A method for the production of an engineered DEAR nucleic acid manipulation system
By engineering the DEAR nucleic acid manipulation system, extending the substrate recognition region, adding recruitment sequences, and forming heterodimers, the off-target effects and excessively large protein problems of the CRISPR-Cas system were solved, improving its specificity and cleavage activity in gene editing, making it suitable for mammalian eukaryotic cells and Escherichia coli.
Patent Information
- Application Number
- CN202311344851.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-17
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2043-10-17
AI Technical Summary
Existing CRISPR-Cas nuclease systems suffer from off-target effects, excessively large proteins affecting transfection efficiency, and potential immune responses, limiting their application in gene editing.
By engineering the DEAR nucleic acid manipulation system based on RNA ribozymes, its specificity and cleavage activity were improved by extending the substrate recognition region, adding recruitment sequences, and forming heterodimers.
The DEAR nucleic acid manipulation system enhances the specificity and cleavage activity of DNA and RNA targeted modification, making it suitable for gene editing in mammalian eukaryotic cells and Escherichia coli.
Smart Images

Figure CN119842702B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a method for preparing an engineered DEAR nucleic acid manipulation system. Background Technology
[0002] Currently, the gene editing technologies commonly used in my country are all based on RNA-guided CRISPR-Cas nucleases. However, the CRISPR-Cas system still has some problems: First, the CRISPR-Cas system has off-target effects, where editing of Cas proteins in non-target regions may cause uncontrollable harmful mutations; second, the CRISPR-Cas system has the problem of excessively large protein size. The protein size of the currently used CRISPR-Cas editing tools SpyCas9 and AsCas12a exceeds 1300 amino acids, and the excessively large molecular weight affects the transfection efficiency of the CRISPR-Cas system tools; at the same time, the CRISPR-Cas system has the potential for immune responses. The SpyCas9 and AsCas12a proteins currently used are derived from pathogens that humans have been exposed to, which may cause human immune responses.
[0003] Therefore, the CRISPR-Cas nuclease system is limited by the limitations of its protein components. Developing a new generation of fully RNA-based nucleic acid targeting manipulation technology that simultaneously possesses gene sequence-specific targeting and catalytic activity could potentially overcome the limitations of protease-based gene editing systems.
[0004] The applicant has identified a number of RNA ribozyme-based DEAR nucleic acid manipulation systems with high cleavage activity and in vivo bacterial editing benefits through biochemical methods. However, their structural basis remains unknown, and therefore, their atomic structure is urgently needed to provide a foundation for subsequent modification and application. Furthermore, the applicant discovered that the RNA ribozyme-based DEAR nucleic acid manipulation system (Chinese Patent Application No.: 202310424082.1) possesses RNA, DNA, and plasmid cleavage activity, as well as intracellular and bacterial gene editing activity. However, currently, the DEAR nucleic acid manipulation system still faces certain limitations in gene editing due to its short substrate recognition window. To overcome this limitation, this invention proposes to improve the specificity and cleavage activity of the DEAR nucleic acid manipulation system through engineered design. Summary of the Invention
[0005] The problem the invention aims to solve
[0006] Based on the various problems existing in the CRISPR-Cas nuclease system in the prior art, the applicant has developed a DEAR nucleic acid manipulation system based on RNA ribozyme and applied it to nucleic acid (DNA, RNA) targeted modification (e.g., cleavage). The applicant provides a method for preparing an engineered DEAR nucleic acid manipulation system, which has improved activity compared to the original RNA ribozyme-based DEAR nucleic acid manipulation system.
[0007] Solution for solving the problem
[0008] [1]. A method for preparing an engineered DEAR nucleic acid manipulation system, wherein the original DEAR nucleic acid manipulation system comprises an RNA molecule of type C class II introns derived from bacteria, the RNA molecule comprising a substrate recognition region that hybridizes with a target sequence in a target nucleic acid, and the RNA molecule comprising I domain to VI domain.
[0009] The preparation method includes at least one of the following (a) to (c):
[0010] (a) The substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system was extended to a length of 7–14 nucleotides to obtain an extended substrate recognition region;
[0011] (b) A recruitment sequence is added to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system, and the recruitment sequence hybridizes with at least a portion of the target nucleic acid;
[0012] (c) A first dimerization motif and a second dimerization motif are respectively placed in the III domain of the first RNA molecule and the second RNA molecule from the original DEAR nucleic acid manipulation system. The first dimerization motif and the second dimerization motif hybridize with each other to form a heterodimer between the first RNA molecule and the second RNA molecule.
[0013] [2]. According to the preparation method described in [1], in (a), the substrate recognition region in the RNA molecule is extended to an extended substrate recognition region having a length of 7 to 12 nucleotides;
[0014] Preferably, the substrate recognition region in the RNA molecule is extended to an extended substrate recognition region having a length of 7 to 10 nucleotides.
[0015] [3]. According to the preparation method described in [1] or [2], wherein, in (b), the length of the recruitment sequence is 10 to 40 nucleotides;
[0016] Preferably, the recruitment sequence is 14 to 26 nucleotides in length.
[0017] [4]. The preparation method according to any one of [1] to [3], wherein, in (b), the portion of the target nucleic acid that hybridizes with the recruitment sequence and the target sequence in the target nucleic acid that hybridizes with the substrate recognition region are located at different positions in the target nucleic acid;
[0018] Preferably, the target sequence in the portion of the target nucleic acid that hybridizes with the recruitment sequence and the target sequence in the target nucleic acid that hybridizes with the substrate recognition region are spaced 10 to 60 nucleotides apart, more preferably 20 to 50 nucleotides apart.
[0019] [5]. The preparation method according to any one of [1] to [4], wherein, in (b), the VI domain of the RNA molecule of the original DEAR nucleic acid manipulation system is deleted.
[0020] [6]. The preparation method according to any one of [1] to [5], wherein, in (c), the first dimerizing motif and the second dimerizing motif are of the same length, optionally, the length of the first dimerizing motif and the second dimerizing motif is 4 to 10 nucleotides, preferably 5 to 9 nucleotides, more preferably 6 nucleotides, and / or,
[0021] The first substrate recognition region of the first RNA molecule recognizes the same part of the target nucleic acid as the second substrate recognition region of the second RNA molecule, or they recognize different parts of the target nucleic acid respectively.
[0022] [7]. The preparation method according to any one of [1] to [6], wherein the engineered DEAR nucleic acid manipulation system has improved specificity and / or cleavage activity compared with the original DEAR nucleic acid manipulation system.
[0023] [8]. The preparation method according to any one of [1] to [7], wherein the nucleotide sequence of the RNA molecule of the original DEAR nucleic acid control system is selected from any one of the following:
[0024] (i) Contains a nucleotide sequence as shown in any of SEQ ID NO: 1 to 9;
[0025] (ii) A nucleotide sequence comprising the reverse complementary sequence of any of the sequences shown in SEQ ID NO: 1 to 9;
[0026] (iii) The reverse complementary sequence of a sequence that can hybridize with the nucleotide sequence shown in (i) or (ii) under high-strict hybridization conditions or very high-strict hybridization conditions;
[0027] (iv) A sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99% sequence identity with the nucleotide sequence shown in (i) or (ii).
[0028] [9]. The preparation method according to any one of [1] to [8], wherein the substrate recognition region of the RNA molecule of the original DEAR nucleic acid manipulation system has a length of 6 nucleotides;
[0029] Preferably, the substrate recognition region is programmable to hybridize with different target sequences.
[0030]
[10] . The preparation method according to any one of [1] to [9], wherein the target nucleic acid is DNA or RNA.
[0031]
[11] . The preparation method according to any one of [1] to
[10] , wherein the major cleavage site of the original DEAR nucleic acid manipulation system is the 0-1 nucleotide downstream of the 3' end of the target sequence in the target nucleic acid.
[0032]
[12] . An engineered DEAR nucleic acid manipulation system, which is prepared by any one of the preparation methods described in [1] to
[11] .
[0033]
[13] . An isolated polynucleotide, wherein the polynucleotide comprises a nucleotide sequence encoding the engineered DEAR nucleic acid manipulation system as described in
[12] .
[0034]
[14] . A nucleic acid construct comprising isolated polynucleotides as described in
[13] .
[0035]
[15] . A vector comprising isolated polynucleotides as described in
[13] , or nucleic acid constructs as described in
[14] .
[0036]
[16] . A cell comprising the engineered DEAR nucleic acid manipulation system as described in
[12] , isolated polynucleotides as described in
[13] , nucleic acid constructs as described in
[14] , or vectors as described in
[15] .
[0037]
[17] . A reagent or kit comprising the engineered DEAR nucleic acid manipulation system as described in
[12] , isolated polynucleotides as described in
[13] , nucleic acid constructs as described in
[14] , vectors as described in
[15] , or cells as described in
[16] .
[0038]
[18] . A pharmaceutical composition comprising, wherein the pharmaceutical composition comprises, as described in
[12] , an engineered DEAR nucleic acid manipulation system, as described in
[13] , an isolated polynucleotide, as described in
[14] , a vector, as described in
[15] , or a cell, as described in [9]; and, optionally, a pharmaceutically acceptable vector.
[0039]
[19] . A method for modifying a target nucleic acid, the method comprising the step of contacting the target nucleic acid with the DEAR nucleic acid manipulation system as described in
[12] , the isolated polynucleotide as described in
[13] , the nucleic acid construct as described in
[14] , the vector as described in
[15] , the cell as described in
[16] , or the reagent or kit as described in
[17] .
[0040]
[20] . Use of the DEAR nucleic acid manipulation system as described in
[12] , isolated polynucleotides as described in
[13] , nucleic acid constructs as described in
[14] , vectors as described in
[15] , and cells as described in
[16] in reagents or kits for modifying target nucleic acids or preparing modified target nucleic acids.
[0041] The effects of the invention
[0042] The applicant has discovered that the DEAR nucleic acid manipulation system, based on RNA ribozymes, can cleave DNA and RNA, and also possesses DNA cleavage capabilities in E. coli and mammalian eukaryotic cells. Based on this, the applicant has further improved its specificity and cleavage activity through engineering modifications, and provided a method for preparing the engineered DEAR nucleic acid manipulation system. Attached Figure Description
[0043] Figures 1A to 1I : Display of the secondary structure of DEAR1 to 9. Figures 1A-1I The secondary structure prediction results for DEAR1-9 are shown separately. Predictions were performed using RNAfold, and domains I-VI and TRS are marked in the figures.
[0044] Figure 2 Quality identification of RNA ribozyme molecules DEAR1-9.
[0045] Figure 3 : Verification of RNA cleavage activity of RNA ribozyme molecules DEAR1-9.
[0046] Figure 4 Verification of the cleavage activity of RNA ribozyme molecules DEAR1-6 against unpaired RNA substrates.
[0047] Figure 5 Verification of the ssDNA cleavage activity of RNA ribozyme molecules DEAR1-6.
[0048] Figure 6 Comparison of the cleavage of paired and unpaired DNA substrates by RNA ribozyme molecules DEAR1-6.
[0049] Figure 7 Verification of the ssDNA cleavage sites of RNA ribozyme molecules DEAR1-6.
[0050] Figure 8 Results of optimized reaction conditions for the RNA ribozyme molecule DEAR1.
[0051] Figure 9 Efficiency curve of DEAR1 RNA ribozyme molecule reaction conditions optimized.
[0052] Figure 10 Comparison of DNA cleavage activity between DEAR1 and RNA-guided protein nucleases.
[0053] Figure 11 : Validation of the plasmid cleavage activity of the RNA ribozyme molecule DEAR1.
