d at 200 μL / mouse each time;

[0192] Group 4: EVs-EGFP-miR-30d+sham operation group, mice were injected with EVs-EGFP-miR-30d at 200 μL / mouse each time;

[0193] Group 5: PBS+surgery group, mice were injected with PBS at 200 μL / mouse each time;

[0194] Group 6: EVs-CMP-Scramble + surgery group, EVs-CMP-Scramble was injected into mice at 200 μL each time;

[0195] Group 7: EVs-CMP-miR-30d+surgery group, mice were injected with EVs-CMP-miR-30d at 200 μL / mouse each time;

[0196] Group 8: EVs-EGFP-miR-30d+surgery group, mice were injected with EVs-EGFP-miR-30d at 200 μL / mouse each time.

[0197] Real-time fluorescence quantitative PCR was used to detect the level of miR-30d in cardiac tissue after injection of different extracellular vesicles. At the same time, echocardiography was used to detect the cardiac function of mice after injection of different extracellular vesicles. Masson staining was used to detect the level of cardiac fibrosis in mice after injection of different extracellular vesicles.

[0198] The results showed that mice injected with EVs-CMP-miR-30d, and real-time fluorescence quantitative PCR results showed that the level of miR-30d in heart tissue was increased (see Fig.19 ); Echocardiography results showed that the cardiac function of mice significantly decreased 3 weeks after ischemia-reperfusion injury surgery, but injection of EVs-CMP-miR-30d was able to improve the cardiac function of mice (see Fig. 20 Masson staining results showed that the fibrosis level of the mouse heart was also improved after injection of EVs-CMP-miR-30d (see Fig.21 ), the above results indicate that extracellular vesicles loaded with miR-30d can improve ventricular remodeling induced by ischemia-reperfusion injury in mice.

[0199] Example 6

[0200] Effects of cardiac-targeted extracellular vesicles loaded with miR-30d (EVs-CMP-miR-30d) on cardiac hypertrophy (TAC)

[0201] 1. Construction of a mouse model of myocardial hypertrophy induced by aortic arch constriction

[0202] The mice were anesthetized with 4% chloral hydrate, and the skin, muscles and adipose tissue of the neck were separated first; after exposing the trachea, the organ cartilage ring was cut open with surgical scissors, and the opening was based on the insertion of the tracheal tube, and the tube was fixed. The ventilator frequency was set to 120 times / min and the tidal volume was set to 2mL; the subsequent surgery was performed after checking the chest contour and normal breathing of the mouse. Subsequently, two ribs were cut down along the tracheal opening, and the rib opening was propped open with a tractor, and the skin and pectoral muscles were separated layer by layer to expose the aortic arch, and the aortic arch was narrowed with 7-0 non-absorbable surgical sutures. Then, the intercostal muscles, pectoral muscles and skin were sutured layer by layer. The tracheal tube was removed and the postoperative wound was disinfected with iodine. The mice were transferred to an electric blanket to allow the mice to breathe spontaneously until they regained consciousness and were able to crawl autonomously before being put back into the mouse cage. The sham operation group was the same as the surgical group except that no narrowing was performed.

[0203] Myocardial hypertrophy surgery was performed in mice according to the above method. Extracellular vesicles were injected into mice regularly one week after surgery (Day 7, Day 8, Day 9, Day 11, Day 13, Day 16, Day 19, Day 22, Day 25 and Day 28 after surgery, with an injection dose of 2^10 10The number of particles / mouse, the injection volume was 200 μL), the experiment was ended 5 weeks after the operation, and the mouse heart was dissected. Tissue samples were taken, and the total RNA of the heart tissue was extracted. Real-time fluorescence quantitative PCR was used to detect the changes in miR-30d, echocardiography was used to detect the cardiac function of the mice, Masson staining was used to detect the level of cardiac fibrosis, and HE and WGA staining were used to detect the size of the mouse cardiomyocytes. The extracellular vesicles are the three extracellular vesicles EVs-CMP-Scramble, EVs-CMP-miR-30d, and EVs-EGFP-miR-30d prepared in Example 3, and the experimental flow chart of the effect of extracellular vesicles on myocardial hypertrophy is shown in Fig. 22 The specific experimental groups are as follows:

[0204] Group 1: sham operation group + PBS, all mice were injected with PBS at 200 μL / mouse;

[0205] Group 2: Sham operation group + EVs-CMP-Scramble, 200 μL / mouse were injected with EVs-CMP-Scramble each time;

[0206] The third group was sham operation group + EVs-CMP-miR-30d, and mice were injected with EVs-CMP-miR-30d at 200 μL / mouse each time;

[0207] Group 4: sham operation group + EVs-EGFP-miR-30d, mice were injected with EVs-EGFP-miR-30d at 200 μL / mouse each time;

[0208] Group 5: surgery group + PBS, 200 μL / mouse were injected with PBS each time;

[0209] Group 6: surgery group + EVs-CMP-Scramble, EVs-CMP-Scramble was injected into mice at 200 μL / mouse each time;

[0210] Group 7, surgery group + EVs-CMP-miR-30d, mice were injected with EVs-CMP-miR-30d at 200 μL / mouse each time;

[0211] The eighth group was surgery group + EVs-EGFP-miR-30d, and EVs-EGFP-miR-30d was injected into mice at 200 μL / mouse each time.