[0054] Figure 12 Verification of the plasmid cleavage activity of RNA ribozyme molecules DEAR1-3 in Escherichia coli.
[0055] Figure 13 Further validation of the plasmid cleavage activity of the RNA ribozyme molecule DEAR1 in Escherichia coli.
[0056] Figure 14 Verification of the plasmid cleavage activity of RNA ribozyme molecules DEAR4-9 in bacteria.
[0057] Figure 15 Verification of the ssDNA cleavage activity of DEAR1-6 RNA ribozymes reprogrammed to the TRS region.
[0058] Figure 16 Schematic diagram of cell survival after stable transfection with DEAR1 and DEAR-NT plasmids in Example 7.
[0059] Figure 17 A~ Figure 17 B is a schematic diagram of the sequencing results analysis in Example 7.
[0060] Figure 18 : Schematic diagram of DEARs recognizing substrates. TRS: Substrate recognition sequence (substrate recognition region). Target: Substrate binding sequence or target sequence, the sequence of the substrate recognized by the DEAR (complementary to the TRS, i.e., the target sequence of the target nucleic acid).
[0061] Figure 19 The diagram shows the structure of dendritic arrays (DEARs). The first column lists the names of the DEARs, the second column shows the secondary structure of the DEARs, the third column shows the two-dimensional classification of the DEARs using cryo-electron microscopy, and the fourth column shows the cryo-electron microscopy structure of the DEARs. Domains I, II, III, IV, V, and VI are labeled as shown in the diagram.
[0062] Figure 20: Schematic diagram of the catalytic active center structure of DEARs, where M1 and M2 are magnesium ions of its catalytic active center. Nucleotides closely related to catalytic activity are labeled as follows: G1, U2, G3, C4, G5, A106, C107, A181, A182, G183, A184, C185, and A186 from domain I, where the nucleotides at positions 1-5 are called the 5' terminus, and the range from 181 to 186 is also called the substrate recognition sequence, or TRS; A337, G338, and C339 from domain II, these three nucleotides are also called the crossover J2 / 3; G582, U583, A584, C585, C565, C566, G567, and C568 from domain V, where positions 566-568 are also called the catalytic triplet, and the nucleotides at positions 584 and 585 are also called the 2-nucleotide protrusion; and U633 from domain VI.
[0063] Figure 21 The results of TRS extension modification in vitro and in vivo bacterial cleavage. Figure 21 In the diagram, A represents an abstract structural model of DEAR1. The TRS region and dimerization motif are marked. Figure 21 B in the diagram represents the cleavage activity after different TRS sequence replacements. Figure 21 In the diagram, C represents the pattern diagram and cutting efficiency diagram of TRS sequences of different lengths. Figure 21 In the figure, D represents the effect of bacterial endoplatinid cleavage of TRS of different lengths.
[0064] Figure 22 : Figure 22 In the diagram, A represents two different modifications to the original DERADS. V1 represents DEAR6 without D6, and V2 represents the version with D6 removed and a recruitment sequence added. Figure 22 B in the diagram represents the modified atomic model, where the recruitment sequence, recruitment-binding sequence, ligation sequence, substrate recognition sequence, substrate binding sequence, and cleavage site are marked as shown in the figure. Figure 22 C and D in the diagram represent the activity of the modified organism.
[0065] Figure 23 The effect of different lengths of ligation sequences on the in vitro cleavage activity of DEAR6 that increases recruitment sequences.
[0066] Figure 24 : The effect of increased recruitment sequences on the in vitro cleavage activity of DEAR1. Figure 24 In the figure, A represents a comparison of the in vitro cleavage activity of the original version of DEAR1 and the version of DEAR1 with D6 deleted and recruitment sequence added. Figure 24In the figure, B represents the effect of recruitment sequences of different lengths on the in vitro cleavage activity of engineered DEAR1.
[0067] Figure 25 : Figure 25 Figure A in the diagram is a schematic diagram of transforming DEARs into heterodimers; Figure 25 B in the image represents the molecular sieve and cryo-electron microscopy two-dimensional image of the DEAR1 heterodimer; Figure 25 The diagram in C represents the different substrate forms of double-stranded DNA cleaved by the DEAR1 heterodimer. From left to right, these are schematic diagrams of the products with 5' overhanging ends, blunt ends, and 3' overhanging ends. Figure 25 The figure shows the results of DEAR1 heterodimer cleaving double-stranded DNA substrates. The results are for substrates with 5' overhangs and spacer sequences of 15, 30, and 45 nucleotides in length, substrates with cleavage sites 0 nucleotides apart (i.e., blunt-ended products), and substrates with 3' overhangs and spacer sequences of -6, 0, 15, 30, and 45 nucleotides in length.
[0068] Figure 26 : Schematic diagram of DEARs heterodimer cleavage results in bacteria. The left side shows the survival experiment of DEARs cleavage in bacteria on streptomycin-resistant plates with CcdB toxic gene expression induced by arabinose. Only bacteria that have undergone cleavage can grow. The right side shows the resistance cleavage experiment. On plates with ampicillin resistance, when the DEAR system cleaves the resistance plasmid, bacteria that have lost resistance cannot survive. Detailed Implementation
[0069] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains.
[0070] In this specification, the range of values referred to as "value A to value B" refers to the range including the endpoint values A and B.
[0071] In this specification, the terms "substantially" or "truly" are used to indicate that the standard deviation from the theoretical model or theoretical data is within 5%, preferably 3%, and more preferably 1%.
[0072] In this specification, the word "may" has two meanings: to perform a certain process and not to perform a certain process.
[0073] In this specification, "optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes both the scenario in which the event occurs and the scenario in which the event does not occur.
[0074] In this specification, references to "some specific / preferred embodiments," "other specific / preferred embodiments," "implementation," etc., refer to specific elements (e.g., features, structures, properties, and / or characteristics) related to that embodiment, which are included in at least one of the embodiments described herein and may or may not be present in other embodiments. Furthermore, it should be understood that these elements may be combined in any suitable manner in various embodiments.
[0075] The terms "comprising" and "having," and any variations thereof, are intended to cover non-exclusive inclusion. For example, a process, method, apparatus, product, or device that includes a series of steps is not limited to the steps or modules listed, but may optionally include steps not listed, or may optionally include other steps inherent to such process, method, product, or device.
[0076] In this invention, "multiple" refers to two or more. "And / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A alone, A and B simultaneously, or B alone. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.
[0077] In this specification, the interchangeable terms “polynucleotide” and “nucleic acid” refer to polymeric forms of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, this term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases.
[0078] In this art, "G", "C", "A", "T", and "U" typically represent the bases of guanine, cytosine, adenine, thymine, and uracil, respectively. However, it is also generally known in the art that each of "G", "C", "A", "T", and "U" typically also represents a nucleotide containing guanine, cytosine, adenine, thymine, and uracil as a base, respectively. This is a common practice in representing deoxyribonucleic acid (DNA) sequences and / or ribonucleic acid (RNA) sequences. Therefore, in the context of this invention, the meanings of "G", "C", "A", "T", and "U" include all of the above-mentioned possible cases. However, it should be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide or an alternative substitution. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil can be substituted with other parts without substantially altering the base-pairing properties of an oligonucleotide (including a nucleotide having such a substitution).
[0079] In this specification, the term "nucleic acid manipulation" includes binding, creating a nick in one strand, or cutting (i.e., cleaving) both strands of a nucleic acid, or includes modifying or editing the nucleic acid. Nucleic acid manipulation can silence, activate, or regulate (increase or decrease) the expression of RNA or polypeptide encoded by said nucleic acid.
[0080] In this specification, "hybridizable," "complementary," or "substantially complementary" means that a nucleic acid (e.g., RNA, DNA) contains a nucleotide sequence that enables the nucleic acid to non-covalently bind (i.e., form Watson-Crick base pairs and / or G / U base pairs), "anneal," or "hybridize" with another nucleic acid in a sequence-specific, antiparallel (i.e., the nucleic acid specifically binds to the complementary nucleic acid) manner, under appropriate in vitro and / or in vivo temperature and solution ionic strength conditions. Standard Watson-Crick base pairings include: adenine (A) paired with thymidine (T), adenine (A) paired with uracil (U), and guanine (G) paired with cytosine (C). Furthermore, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization between DNA and RNA molecules (e.g., when a DNA or RNA target nucleic acid base pairs with the substrate recognition region of the DEAR nucleic acid manipulation system): guanine (G) may also pair with uracil (U). For example, when the anticodon of tRNA pairs with a codon in mRNA, G / U base pairing is at least partially responsible for the degeneracy of the genetic code.
[0081] Hybridization and washing conditions are well known and illustrated in Sambrook, J., Fritsch, E.F. and Maniatis, T., *Molecular Cloning: A Laboratory Manual*, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly in Chapter 11 and Table 11.1 of that reference; and in Sambrook, J. and Russell, W., *Molecular Cloning: A Laboratory Manual*, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001). The temperature and ionic strength conditions determine the “rigidity” of the hybridization.
[0082] In this invention, "medium stringency," "medium-high stringency," "high stringency," or "very high stringency" describes the conditions for nucleic acid hybridization and washing. For instructions on performing the hybridization reaction, see Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1–6.3.6, which is incorporated herein by reference. Aqueous and non-aqueous methods are described in that literature, and either method may be used. For example, specific hybridization conditions are as follows: (1) Low-toughness hybridization conditions: 6× sodium chloride / sodium citrate (SSC) at about 45°C, then at at least 50°C, washed twice in 0.2× SSC, 0.1% SDS (for low-toughness conditions, the washing temperature can be increased to 55°C); (2) Medium-toughness hybridization conditions: 6× SSC at about 45°C, then at 60°C, washed once or more in 0.2× SSC, 0.1% SDS; (3) High-toughness hybridization conditions: 6× SSC at about 45°C, then at 65°C, washed once or more in 0.2× SSC, 0.1% SDS, preferably; (4) Very high-toughness hybridization conditions: 0.5M sodium phosphate, 7% SDS at 65°C, then at 65°C, washed once or more in 0.2× SSC, 1% SDS.
[0083] Hybridization requires two nucleic acids to contain complementary sequences, but base mismatches are possible. The suitable conditions for hybridization between two nucleic acids depend on the length and complementarity of the nucleic acids, which are well-known variables in the field.
[0084] In this invention, the DNA sequence “encoding” a specific RNA is the DNA nucleotide sequence transcribed into RNA. DNA polynucleotides can encode RNA (mRNA) that is converted into protein (therefore both DNA and mRNA encode proteins), or DNA polynucleotides can encode RNA that is not translated into protein (e.g., tRNA, rRNA, microRNA (miRNA), “non-coding” RNA (ncRNA), and the DEAR nucleic acid manipulation system provided by this invention, etc.).
[0085] In this invention, the terms "naturally occurring," "unmodified," or "wild-type" applied to nucleic acids, polypeptides, cells, or organisms refer to nucleic acids, polypeptides, cells, or organisms that are present in nature. For example, polypeptide or polynucleotide sequences present in an organism that can be isolated from natural sources are naturally occurring.
[0086] In this invention, "recombinant" means that a specific nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR), and / or ligation steps that produce a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids present in natural systems. DNA sequences encoding polypeptides may be assembled from cDNA fragments or from a series of synthetic oligonucleotides to provide synthetic nucleic acids capable of being expressed by recombinant transcription units contained in cellular or cell-free transcription and translation systems. Genomic DNA containing the relevant sequences may also be used in the formation of recombinant genes or transcription units. Sequences of untranslated DNA may be present at the 5' or 3' end of an open reading frame, wherein such sequences do not interfere with the manipulation or expression of coding regions and can, in fact, function to regulate the production of the desired product through various mechanisms (see "DNA Regulatory Sequences"). Alternatively, DNA sequences encoding untranslated RNA (e.g., the DEAR nucleic acid manipulation system provided by this invention) may also be considered recombinant. Thus, the term "recombinant" nucleic acid, for example, refers to non-naturally occurring polynucleotides or nucleic acids, such as polynucleotides or nucleic acids produced by human intervention through the artificial combination of two additional separate segments of a sequence. Such artificial combinations are often achieved through chemical synthesis or by artificially manipulating isolated segments of nucleic acids (e.g., through genetic engineering). This operation typically involves replacing codons with those encoding the same amino acid, conserved amino acids, or non-conserved amino acids. Alternatively, this operation can be performed to link nucleic acid segments with the desired function together to produce the desired functional combination. Such artificial combinations are often achieved through chemical synthesis or by artificially manipulating isolated segments of nucleic acids (e.g., through genetic engineering).
[0087] As used in this disclosure, the term "isolated" means a substance in a form or environment not naturally occurring. Non-limiting examples of isolated substances include (1) any substance not naturally occurring, (2) any substance including, but not limited to, any enzyme, mutant, nucleic acid, protein, peptide, or cofactor, which is at least partially removed from one or more of the naturally occurring components associated with it; (3) any substance artificially modified relative to a naturally found substance; or (4) any substance modified by increasing the amount of the substance relative to other components naturally associated with it (e.g., recombinant generation in a host cell; multiple copies of the gene encoding the substance; and the use of a promoter stronger than that naturally associated with the gene encoding the substance).
[0088] As used in this disclosure, the term "nucleic acid construct" comprises a polynucleotide encoding a polypeptide or domain or module efficiently linked to a suitable regulatory sequence necessary for polynucleotide expression in selected cells or strains. In this disclosure, transcriptional regulatory elements comprise promoters, and may further comprise enhancers, silencers, insulators, and other elements.
[0089] The term "vector" refers to a genetic element, such as a plasmid, granule, rod, bacteriophage, or virus, to which another genetic sequence or element (DNA or RNA) can be attached. A vector can be a replicon, thereby causing the replication of the attached sequence or element. An "expression vector" is a device that facilitates the expression of nucleic acids or nucleic acid sequences encoding polypeptides in a host cell or organism.
[0090] In this invention, the terms "recombinant expression vector" or "DNA construct" are used interchangeably herein to refer to a DNA molecule comprising a vector and an insert. Recombinant expression vectors are typically generated for the purpose of expressing and / or proliferating one or more inserts, or for the purpose of constructing other recombinant nucleotide sequences. The one or more inserts may or may not be operatively linked to a promoter sequence and may or may not be operatively linked to a DNA regulatory sequence.
[0091] As used herein, the term "operably ligable" refers to a nucleic acid sequence that is placed in a functional relationship with another nucleic acid sequence. Examples of operably ligable nucleic acid sequences include, but are not limited to, promoters, transcription terminators, enhancers or activators, and heterologous genes that, when transcribed, and if appropriate, will be translated to produce functional products such as proteins, ribozymes, or RNA molecules.
[0092] As used herein, the term “derived from” means origin or source and can include naturally occurring, recombinant, unpurified, or purified molecules. Nucleic acids derived from the original nucleic acid may contain part or all of the original nucleic acid and may be fragments or variants of the original nucleic acid.
[0093] In this invention, the term "ribozyme" refers to an RNA molecule capable of catalyzing specific biochemical reactions. Common examples of such reactions include the cutting or joining of RNA and DNA, as well as modifications.
[0094] In this invention, a "target nucleic acid" is a polynucleotide (e.g., DNA such as genomic DNA, RNA, etc.) that includes a site ("target site" or "target sequence") targeted by the DEAR nucleic acid manipulation system provided by this invention. The target sequence is the sequence with which the substrate recognition region of the DEAR nucleic acid manipulation system hybridizes. For example, the target site (or target sequence) 5'-UGUCUU-3' or 5'-TGTCTT-3' within the target nucleic acid is targeted (or bound to, hybridized with, or complementary to) the sequence 5'-AAGACA-3'. Suitable hybridization conditions include physiological conditions normally present in cells.
[0095] In this invention, "cleavage" refers to the breakage of the covalent backbone of a target nucleic acid molecule (e.g., RNA, DNA). Both single-strand and double-strand cleavage are possible, and double-strand cleavage can occur due to two distinct single-strand cleavage events. "Major cleavage site" refers to the DNA / RNA break site corresponding to a clearly banded cleavage product. "Minor cleavage site" refers to the DNA / RNA break site corresponding to a less clearly banded cleavage product.
[0096] The term "palindromic sequence" or "palindromic structure" refers to a specific nucleotide segment in a double-stranded DNA or RNA molecule where the sequence read from 5' to 3' on one strand is identical to the sequence read from 5' to 3' on its complementary strand. Single-stranded DNA or RNA with palindromic sequences possess a center of symmetry, with bases on either side of this center being complementary. Therefore, palindromic sequences can form hairpin structures (stem-loop structures).
[0097] The term "homodimer" refers to a dimerized molecule formed from the same type of molecule that can exist stably.
[0098] The term "heterodimer" refers to a dimerized molecule that can exist stably, formed from different molecules.
[0099] The technical solution of the present invention will be described in detail below.
[0100] The applicant constructed the DEAR nucleic acid manipulation system based on RNA ribozymes using bacterial class II intron elements. Class II introns consist of two parts: an RNA ribozyme and an intron-encoded protein (IEP). The RNA ribozyme catalyzes the auto-cleavage maturation of the original transcript, while the IEP protein plays a supporting role. The RNA ribozyme portion includes six domains, I through VI. Domain I is the largest of all domains and plays a crucial stabilizing role in the formation of the overall intron structure, containing an exon-binding site (EBS) for exon binding. Domains II and III also participate in ribozyme structure formation. Domain IV contains an open reading frame (ORF), which encodes the IEP protein. Domain V is the catalytic center of the RNA ribozyme, while domain VI performs a co-catalytic function. Based on RNA primary sequence and secondary structure characteristics, group II introns can be classified into classes A, B, and C. Among them, class C is considered to be a more ancient class of introns (DMSimon et al., Group II introns in eubacteria and archaea: ORF-less introns and new varieties. Rna 14, 1704-1713 (2008); AMlambowitz, S. Zimmerly, Mobile group II introns. Annu Rev Genet 38, 1-35 (2004); JSRest, DPMindell, Retroids in archaea: phylogeny and lateralorigins. Mol Biol Evol 20, 1134-1142 (2003).). The applicant is interested in type C group II introns that do not have an open reading frame encoding an IEP in their IV domain.
[0101] The applicant has discovered that the EBS of type C class II introns and its nearby sequences can be used as substrate recognition elements (referred to as target recognition sites, TRS) for ribozymes targeting nucleic acids. The programmability of TRS has been discovered and demonstrated, and the target nucleic acids (RNA, DNA) can be hydrolyzed and cleaved using the V domain of RNA intron ribozymes. Therefore, the applicant refers to a programmable nucleic acid recognition and cleavage system constructed based on type C class II introns derived from bacteria, which lack open reading frames encoding intron-encoding proteins in their IV domains, as the RNA ribozyme-based DEAR nucleic acid manipulation system. In this invention, it is also referred to as the original DEAR nucleic acid manipulation system or the original RNA ribozyme-based DEAR nucleic acid manipulation system.
[0102] The original DEAR nucleic acid manipulation system still has certain limitations for gene editing due to its short substrate recognition window. In order to overcome this limitation, this invention aims to improve the specificity and cleavage activity of the DEAR nucleic acid manipulation system by engineering it, thereby obtaining an engineered DEAR nucleic acid manipulation system.
[0103] <Preparation Method of the Engineered DEAR Nucleic Acid Manipulation System>
[0104] The purpose of this invention is to provide a method for preparing an engineered DEAR nucleic acid manipulation system, wherein the original DEAR nucleic acid manipulation system comprises an RNA molecule derived from a bacterial C-type class II intron, the RNA molecule comprising a substrate recognition region that hybridizes with a target sequence in a target nucleic acid, and the RNA molecule comprising domains I to VI.
[0105] The preparation method includes at least one of the following (a) to (c):
[0106] (a) The substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system was extended to a length of 7–14 nucleotides to obtain an extended substrate recognition region;
[0107] (b) A recruitment sequence is added to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system, and the recruitment sequence hybridizes with at least a portion of the target nucleic acid;
[0108] (c) A first dimerization motif and a second dimerization motif are respectively placed in the III domain of the first RNA molecule and the second RNA molecule from the original DEAR nucleic acid manipulation system. The first dimerization motif and the second dimerization motif hybridize with each other to form a heterodimer between the first RNA molecule and the second RNA molecule.
[0109] In some implementations, the engineered DEAR nucleic acid manipulation system has improved specificity and / or cleavage activity compared to the original DEAR nucleic acid manipulation system.
[0110] Original DEAR Nucleic Acid Manipulation System
[0111] In some embodiments of the invention, the original DEAR nucleic acid manipulation system based on RNA ribozymes comprises (isolated) RNA molecules derived from bacterial C-type class II introns, the RNA molecules containing a substrate recognition region that hybridizes to a target sequence in a target nucleic acid.
[0112] In some embodiments of the present invention, the C-type second intron is a C-type second intron in which there is no open reading frame encoding an IEP in the IV domain.
[0113] The original DEAR nucleic acid manipulation system acts as an endonuclease, catalyzing the cleavage of nucleic acids at specific sequences within the target nucleic acid (e.g., DNA, RNA). As will be detailed later, sequence specificity is provided by a substrate recognition region within the DEAR system, which hybridizes with the target sequence in the target nucleic acid. Therefore, the DEAR system binds to the target nucleic acid through hybridization of the substrate recognition region with the target sequence. In other words, the location of specific binding (and / or cleavage) of the target nucleic acid is determined by the complementary base pairing between the substrate recognition region and the target nucleic acid.
[0114] In some specific implementations, the primary cleavage site of the original DEAR nucleic acid manipulation system is 0-1 nt downstream of the 3' end of the target sequence in the target nucleic acid; that is, the primary cleavage site is located 0-1 nt downstream of the 3' end of the target nucleic acid in the region that pairs with the substrate recognition region.
[0115] In some embodiments of the present invention, the nucleotide sequence of the RNA molecule of the original DEAR nucleic acid manipulation system is selected from any of the following:
[0116] (i) Contains a nucleotide sequence as shown in any of SEQ ID NO: 1 to 9;
[0117] (ii) A nucleotide sequence comprising the reverse complementary sequence of any of the sequences shown in SEQ ID NO: 1 to 9;
[0118] (iii) The reverse complementary sequence of a sequence that can hybridize with the nucleotide sequence shown in (i) or (ii) under high-strict hybridization conditions or very high-strict hybridization conditions;
[0119] (iv) A sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99% sequence identity with the nucleotide sequence shown in (i) or (ii).
[0120] SEQ ID NO: 1 to 9 are shown below:
[0121]
[0122]
[0123] In this context, "NNNNNN" represents the substrate identification area, where N can be A, U, G, or C.
[0124] In some specific embodiments, the original DEAR nucleic acid manipulation system comprises an RNA molecule whose nucleotide sequence is as shown in any of SEQ ID NO: 1 to 9.