[0212] Real-time fluorescence quantitative PCR was used to detect the level of miR-30d in cardiac tissue after injection of different extracellular vesicles. At the same time, echocardiography was used to detect the cardiac function of mice after injection of different extracellular vesicles. Masson staining was used to detect the fibrosis level of the mouse heart after injection of different extracellular vesicles. HE and WGA staining were used to detect the size of mouse cardiomyocytes.

[0213] The results showed that mice injected with EVs-CMP-miR-30d, and real-time fluorescence quantitative PCR results showed that the level of miR-30d in heart tissue was increased ( Fig.23 ); Echocardiography results showed that injection of EVs-CMP-miR-30d in mice with myocardial hypertrophy model could improve the cardiac function of mice ( Fig.24 ), heart size decreases ( Fig.25 ). Masson staining results showed that the fibrosis level of mouse hearts was also improved after injection of EVs-CMP-miR-30d ( Fig.26 HE and WGA staining showed that the size of mouse cardiomyocytes was improved after injection of EVs-CMP-miR-30d ( Fig. 27 and Fig.28 ). The above results indicate that extracellular vesicles loaded with miR-30d can improve myocardial hypertrophy induced by aortic arch constriction in mice.

[0214] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A cardiac-targeted extracellular vesicle, characterized in that: The extracellular vesicle contains a fusion sequence of Lamp-2b and a cardiac targeting peptide CMP; the fusion sequence of Lamp-2b and a cardiac targeting peptide CMP is shown as SEQ ID No.

11.

2. A method for preparing heart-targeted extracellular vesicles, characterized in that: The following steps are involved: Inserting the cardiac targeting peptide CMP sequence into the pcDNAGNSTM-3-RVG-10-Lamp2b-HA plasmid to obtain a recombinant plasmid, transfecting the recombinant plasmid into a host cell to obtain a recombinant cell, culturing the recombinant cell to secrete, and isolating to obtain cardiac targeting extracellular vesicles; The host cell is HEK293T cell.

3. The preparation method according to claim 2, characterized in that: The nucleotide sequence of the heart-targeting peptide CMP is shown in SEQ ID No.12; the amino acid sequence of the heart-targeting peptide CMP is shown in SEQ ID No.

13.

4. The preparation method according to claim 2, characterized in that: The usage ratio of the recombinant plasmid to the host cells is 8-12 μg: 2.8-3.2 million cells.

5. Use of the heart-targeted extracellular vesicles according to claim 1 or the preparation method according to any one of claims 2 to 4 in the preparation of heart-targeted products.

6. An extracellular vesicle for treating cardiovascular diseases, characterized in that: The extracellular vesicles for treating cardiovascular diseases are obtained by loading the heart-targeted extracellular vesicles according to claim 1 or 2 with miR-30d.

7. A method for preparing extracellular vesicles for treating cardiovascular diseases, characterized in that: The following steps are involved: Inserting the cardiac targeting peptide CMP sequence into the pcDNAGNSTM-3-RVG-10-Lamp2b-HA plasmid to obtain a recombinant plasmid, transfecting the recombinant plasmid into a host cell to obtain a recombinant cell, and culturing and secreting the recombinant cell to obtain extracellular vesicles for treating cardiovascular diseases; The host cell is a HEK293T cell stably transfected with miR-30d; The HEK293T cells stably transfected with miR-30d are prepared by co-transfecting HEK293T cells with a plasmid overexpressing miR-30d and a lentiviral packaging plasmid.

8. Use of the extracellular vesicles according to claim 6 or the preparation method according to claim 7 in preparing drugs for treating cardiovascular diseases.

9. Use of the extracellular vesicles according to claim 6 or the preparation method according to claim 7 in preparing drugs for targeted treatment of cardiovascular diseases.

10. A drug for treating cardiovascular diseases, characterized in that: The drug includes the extracellular vesicles according to claim 6 or the extracellular vesicles obtained by the preparation method according to claim 7, and also includes pharmaceutically acceptable excipients.

Images