[0125] (Substrate identification area)
[0126] In some embodiments, the substrate recognition region of the original DEAR nucleic acid manipulation system is a nucleotide sequence complementary to a sequence in the target nucleic acid (target sequence). In other words, the substrate recognition region of the original DEAR nucleic acid manipulation system can interact with the target nucleic acid (e.g., DNA, RNA) in a sequence-specific manner via hybridization (i.e., base pairing). The substrate recognition region can be modified (e.g., through genetic engineering) / designed to hybridize with any desired target sequence within the target nucleic acid (e.g., prokaryotic target nucleic acid, eukaryotic target nucleic acid, isolated target nucleic acid).
[0127] In some implementations, the substrate recognition region is programmable because it can be designed or engineered to recognize and bind different target sequences.
[0128] In some embodiments, the complementarity percentage between the substrate recognition region and the target sequence of the target nucleic acid is 60% or higher (e.g., 65% or higher, 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 97% or higher, 98% or higher, 99% or higher, or 100%). In some embodiments, the complementarity percentage between the substrate recognition region and the target sequence of the target nucleic acid is 80% or higher (e.g., 85% or higher, 90% or higher, 95% or higher, 97% or higher, 98% or higher, 99% or higher, or 100%). In some embodiments, the complementarity percentage between the substrate recognition region and the target sequence of the target nucleic acid is 90% or higher (e.g., 95% or higher, 97% or higher, 98% or higher, 99% or higher, or 100%). In some embodiments, the complementarity percentage between the substrate recognition region and the target sequence of the target nucleic acid is 100%.
[0129] In some embodiments, the substrate recognition region has a length of 6 nucleotides (nt). In some specific embodiments, the sequence of the substrate recognition region is: N1N2N3N4N5N6; wherein N1 to N6 are A, G, C, or U, respectively.
[0130] In some embodiments, at least four nucleotides in the substrate recognition region of the original DEAR nucleic acid manipulation system are complementary to the target sequence of the target nucleic acid. In some preferred embodiments, at least five nucleotides in the substrate recognition region of the original DEAR nucleic acid manipulation system are complementary to the target sequence of the target nucleic acid. In some more preferred embodiments, six nucleotides in the substrate recognition region of the original DEAR nucleic acid manipulation system are complementary to the target sequence of the target nucleic acid.
[0131] In some specific implementations, the sequence of the substrate recognition region is selected from, but not limited to:
[0132] (a) AAGACA ;
[0133] (b)UAGGCA;
[0134] (c) CAGACA ;
[0135] (d)AAUGAA;
[0136] (e) AUAACA ;
[0137] (f)ACAUCA;
[0138] (g)CACUCA;
[0139] (h)AUUACA.
[0140] In some specific embodiments, the original DEAR nucleic acid manipulation system comprises an RNA molecule whose nucleotide sequence is as shown in any of SEQ ID NO: 10-18.
[0141] (Target nucleic acid)
[0142] In this invention, the original DEAR nucleic acid manipulation system can bind to and cleave target nucleic acids. In this invention, the target nucleic acid can be any nucleic acid (e.g., DNA, RNA), can be any type of nucleic acid (e.g., chromosomal (genomic DNA), chromosome-derived, chromosomal DNA, plasmid, virus, extracellular, intracellular, mitochondrial, chloroplast, linear, circular, etc.), and can originate from any organism (e.g., as long as the original DEAR nucleic acid manipulation system contains a nucleotide sequence that hybridizes with the target sequence in the target nucleic acid, such that the target nucleic acid can be targeted).
[0143] Specifically, in this invention, the target nucleic acid can be DNA or RNA. In some exemplary embodiments, the target nucleic acid is selected from: mRNA, rRNA, tRNA, non-coding RNA (ncRNA), long non-coding RNA (lncRNA), and microRNA (miRNA). In some exemplary embodiments, the target nucleic acid is viral DNA or plasmid DNA. The target nucleic acid can be located anywhere, for example, outside of cells in vitro, inside cells in vitro, inside cells in vivo, or inside cells outside the body.
[0144] Extend the substrate recognition area
[0145] In some embodiments of the present invention, the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system is extended to a length of 7 to 14 nucleotides to obtain an extended substrate recognition region, thereby obtaining an engineered DEAR nucleic acid manipulation system with an extended substrate recognition region. Similarly, the extended substrate recognition region is a nucleotide sequence complementary to a sequence in the target nucleic acid (target sequence).
[0146] In some specific implementations, the sequence N1N2N3N4N5N6 of the substrate identification region can be extended to N1N2N3N4N5N6N7. That is, NNNNNN in any one of SEQ ID NO:1 to 9 can be replaced with NNNNNNN.
[0147] In some specific implementations, the sequence N1N2N3N4N5N6 of the substrate identification region can be extended to N1N2N3N4N5N6N7N8. That is, NNNNNN in any one of SEQ ID NO:1 to 9 can be replaced with NNNNNNNN.
[0148] In some specific implementations, the sequence N1N2N3N4N5N6 of the substrate identification region can be extended to N1N2N3N4N5N6N7N8N9. That is, NNNNNN in any one of SEQ ID NO:1 to 9 can be replaced with NNNNNNNNN.
[0149] In some specific implementations, the sequence N1N2N3N4N5N6 of the substrate recognition region can be extended to N1N2N3N4N5N6N7N8N9N 10 That is, replace NNNNNN with NNNNNNNNN in any of the entries in SEQ ID NO:1 to 9.
[0150] In some specific implementations, the sequence N1N2N3N4N5N6 of the substrate recognition region can be extended to N1N2N3N4N5N6N7N8N9N 10 N 11 That is, replace NNNNNN in any of the entries in SEQ ID NO:1 to 9 with NNNNNNNNNNN.
[0151] In some specific implementations, the sequence N1N2N3N4N5N6 of the substrate recognition region can be extended to N1N2N3N4N5N6N7N8N9N 10 N 12 That is, replace NNNNNN in any of the entries in SEQ ID NO:1 to 9 with NNNNNNNNNNNNN.
[0152] In some specific implementations, the sequence N1N2N3N4N5N6 of the substrate recognition region can be extended to N1N2N3N4N5N6N7N8N9N 10 N 12 N 13 That is, replace NNNNNN in any of the entries in SEQ ID NO:1 to 9 with NNNNNNNNNNNNN.
[0153] In some specific implementations, the sequence N1N2N3N4N5N6 of the substrate recognition region can be extended to N1N2N3N4N5N6N7N8N9N 10 N 12 N 13 N 14 That is, replace NNNNNN in any of the entries in SEQ ID NO:1 to 9 with NNNNNNNNNNNNNNN.
[0154] In the above implementation scheme, N1~N 14 Each of the options is A, G, C, or U.
[0155] In some implementations, the extended substrate recognition region is designed to be identical to the substrate recognition region of the original DEAR nucleic acid manipulation system, except for its length.
[0156] In some preferred embodiments, the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system is extended to a length of 7 to 12 nucleotides, preferably 7 to 10 nucleotides, such as 7, 8, 9 or 10 nucleotides.
[0157] Add recruitment sequence
[0158] In some embodiments of the invention, a recruitment sequence is added to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system, and the recruitment sequence hybridizes with at least a portion of the target nucleic acid.
[0159] In some implementations, the recruitment sequence is 10 to 40 nucleotides in length.
[0160] In some preferred embodiments, the recruitment sequence is 14 to 26 nucleotides in length.
[0161] In some exemplary embodiments, the recruitment sequence is 14, 20, or 26 nucleotides in length.
[0162] In some preferred embodiments, the recruitment sequence is 20 nucleotides in length.
[0163] In some embodiments, the target nucleic acid portion hybridizing with the recruiting sequence and the target nucleic acid portion hybridizing with the substrate recognition region have different target sequences. In some preferred embodiments, the interval (i.e., the linker sequence length) between the target nucleic acid portion hybridizing with the recruiting sequence and the target nucleic acid portion hybridizing with the substrate recognition region is 10 to 60 nucleotides, preferably 20 to 50 nucleotides.
[0164] In some implementations, the portion of the target nucleic acid that is associated with the recruitment sequence is referred to as the recruitment sequence binding sequence.
[0165] In some embodiments, a gap, referred to as a linker sequence, exists between the substrate-binding sequence recognized by the substrate recognition sequence (TRS) of the DEAR nucleic acid manipulation system and the recruitment sequence-binding sequence in the target nucleic acid. In some embodiments, the length of the linker sequence is 10–60 nucleotides, preferably 20–50 nucleotides.
[0166] In some implementations, a recruitment sequence is added to the 3' end of the original DEAR nucleic acid control system RNA molecule while simultaneously deleting the VI domain of the original DEAR nucleic acid control system RNA molecule. That is, after deleting the VI domain of the original DEAR nucleic acid control system RNA molecule, the recruitment sequence is attached to the 3' end of the original DEAR nucleic acid control system RNA molecule.
[0167] Delete the VI domain of the RNA molecule of the original DEAR nucleic acid manipulation system:
[0168] For DEAR1, delete nucleotides 597-633 in SEQ ID NO:1;
[0169] For DEAR2, delete nucleotides 590-633 in SEQ ID NO:2;
[0170] For DEAR3, nucleotides 607-647 in SEQ ID NO:3 are deleted;
[0171] For DEAR4, delete nucleotides 608-650 in SEQ ID NO:4;
[0172] For DEAR5, nucleotides 604-640 in SEQ ID NO:5 are deleted;
[0173] For DEAR6, nucleotides 551-595 in SEQ ID NO:6 are deleted;
[0174] For DEAR7, delete nucleotides 597-644 in SEQ ID NO:7;
[0175] For DEAR8, nucleotides 595-647 in SEQ ID NO:8 are deleted;
[0176] For DEAR9, nucleotides 416-451 in SEQ ID NO:7 are deleted.
[0177] Set dimerization motif
[0178] In some embodiments of the present invention, a first dimerization motif and a second dimerization motif are respectively set in the III domain of the first RNA molecule and the second RNA molecule from the original DEAR nucleic acid manipulation system. The first dimerization motif and the second dimerization motif hybridize with each other, so that the first RNA molecule and the second RNA molecule form a heterodimer.
[0179] In some embodiments, the first dimerizing motif and the second dimerizing motif are of the same length. In some embodiments, the lengths of the first dimerizing motif and the second dimerizing motif are 4 to 10 nucleotides, preferably 5 to 9 nucleotides, for example, 5, 6, 7, 8, 9 or 10 nucleotides, more preferably 6 nucleotides.
[0180] In some implementations, the first substrate recognition region (TRS1) of the first RNA molecule may be the same as or different from the second substrate recognition region (TRS1) of the second RNA molecule.
[0181] In some specific implementations, the first substrate recognition region and the second substrate recognition region can recognize both strands of a double-stranded target nucleic acid, respectively. In other specific implementations, the first substrate recognition region and the second substrate recognition region can recognize one strand of a double-stranded target nucleic acid, or recognize a single-stranded target nucleic acid.
[0182] In some specific implementations, the first substrate recognition region and the second substrate recognition region can recognize different parts of the target nucleic acid, respectively. In some specific implementations, the first substrate recognition region and the second substrate recognition region can recognize the same part of the target nucleic acid.
[0183] This invention discovers that the original DEAR1 nucleic acid control system, through the dimerization motif of its III domain in its RNA molecule (nucleotides 361-366 of SEQ ID NO:1 / SEQ ID NO:10, which is a palindromic sequence UCUAGA), can naturally form a homodimer. Based on this, in some specific embodiments of this invention, the dimerization motif of the III domain (nucleotides 361-366) in the two monomers (i.e., the first RNA molecule and the second RNA molecule) of the original DEAR1 nucleic acid control system is replaced with different sequences of six nucleotides that can hybridize with each other. The two different RNA molecules of the DEAR1 nucleic acid control system after the dimerization motif replacement can form a heterodimer.
[0184] Specifically, the structure of the first RNA molecule (monomer 1) is as follows:
[0185] GUGCGCUCGGCAUGGGUGCAAUCUCUAGGGUGAAAGUCCCGAACUGCGAAGGC
[0186] AGAAGUAGCAGUUAGCUUAACGCAAGGGUGUCCGUGGUGACGCGGAAUCUGAA
[0187] GGAAGCGGGCGGCAAACUUCCGGUCUGAGGAACACGAACUUCAUAUAAGGCUAGGUAUCAUUGGAUGAGUUUGC-[TRS1]-AAACAAAGUCCUUUCUGCCGAAGGUGAUACAGAGUAAAUGAAGCAGAUAGAUGGAAGGAAAGAUUGUACUCUUACCCGAGGAGGUCUGAUGGAUACGUGAAGUGCGCUUCAUAACCUACUUAGUGAUAAGUAACUGAACCAUCAGAAGUCAGCAGAGGUCAUAGUACGAAUCGG-[The first dimerization motif]-ACGAUUCGGAAGGACUGAACAAUCAAGAGAAAAUAGCCCUUGGCAUUCAGUACGUCAUGAUGAACACAGAAAACAUGGUACCUCCCAAGAGAAAGGAAACGGUGAAUCCCGUGGGAAUCUUUUGGAGGGUGGAGUGACGACUGGCAUAAGAAGAUCAGCUAUUUACGGAAGGAAGCUUGCGUCAUUAUCUUGAUUGAACCGCCGUAUACGGAACCGUACGUACGGUGGUGUGAGAGGACGGAGGUUAAUCACCUCCUCCUACUCGAU;
[0188] The structure of the second monomer of the second RNA molecule is as follows:
[0189] GUGCGCUCGGCAUGGGUGCAAUCUCUAGGGUGAAAGUCCCGAACUGCGAAGGCAGAAGUAGCAGUUAGCUUAACGCAAGGGUGUCCGUGGUGACGCGGAAUCUGAAGGAAGCGGGCGGCAAACUUCCGGUCUGAGGAACACGAACUUCAUAUAAGGCUAG GUAUCAUUGGAUGAGUUUGC-[TRS2]-AAACAAAGUCCUUUCUGCCGAAGGUGAUACAGAGUAAAUGAAGCAGAUAGAUGGAAGGAAAGAUUGUACUCUUACCCGAGGAGGUCUGAUGGAUACGUGAAGUGCGCUUCAUAACCUACUUAGUGAUAAGUA ACUGAACCAUCAGAAGUCAGCAGAGGUCAUAGUACGAAUCGG-[Second dimerization motif]-ACGAUUCGGAAGGACUGAACAAUCAAGAGAAAAUAGCCCUUGGCAUUCAGUACGUCAUGAUGAACACAGAAAACAUGGUACCUCCCAAGAGAAAGGAAACGGUGAAU CCCGUGGGAAUCUUUUGGAGGGUGGAGUGACGACUGGCAUAAGAAGAUCAGCUAUUUACGGAAGGAAGCUUGCGUCAUUAUCUUGAUUGAACCGCCGUAUACGGAACCGUACGUACGGUGGUGAGAGGACGGAGGUUAAUCACCUCCUCCUACUCGAU
[0190] In some other specific embodiments of the present invention, the dimerization motif (i.e., nucleotides 361-366) of the III domain in the two monomers (i.e., the first RNA molecule and the second RNA molecule) of the original DEAR nucleic acid control system DEAR5 is replaced with different sequences of 6 nucleotides that can hybridize with each other. The two different RNA molecules of the DEAR nucleic acid control system after dimerization motif replacement can form a heterodimer.
[0191] In other specific embodiments of the present invention, the dimerization motif (i.e., nucleotides 361-366) of the III domain in the two monomeric RNA molecules (i.e., the first RNA molecule and the second RNA molecule) formed by DEAR1 or DEAR5 can be replaced with different sequences of six nucleotides that can hybridize with each other. Furthermore, the III domain (i.e., nucleotides 340-385) of the two monomeric RNA molecules (i.e., the first RNA molecule and the second RNA molecule) after the dimerization motif replacement can be replaced with the III domain in two RNA molecules of other original DEAR nucleic acid manipulation systems (e.g., any one of DEAR1-9). Thus, the RNA molecules of the two different DEAR nucleic acid manipulation systems after the III domain (including the dimerization motif replacement) replacement can form heterodimers.
[0192] In some implementations, during the cleavage of double-stranded DNA, the two TRS of the heterodimer can each recognize and cleave both strands of the double-stranded DNA, forming a DNA double-strand break. A DNA double-strand break can only be formed when both strands of the double-stranded DNA contain substrate-binding sequences (targets) that can be recognized by the two TRS of the heterodimer. This broadens the DNA recognition range of the DEAR nucleic acid manipulation system, extending the original 6nt recognition to 12nt. Furthermore, as... Figure 25 As shown. Depending on the design differences of the recognition site, three different products can be generated: a 3' protruding end (spacer length 0-45nt), a blunt end (spacer length 0nt), and a 5' protruding end (spacer length 0-45nt).
[0193] <Engineering Modification of the DEAR Nucleic Acid Manipulation System>
[0194] Some aspects of the present invention provide an engineered DEAR nucleic acid manipulation system, which is prepared by the preparation method of the engineered DEAR nucleic acid manipulation system described in the present invention.
[0195] <Biomaterials>
[0196] (isolated polynucleotides)
[0197] In some embodiments of the present invention, an isolated polynucleotide is provided, wherein the polynucleotide comprises a nucleotide sequence encoding the engineered DEAR nucleic acid manipulation system described in the present invention.
[0198] (Nucleic acid construct)
[0199] In some embodiments of the present invention, a nucleic acid construct is provided, wherein the nucleic acid construct comprises the isolated polynucleotides described in the present invention.
[0200] In some optional embodiments, the polynucleotide is operatively linked to one or more regulatory sequences, which are nucleotide sequences containing promoters and / or ribosome binding sites, and which direct the expression of genes of the engineered DEAR nucleic acid manipulation system in host cells.
[0201] (Carrier)
[0202] In some embodiments of the present invention, a vector is provided, wherein the vector comprises the isolated polynucleotides described in the present invention, or the nucleic acid constructs described in the present invention.
[0203] In some specific implementation schemes, the vector is a recombinant expression vector.
[0204] Suitable recombinant expression vectors include viral expression vectors (e.g., viral vectors based on viruses such as vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus), retroviral vectors (e.g., murine leukosis virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus), etc.
[0205] (cell)
[0206] In some embodiments of the present invention, the present invention provides a cell comprising the engineered DEAR nucleic acid manipulation system described in the present invention, the isolated polynucleotides described in the present invention, the nucleic acid constructs described in the present invention, or the vectors described in the present invention.
[0207] The cell can be any of a variety of cells, including, for example, in vitro cells, in vivo cells, isolated cells, primary cells, cancer cells, animal cells, plant cells, algal cells, fungal cells, etc.
[0208] In some embodiments, the cell is a receptor for the engineered DEAR nucleic acid manipulation system, isolated polynucleotides, nucleic acid constructs, or vectors provided by the present invention, and may also be referred to as a "host cell" or "target cell." The host cell or target cell can be a receptor for the engineered DEAR nucleic acid manipulation system, isolated polynucleotides, nucleic acid constructs, or vectors provided by the present invention.
[0209] In some specific implementations, non-limiting examples of cells include: prokaryotic cells, eukaryotic cells, bacterial cells, archaea cells, cells of unicellular eukaryotes, protozoan cells, cells derived from plants, algae cells, fungal cells, animal cells, cells derived from invertebrates, cells derived from vertebrates, and cells derived from mammals (e.g., ungulates; rodents; non-human primates; humans; felines; dogs, etc.). In some cases, the cell is not derived from a natural organism (e.g., the cell may be a synthetic cell; also known as an artificial cell).
[0210] Depending on the host / vector system used, any of a number of suitable transcriptional and / or translational control elements can be used in recombinant expression vectors, including constitutive and inducible promoters, transcriptional enhancer elements, transcription terminators, etc.
[0211] Methods for introducing nucleic acids into host cells are known in the art, and any convenient method can be used to introduce nucleic acids (e.g., recombinant expression vectors, isolated polynucleotides, nucleic acid constructs, and engineered DEAR nucleic acid manipulation systems) into cells. Suitable methods include, for example, viral infection, transfection, liposome transfection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, direct microinjection, and nanoparticle-mediated nucleic acid delivery.
[0212] <Reagents, kits, and pharmaceutical compositions>
[0213] In some embodiments of the present invention, the present invention provides a reagent or kit comprising the engineered DEAR nucleic acid manipulation system of the present invention, the isolated polynucleotides of the present invention, the nucleic acid constructs of the present invention, the vectors of the present invention, or the cells of the present invention.
[0214] In some embodiments of the present invention, the present invention provides a pharmaceutical composition comprising the engineered DEAR nucleic acid manipulation system of the present invention, the isolated polynucleotide of the present invention, the nucleic acid construct of the present invention, the vector of the present invention, or the cell of the present invention, and optionally, a pharmaceutically acceptable vector.
[0215] <Methods and Applications of Modifying Target Nucleic Acids>
[0216] This invention provides a method for modifying a target nucleic acid, the method comprising the step of contacting the target nucleic acid with the engineered DEAR nucleic acid manipulation system, the isolated polynucleotide, the nucleic acid construct, the vector, the cell, or the reagent or kit described herein. In some embodiments, the contact results in modification of the target nucleic acid by the engineered DEAR nucleic acid manipulation system.
[0217] This invention provides the use of the engineered DEAR nucleic acid manipulation system described in this invention, the isolated polynucleotides described in this invention, the nucleic acid constructs described in this invention, the vectors described in this invention, and the cells described in this invention in reagents or kits for modifying target nucleic acids or preparing modified target nucleic acids.
[0218] In some specific embodiments, the modification involves cleavage of the target nucleic acid. In some specific embodiments, the target nucleic acid is selected from DNA, RNA, genomic DNA, and extrachromosomal DNA.
[0219] In some specific embodiments, the contact occurs in vitro or in vivo. In some specific embodiments, the contact occurs inside or outside cells.
[0220] In some specific implementations, the cells are eukaryotic or prokaryotic cells.
[0221] In some more specific embodiments, the cells are selected from: plant cells, fungal cells, mammalian cells, reptile cells, insect cells, avian cells, fish cells, parasite cells, arthropod cells, invertebrate cells, vertebrate cells, rodent cells, mouse cells, rat cells, primate cells, non-human primate cells, and human cells.
[0222] In some more specific implementations, the contact results in genome editing.
[0223] In some implementations, the contact includes introducing the engineered DEAR nucleic acid manipulation system into the cell.
[0224] Example
[0225] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0226] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0227] Examples 1-7 illustrate the construction and effects of the original DEAR nucleic acid manipulation system.
[0228] Example 1. Screening RNA sequences for type C class II introns
[0229] To screen for type C class II introns, this embodiment utilizes 92 type C class II introns from a publicly available database to construct sequence and structural covariance models for the conserved I-III and V-VI domains of RNA sequences, respectively. Furthermore, a hidden Markov model of the amino acid sequence characteristics of potential IEP proteins was also constructed. Typically, the length of type C class II introns does not exceed 4000 nt; therefore, this embodiment sets a 4000 bp recognition window. Potential type C class II introns must simultaneously satisfy both the high-confidence I-III and V-VI domains within a 4000 bp range. If an IEP protein cannot be identified in the IV domain, it is considered a type C class II intron without an ORF.
[0230] Based on the aforementioned multiple covariance model, this embodiment identified 5,684 type C class II introns in the Earth metagenomic dataset. Active type C class II introns should have multiple highly similar copies within the same strain genome. Therefore, this embodiment clustered highly similar candidate type C class II introns within the same species metagenomics, identifying 469 potentially active type C class II introns with multiple copies.
[0231] To screen for stable, ORF-free ribozymes, this embodiment ranked candidate type C class II introns (GIIC introns) based on predicted secondary structure thermostability. Simultaneously, this embodiment also utilized RNA secondary structure prediction to further screen candidate type C class II introns with conserved substrate recognition region (TRS) secondary structures. Ultimately, DEAR1–9 were selected as the DEAR nucleic acid manipulation system, and substrate cleavage activity was verified. The secondary structure predictions of the selected DEAR1–9 (using RNAfold WebServer for RNA secondary structure prediction: http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) and their domain annotations are shown below. Figures 1A to 1IAs can be seen, the secondary structures of DEAR1 to 9 are quite similar, all consisting of domains I to VI. Each domain exists in a stem-loop structure and is naturally separated. The programmable TRS region is located in the apical loop region of domain I and is used to recognize nucleic acid substrates. The sequences of DEAR1 to 9 are shown in Table 1 below, where the underlined and bold parts are TRS.
[0232] Table 1:
[0233]
[0234] Example 2. Method for RNA preparation
[0235] First, the DNA sequences corresponding to DEAR1–9 screened in Example 1 were synthesized, and a T7 promoter (TAATACGACTCACTATA; SEQ ID NO: 19) was added upstream of each DEAR via PCR. The PCR amplification products were purified using DNA purification magnetic beads (VAHTS DNACleanBeads, Vazyme, catalog number N411-01), and the products were used as templates for in vitro transcription (IVT). The in vitro transcription reaction was performed in 30 mM Tris pH 8.1, 25 mM MgCl2, 0.01% Triton X-100, 2 mM spermidine, and 5 mM DTT, with 5 mM of each NTP added. An RNase inhibitor (Promega, catalog number N2111) and T7 RNA polymerase (NEB, catalog number M0251S) were added according to the reagent supplier's instructions. After reacting at 37°C for 4 hours, the DNA template and proteins were removed by sequential digestion with DNase I (Promega, catalog number M6101) and proteinase K (Beyotime, catalog number ST533). The transcripts were then washed and concentrated using a concentration tube with a molecular weight cutoff of 100 kDa. RNA quality was assessed using 8% Urea-PAGE electrophoresis. Specific results are shown below. Figure 2 As shown, RNA with nine ribozymes was successfully prepared. Compared with RNA of known length, the size of each RNA ribozyme was found to be consistent with its theoretical length.
[0236] Example 3. In vitro cleavage of single-stranded RNA, DNA, and plasmids using the DEAR nucleic acid manipulation system.
[0237] 1. DEAR Nucleic Acid Manipulation System for In Vitro Single-Stranded RNA Cutting
[0238] Single-stranded RNA (ssRNA) substrates with DEAR target sequences were synthesized according to the sequences shown in Table 2 (underlined and bolded portions indicate the target sequences recognized by DEAR). Each ssRNA substrate had a -Cy5 tag at its 3' end. Each DEAR (1.5 μM) substrate was incubated with a 100 nM ssRNA substrate at 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50 °C for 1 h. After terminating the reaction, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned using a fluorescence imaging system. Results are shown below. Figure 3 ,like Figure 3 As shown below, the products obtained from cleaving ssRNA are displayed, indicating that DEAR1 to DEAR9 can all cleave single-stranded RNA. Figure 3 In this context, I represents the input ssRNA, and C represents the cleavage product.
[0239] Table 2:
[0240]
[0241] 2. Validation of the ssRNA targeting region of the DEAR nucleic acid manipulation system
[0242] DEAR1–6 (1.5 μM each) were incubated with single-stranded RNA (100 nM) substrates that could not pair with the TRS region (DEAR1: substrate shown in SEQ ID NO:21; DEAR2: substrate shown in SEQ ID NO:23; DEAR3: substrate shown in SEQ ID NO:23; DEAR4: substrate shown in SEQ ID NO:22; DEAR5: substrate shown in SEQ ID NO:21; DEAR6: substrate shown in SEQ ID NO:23) at 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, and 37 °C. Samples were taken at time points (0 min, 5 min, 10 min, 30 min, 60 min, 120 min). After the reaction was terminated, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescence imager. See the gel image results below. Figure 4 ,like Figure 4 As shown, the product obtained from cleaving ssRNA is below the substrate, and it cannot be cleaved when the substrate cannot pair with the TRS region.
[0243] 3. DEAR Nucleic Acid Manipulation System for In Vitro Single-Strand DNA Cutting
[0244] Following the sequences shown in Table 3, single-stranded DNA (ssDNA) substrates containing the corresponding target sequences of DEAR1–6 were synthesized (underlined and bolded portions indicate the target sequences recognized by DEAR), with a -Cy5 tag at the 3' end. Each DEAR (1.5 μM) and its corresponding single-stranded DNA (100 nM) substrate were then incubated at 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50 °C, with samples taken at time points (0 min, 5 min, 10 min, 20 min, 40 min, 60 min, 120 min). After terminating the reaction, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned using a fluorescence imager. See [link to gel images and efficiency curves]. Figure 5 ,like Figure 5 As shown, the product obtained from cutting ssDNA is below the substrate, indicating that DEAR1 to DEAR6 can all cleave single-stranded DNA.
[0245] Table 3:
[0246]
[0247] 4. Validation of the ssDNA targeting region of the DEAR nucleic acid manipulation system
[0248] Each of DEAR1–6 (1.5 μM) was incubated with single-stranded DNA (100 nM) substrates that could and could not pair with the TRS region (the substrates used for DEAR1 were the sequences shown in SEQ ID NO:29 and SEQ ID NO:30, respectively; for DEAR2, the substrates were the sequences shown in SEQ ID NO:30 and SEQ ID NO:32, respectively; for DEAR3, the substrates were the sequences shown in SEQ ID NO:31 and SEQ ID NO:32, respectively; for DEAR4, the substrates were the sequences shown in SEQ ID NO:32 and SEQ ID NO:31, respectively; for DEAR5, the substrates were the sequences shown in SEQ ID NO:33 and SEQ ID NO:30, respectively; and for DEAR6, the substrates were the sequences shown in SEQ ID NO:34 and SEQ ID NO:32, respectively) at 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50 °C for 1 h. After the reaction was terminated, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescence imager. See the gel image results below. Figure 6 ,like Figure 6As shown, T represents paired substrate, T* represents the cleavage product of paired substrate, N represents unpaired substrate, N* represents the cleavage product of unpaired substrate, and M represents marker. The product obtained from cleaving ssDNA is below the substrate. It can be seen that DEAR1 to DEAR6 can all cleave single-stranded DNA, and cannot be cleaved when the substrate cannot pair with the TRS region.
[0249] 5. Validation of ssDNA cleavage sites in the DEAR nucleic acid manipulation system
[0250] Following the sequences shown in Table 4, single-stranded DNA (ssDNA) substrates containing the corresponding target sequences of DEAR1–6 were synthesized (underlined and bolded portions indicate the target sequences recognized by DEAR), with a -Cy5 tag at the 3' end. Each DEAR (1.5 μM) and the corresponding single-stranded DNA (100 nM) substrate were then incubated for 24 h at 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50 °C. After terminating the reaction, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned using a fluorescence imager. See gel images below. Figure 7 ,like Figure 7 As shown, the larger triangles represent the major cleavage sites, the smaller triangles represent the minor cleavage sites, I represents the substrate, Dr1-6 represent the cleavage products of DEAR1-6, L is the ladder generated by random digestion of ssDNA with DNase I (Promega, catalog number M6101) to indicate product length, M represents the marker, and the products obtained from cleaving ssDNA are below the substrate. It can be seen that the major cleavage site is located 0-1 nt downstream of the 3' end of the TRS pairing region.
[0251] Table 4:
[0252]
[0253] 6. Optimization of DNA cleavage conditions for DEAR1
[0254] The DEAR1 (1.5 μM) and single-stranded DNA 1X-DEAR1 (SEQ ID NO: 35; 100 nM) substrate were incubated under different concentrations of monovalent and divalent ions and at different temperatures. Samples were taken at different time points (0 min, 5 min, 10 min, 20 min, 40 min, 1 h, 2 h, 4 h, 8 h, 12 h, 24 h). After the reaction was terminated, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescence imager. See [link to gel images and efficiency curves]. Figures 8-9 ,like Figures 8-9 As shown, the product obtained from DNA cleavage is below the substrate, indicating that DEAR1 prefers K.+ Furthermore, the lower the concentration, the stronger the activity, which differs from previously reported class II introns (N. Toor, K. S Keating, S. D Taylor, A. M. P. Y., Crystal structure of a self-spliced group II intron. Science 320, 77-82 (2008); C. Quiroga, P. H. Roy, D. Centron, The S. ma. I2 class C group II intron inserts at integron attCsites. Microbiology (Reading) 154, 1341-1353 (2008).). Additionally, DEAR1 exhibits higher Mg content. 2+ The activity increases with temperature. It exhibits activity at temperatures ranging from 25 to 50°C, with particularly good activity at temperatures between 37 and 42°C. Specific reaction conditions: Figure 8 The concentrations of A, KCl, MgCl2, MgCl2, and MgCl2 in the sample are 150 mM, 10 / 50 / 125 mM, 40 mM MOPS, 7.5, and 37 °C. Figure 8 The B in the solution is 10 / 150 / 500mM KCl, 50mM MgCl2, 40mM MOPS 7.5, 37℃; Figure 8 The concentrations of C in the solution are: 10 / 150 / 500mM NH4Cl, 50mM MgCl2, 40mM MOPS 7.5, and 37℃. Figure 8 The concentrations of D in the solution are: 10 / 150 / 500mM NaCl, 50mM MgCl2, 40mM MOPS7.5, and 37℃. Figure 8 The concentrations of E, 10mM KCl, 50mM MgCl2, 40mM MOPS 7.5, and temperatures of 25 / 37 / 42 / 50 / 60℃ are as follows.
[0255] 7. Comparison of DNA cleavage efficiency between DEAR1 and RNA-guided proteases
[0256] The DEAR1 (1.5 μM) and single-stranded DNA 1X-DEAR1 (SEQ ID NO: 35; 100 nM) substrate were incubated at 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, and 37 °C. Samples were taken at different time points (0 min, 10 min, 30 min, 1 h, 2 h, 4 h, 8 h, 16 h). For the CRISPR-Cas nuclease system used, the reaction system was prepared at a ratio of RNP:DNA = 15:1 according to the methods described in A. Sun et al., The compact Caspi (Cas12l) 'bracelet' provides a unique structural platform for DNA manipulation. Cell Res 33, 229-244 (2023), CATsuchida et al., Chimeric CRISPR-CasX enzymes and guide RNAs for improved genome editing activity. MolCell 82, 1199-1209e1196 (2022), and M. Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012), and samples were taken at different time points (0 min, 10 min, 30 min, 1 h, 2 h, 4 h, 8 h, 16 h). After terminating the reaction, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescence imaging system. See [link to gel images and efficiency curves]. Figure 10 ,like Figure 10 As shown, the product obtained from DNA cleavage is below the substrate. It can be seen that the cleavage efficiency of DEAR1 is close to that of SpyCas9 and AbCasπ1, and higher than that of PlmCasX.
[0257] 8. DEAR Nucleic Acid Manipulation System for In Vitro Plasmid Cutting
[0258] A plasmid (backbone: pUC19 plasmid purchased from Addgene, Plasmid #50005) carrying the target sequence corresponding to DEAR1 (TGTCTTAAGACA; SEQ ID NO:41) was designed and synthesized. The DEAR1 (1.5 μM) and plasmid substrate (0.03 μM) were incubated at 150 mM KCl, 10 mM MgCl2, 40 mM MOPS 7.5, and 37 °C, with samples taken at time points (0 h, 3 h, 8 h, 24 h). After terminating the reaction, agarose gel electrophoresis was performed, and gel images were obtained using a UV imager. The results are as follows: Figure 11 As shown, L indicates a plasmid treated with EcoRI (NEB, catalog number R0101V) and exhibiting a linear double-stranded state; OC indicates a plasmid treated with Nt.BspQI (NEB, catalog number R0644S) and exhibiting an open-ring state; SC indicates an untreated plasmid exhibiting a supercoiled state; 0, 3, 8, and 24 represent the time (in hours) for cutting the plasmid using DEAR1. See also... Figure 11 The substrate particles are in a supercoiled state, and the products obtained from the cleavage reaction are in an open-ring state. Above the substrate, DEAR1 can be seen to cleave the plasmid.
[0259] Example 4. Plasmid interference within E. coli cells
[0260] 1. Construction of target plasmids
[0261] The ccdB toxicity gene induced expression plasmid with the corresponding target sequences of DEAR1-3 at the plasmid replication origin (ori) was used as the target plasmid (addgene sequence number: 69056).
[0262] 2. Construction of the DEAR expression plasmid
[0263] In the DEAR expression plasmid, the J23119 promoter (its specific sequence is (SEQ ID NO:42): TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT) is used to initiate the expression of each DEAR sequence. The construction method is as follows: the J23119 promoter is linked to DEAR1–3 respectively. Then, the sequences of DEAR1–3 linked to the J23119 promoter are inserted into the pCDFDuet1 plasmid vector (Novagen catalog number: 71340-3) via homologous recombination, completely replacing the 410–3765 region sequence of the plasmid.
[0264] 3. Construction of the CRISPR-Cas nuclease system
[0265] In the CRISPR-Cas nuclease expression plasmid, Cas9 nuclease expression was initiated using the Trc promoter (its specific sequence is (SEQ ID NO:43): TTGACAATTAATCATCCGGCTCGTATAATG), and its corresponding guide RNA (sgRNA) sequence was initiated using the J23119 promoter (its specific sequence is the same as above). The positive control group ( Figure 12 The sgRNA expressed by the group labeled PC (i.e., PC group) contains a 20-base target sequence (the specific sequence is (SEQ ID NO:44): GCGATAGTCGTGTCTTACC), which cleaves the target plasmid under the guidance of the sgRNA; the negative control group ( Figure 12 The sgRNA expressed by the group marked NC (i.e., NC group) does not contain a 20-base target sequence and cannot cleave the target plasmid. Its construction method is as follows: After linking the Cas9 sequence to the Trc promoter, link the sgRNA to the J23119 promoter. Then, insert the entire Trc-Cas9-J23119-sgRNA sequence into the pCDFDuet1 plasmid vector (Novagen catalog number: 71340-3) via homologous recombination, completely replacing the 410–3765 region sequence of the plasmid.
[0266] 4. Detection of plasmid interference within E. coli cells
[0267] The targeting plasmid from step 1 was combined with different expression plasmids constructed in steps 2 and 3 (DEAR1-3 expression plasmids and CRISPR-Cas nuclease system expression plasmids) and introduced into *E. coli* strain BW25141 (CGSC strain accession number: 7635). After a certain period of cultivation, bacterial culture samples were taken and cultured on plates containing ccdB inducer (10 mM arabinose, Sangon Biotech product number: A610071) and on plates resistant to the targeting plasmid (ampicillin). See [link to relevant documentation]. Figure 12 In group A, when bacteria contain only the target plasmid, they can survive and display plaques on ampicillin plates, but cannot grow on ccdB-induced expression plates (groups BC and NC). This is largely consistent with the survival and death of plaques when the expressed plasmid does not cleave the target plasmid (group NC, expressing Cas9 but not cleaving ccdB). When the expressed plasmid cleaves the target plasmid (group PC, expressing Cas9 and cleaving ccdB; groups DEAR1–DEAR3, expressing the corresponding intron RNA sequences respectively), the ccdB toxic gene cannot be expressed normally, allowing bacteria to survive on ccdB-induced expression plates. Simultaneously, bacteria lose their ampicillin resistance due to the cleavage of the target plasmid and die on ampicillin plates. Bacterial plate plating results and ccdB gene expression level analysis show that DEAR1–DEAR3 can all cleave the plasmid within E. coli cells.
[0268] 5. Further validation of intracellular plasmid interference in DEAR1 E. coli cells
[0269] The DEAR1 expression plasmid was PCR-converted using primers GGATGAGTTTGCAAACAAAGTCCTTTCTGCCG (SEQ ID NO:45) and AGGACTTTGTTTGCAAACTCATCCAATGATACCTAGC (SEQ ID NO:46), and a ΔTRS mutant expression plasmid was constructed by homologous recombination, denoted as Dr1_ΔTRS (an expression plasmid constructed by deleting 6 nucleotides of the TRS sequence from DEAR1), which was used as one of the expression plasmids;
[0270] Primers were used for the plasmids used in the NC group in step 3:
[0271] PCR was performed on AGTACAGCATCGGCCTGGCCATCGGCACCAACTCTGTGG (SEQ ID NO:47) and GGCCAGGCCGATGCTGTACTTCTTGTCAGAACCGTGGTGA (SEQ ID NO:48). The PCR products were further processed using primers:
[0272] CCGACTACGATGTGGACGCCATCGTGCCTCAGAGCTTTC (SEQ ID NO:49) and GGCGTCCACATCGTAGTCGGACAGCCGGTTGATGTCC (SEQ ID NO:50) were subjected to PCR and homologous recombination to construct a dCas9 expression plasmid (all two Cas9 restriction enzyme active sites were mutated and inactivated), denoted as dCas9, as one of the expression plasmids;
[0273] Primers were used for the plasmids used in the PC group in step 3:
[0274] PCR was performed on CCGACTACGATGTGGACGCCATCGTGCCTCAGAGCTTTC (SEQ ID NO:49) and GGCGTCCACATCGTAGTCGGACAGCCGGTTGATGTCC (SEQ ID NO:50), and an nCas9 expression plasmid was constructed by homologous recombination (one of the Cas9 restriction enzyme active sites was inactivated by H840 mutation), denoted as nCas9, as one of the expression plasmids;
[0275] The plasmid used in group PC in step 3 was not modified and was used as the wtCas9 expression plasmid. The targeting plasmid constructed in step 1 and the different expression plasmids mentioned above (dCas9, nCas9, wtCas9, Dr1_ΔTRS, and the DEAR1 expression plasmid used in step 2) were combined and introduced into *E. coli* strain BW25141 (CGSC strain accession number: 7635). After a certain period of cultivation, bacterial culture samples were taken and cultured on targeting plasmid-resistant plates (ampicillin). See [link to relevant documentation]. Figure 13 When bacteria contain only the target plasmid, they can survive and display plaques on ampicillin plates (Blank group); the survival and death of plaques are basically consistent with those transformed with the DEAR expression plasmid Dr1_ΔTRS (with TRS removed) and those expressing dCas9. The DEAR1 expression plasmid cleaves the target plasmid, and the results are basically consistent with those of nCas9 and wtCas9 expression; bacteria lose ampicillin resistance due to the cleavage of the target plasmid and die on ampicillin plates. Bacterial plate plating results and AmpR gene expression level analysis show that DEAR1 can cleave the plasmid within *E. coli* cells via the TRS region.
[0276] Example 5. Detection of plasmid interference of DEAR4-9 in Escherichia coli cells
[0277] 1. Construction of target plasmids
[0278] The ccdB toxic gene induced expression plasmid with the corresponding intron RNA target sequences of DEAR1, DEAR4-9 at the plasmid replication origin (ori) was used as the target plasmid (addgene sequence number: 69056).
[0279] 2. Construction of other DEAR expression plasmids
[0280] The method is basically the same as in Example 4. In the DEAR expression plasmid, the J23119 promoter (its specific sequence is (SEQ ID NO:42): TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT) is used to start the expression of each DEAR sequence. The construction method is as follows: The J23119 promoter is connected to Dr1_△TRS, DEAR1, and DEAR4~9 respectively (where Dr1_△TRS and DEAR1 are the same as in Example 4). Then, the sequences of Dr1_△TRS, DEAR1, and DEAR4~9 connected to the J23119 promoter are inserted into the pCDFDuet1 plasmid vector (Novagen catalog number: 71340-3) by homologous recombination, replacing the 410~3765 interval sequence of the plasmid.
[0281] 3. Detection of plasmid interference within E. coli cells
[0282] The method is basically the same as in Example 4. The targeting plasmid from step 1 and the different expression plasmids (Dr1_△TRS, DEAR1, DEAR4-9 expression plasmids) constructed in step 2 were combined and introduced into *Escherichia coli* strain BW25141 (CGSC strain accession number: 7635). After a certain period of cultivation, bacterial culture samples were taken and cultured on ampicillin-containing plates containing the targeting plasmid resistance. See [link to example]. Figure 14 When the expressed plasmid did not cleave the target plasmid (Dr1_△TRS, DEAR4, DEAR6, DEAR7, DEAR8, and DEAR9 groups: expressing the corresponding intron RNA sequences, respectively), the bacterial plaques survived. When the expressed plasmid cleaved the target plasmid (DEAR1 and DEAR5 groups: expressing the corresponding intron RNA sequences, respectively), the bacteria lost their ampicillin resistance due to the cleavage of the target plasmid and died on the ampicillin plate. Bacterial plate plating results and Amp gene expression level analysis showed that DEAR1 and DEAR5 could cleave the plasmid in E. coli cells, while DEAR4, 6, 7, 8, and 9 had no plasmid cleavage activity in E. coli cells.
[0283] Example 6. DEAR of reprogrammed TRS cleavage at new DNA sites
[0284] Single-stranded DNA substrates with novel DEAR target sequences were synthesized according to the sequences shown in Table 5 (underlined and bolded portions indicate the target sequences recognized by DEAR), with a -Cy5 tag at the 3' end. DEAR1–6 (1.5 μM) with TRS sequences modified to CGAUAG were incubated with this single-stranded DNA (100 nM) substrate at 50 mM MgCl2, 10 mM KCl, 40 mM MOPS 7.5, and 37 °C for 8 h. After terminating the reaction, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned using a fluorescence imaging system. Results are shown below. Figure 15 ,like Figure 15 As shown, the product obtained from cutting ssDNA is below the substrate, indicating that DEAR1 to DEAR6 can all cut new single-stranded DNA. Figure 15 In the diagram, I represents the input ssDNA substrate, and Dr1*-Dr6* represent the cleavage products of DEAR1-6 pairs of ssDNA after TRS modification.
[0285] Table 5:
[0286]
[0287] Example 7. Genomic DNA Cutting in Mammalian Cells
[0288] 1. Construction of stable transfection plasmids
[0289] Using PiggyBacTM Constructing DEAR1 target sequence stable transfection plasmid and DEAR stable transfection plasmid using the Transposon Vector System (from System Biosciences):
[0290] (1) Construction of a stable plasmid for the DEAR1 targeting sequence: The frameshifted sequence of the puromycin resistance (PuroR) gene with the DEAR1 targeting sequence at the N-terminus was obtained.
[0291]
[0292] (SEQ ID NO:52, where uppercase letters represent the DEAR1 target sequence, and bold and underlined letters represent sites that DEAR1 can specifically recognize and cleave. DEAR1 can cleave both the sense and antisense strands at this site, resulting in double-strand breaks. Lowercase letters represent the PuroR gene.) The gene was inserted into the XbaI restriction site of the PiggyBac Dual promoter PB513B-1 plasmid multiple cloning site using homologous recombination, and the blastcin resistance (Blasticidine S-deaminase) gene was then introduced using homologous recombination.
[0293] atggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagc
[0294] gtcgccagcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggt
[0295] gctgggcactgctgctgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcg
[0296] gacggtgccgacaggtgcttctcgatctgcatcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtgggagggctaa (SEQ ID NO:53) is inserted between the NcoI and SalI restriction sites.
[0297] (2) Construction of DEAR stable plasmid: The DEAR1 sequences initiated by the U6 promoter and terminated by the TTTTTTTT signal were respectively:
[0298] (SEQ ID NO:54, uppercase, bold, and underlined letters represent the U6 promoter sequence, uppercase letters not represented by bold and underlined letters represent the corresponding DNA sequence of DEAR1, and lowercase letters represent transcription termination signals and part of the vector backbone sequence), or, the DEAR-NT sequence initiated by the U6 promoter and terminated by the TTTTTTTT signal:
[0299] (SEQ ID NO:55, uppercase, bold, and underlined letters represent the U6 promoter sequence; uppercase letters not represented by bold and underlined letters represent the DEAR-NT (the corresponding DNA sequence of DEAR2) sequence; lowercase letters represent the transcription termination signal and part of the vector backbone sequence.) The hygromycin resistance (HygBR) gene was inserted between the SfiI and MluI restriction sites in the PiggyBac Dual promoter PB513B-1 plasmid using homologous recombination.
[0300]
[0301] 2. Enrichment of DEAR targeting sequences with stable transfection and resistance selection for DEAR
[0302] HEK-293T (ATCC CRL-11268) cells were cultured to the logarithmic growth phase in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. After digestion with 0.25% trypsin, the cells were washed twice with PBS (pH 7.0–7.2) and resuspended in Opti-MEM. TM (Gibco, product number: 31985070) In culture medium, adjust the cell density to 5 × 10⁻⁶ cells / year. 4 Add 2 μg of Integration PB transposase plasmid (System Biosciences) and 2 μg of DEAR1 targeting sequence stable transfection plasmid to 20 μL of cell suspension. Electrolyze the cell suspension (Celetrix biotechnologies, model: LE+) at 450V. Add the electroporated cells to DMEM high glucose medium containing 10% fetal bovine serum. After electroporation for 24 hours, replace the medium with medium containing 10 μg / mL Blasticidin. Screen for drugs for one week, and passage the cells according to their growth status. Once the cells are stable, a stable transfected cell line containing the DEAR1 targeting sequence is obtained. Using the same method, electroporate 2 μg of Integration PB transposase plasmid (SystemBiosciences) and 2 μg of DEAR stable transposable plasmid (DEAR1 stable transposable plasmid or DEAR-NT stable transposable plasmid) into a stable cell line containing the DEAR1 targeting sequence. After 24 hours of electroporation, replace the medium with medium containing 50 μg / mL Hygromycin B and screen for the drug for one week, passaged according to cell growth status during this period. Once the cell condition is stable, replace the medium with medium containing 10 μg / mL Puromycin and screen for the drug for one week.
[0303] For stable cell lines containing the DEAR1 target sequence, the integrated PuroR gene is in a frameshift state and cannot express the correct protein, thus lacking resistance to Puromycin. The DEAR1 (DEAR1 stable transgenic plasmid) can cleave the DEAR1 target sequence, causing DNA double-strand breaks. Insertion or deletion mutations introduced by break repair can restore the frameshifted PuroR gene, enabling normal expression and leading to cell survival under Puromycin selection. However, the DEAR-NT (DEAR-NT stable transgenic plasmid) cannot cleave the DEAR1 target sequence, preventing cells from expressing the correct PuroR gene, resulting in cell death under Puromycin selection. Figure 16 As shown, cells stably transfected with DEAR1 (DEAR1 stable transfect plasmid) survive, while cells stably transfected with DEAR-NT (DEAR-NT stable transfect plasmid) die.
[0304] 3. Next-generation sequencing verifies DEAR1's ability to cleave genomic DNA in mammalian cells.
[0305] for Figure 16 Genomic DNA was extracted from surviving cells (stable transfected with DEAR1, i.e., stably transfected with DEAR1 plasmids) and the DEAR1 target sequence was used for next-generation sequencing library construction using the TIANSeq Fast DNA Library Kit (Illumina). Next-generation sequencing was performed by Novogene. The next-generation sequencing data were analyzed online using the CRISPResso2 website, and the results are as follows: Figure 17 As shown in Figure A, 47.14% of the reads contained mutations. Figure 17 B shows the sequence alignment of reads near the first and second cleavage sites in the DEAR1 target sequence. Both insertion and deletion mutations occur near the DEAR1 cleavage sites (dashed lines in the figure). Sequencing data demonstrate that DEAR1 has specific cleavage activity against double-stranded genomic DNA in mammalian cells.
[0306] Example 8. Improving the cleavage activity and specificity of the DEAR nucleic acid manipulation system by extending the TRS region.
[0307] The DEAR nucleic acid manipulation system is a type of ribonucleic acid biomolecule that performs site-specific cleavage of DNA and RNA as substrates. The TRS region is its specific region responsible for substrate recognition. Figure 18 As shown, biochemical experiments have shown that the wild-type DEAR system depends only on the 6-nt sequence of its TRS when the substrate is cleaved.
[0308] As shown in Table 6, extending the TRS reduces the frequency of the corresponding substrate-binding sequence in the genome, thereby improving specificity. For example, when a 6-nt substrate is extended to more than 10-nt, its frequency in E. coli is reduced by approximately 250 times compared to the original 6-nt sequence. Therefore, extending the TRS sequence can significantly improve the specificity of substrate recognition.
[0309] Table 6:
[0310] target sequence length Average frequency of occurrence in the E. coli genome 6-nt 1137.92 7-nt 281.53 8-nt 70.31 9-nt 17.70 10-nt 4.42 11-nt 1.11 12-nt 0.28
[0311] Therefore, in this embodiment, the structure of DEAR1-9 was resolved by cryo-electron microscopy, specifically as follows: Figure 19As shown, DEAR1-9 each possess six structural domains, domains I-VI, also referred to as D1-D6. D1 is the largest domain, and the TRS substrate recognition sequence is located on D1. D1-D4 and D6 form the structural framework, stabilizing the overall configuration. D5 is the catalytically active structural center, which forms the catalytically active center by binding two magnesium ions. From the secondary and tertiary structures, it was found that DEARs all possess conserved catalytically active centers and substrate recognition regions (see...). Figure 20 Therefore, in this embodiment, one type of DEAR (DEAR1) will be used as an example for explanation.
[0312] The nucleotides corresponding to D1-D6 in DEAR1-9 are shown below:
[0313] DEAR1
[0314] D1:1-266, D2:267-339, D3:340-385, D4:386-562, D5:563-596, D6:597-633,
[0315] TRS:181-186
[0316] DEAR2
[0317] D1:1-267, D2:268-318, D3:319-375, D4:376-562, D5:563-596, D6:590-633,
[0318] TRS:181-186
[0319] DEAR3
[0320] D1:1-266, D2:267-350, D3:351-390, D4:391-572, D5:573-606, D6:607-647,
[0321] TRS: 180-185
[0322] DEAR4
[0323] D1:1-262, D2:263-318, D3:319-379, D4:380-573, D5:574-607, D6:608-650,
[0324] TRS:179-184
[0325] DEAR5
[0326] D1:1-266, D2:267-342, D3:343-385, D4:343-569, D5:570-603, D6:604-640,
[0327] TRS:181-186
[0328] DEAR6
[0329] D1:1-299, D2:300-342, D3:343-411, D4:386-515, D5:516-550, D6:551-595,
[0330] TRS:214-219
[0331] DEAR7
[0332] D1:1-290, D2:291-380, D3:381-448, D4:386-561, D5:562-596, D6:597-644,
[0333] TRS:206-211
[0334] DEAR8
[0335] D1:1-267, D2:268-338, D3:339-375, D4:386-613, D5:614-594, D6:595-647,
[0336] TRS: 180-185
[0337] DEAR9 (no D4 structure field, indicated by "---")
[0338] D1:1-266, D2:267-342, D3:343-380, D4: ---, D5:381-415, D6:416-451, TRS:181-186
[0339] For example, the I domain (D1) in DEAR1 corresponds to nucleotides 1 through 266 of the nucleotide sequence of DEAR1 (SEQ ID NO: 1).
[0340] Through structural analysis, it was found that there is a large room for modification in the TRS region of DEARs. Therefore, this embodiment proposes to extend and modify its TRS region.
[0341] First, this embodiment tests the modifiability of the TRS region by replacing the TRS region (nucleotides 181-186 of the exemplary DEAR1) with different sequences. The sequences of different TRS and their corresponding substrates (the substrate-binding sequences of the corresponding TRS are shown in bold) are listed in Table 7 below:
[0342] Table 7:
[0343]
[0344] Following the method in Example 2, DNA sequences of DEAR1 with different TRS sequences were synthesized and RNA was prepared. The cleavage activity of the corresponding RNA was detected under the conditions of 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, and 37°C, according to the experimental methods in Examples 3-6. It was found that different sequences all produced cleavage effects, with slight differences in cleavage activity. The DEAR1 cleavage activity of TRS sequences UGUCCC and CGAUAG was weaker than the original version, while the DEAR1 cleavage activity of TRS sequence GGAGUG was stronger than the original version. This indicates that the TRS region sequence can be substituted, such as... Figure 21 As shown in B in the diagram.
[0345] Secondly, by replacing the TRS sequence with sequences of different lengths, this embodiment demonstrates the potential of extending the TRS region to improve the specificity of the DEAR nucleic acid manipulation system. Following the method in Example 2, the corresponding DNA sequences of DEAR1 were synthesized using 0-nt TRS (i.e., TRS deleted from the full-length DEAR sequence), 2-nt TRS (i.e., TRS replaced with GA in the full-length DEAR sequence), 4-nt TRS (i.e., TRS replaced with AGAC in the full-length DEAR sequence), 6-nt TRS (i.e., the original full-length DEAR sequence), 8-nt TRS (i.e., TRS replaced with CUAAGACA in the full-length DEAR sequence), 10-nt TRS (i.e., TRS replaced with CGCUAAGACA (SEQ ID NO:89) in the full-length DEAR sequence), 12-nt TRS (i.e., TRS replaced with UCCGCUAAGACA (SEQ ID NO:90) in the full-length DEAR sequence), and 14-nt TRS (i.e., TRS replaced with GAUCCGCUAAGACA (SEQ ID NO:91) in the full-length DEAR sequence), and RNA was prepared. Following the experimental methods in Examples 3-6, RNA was prepared using 10 mM KCl and 50 mM KCl. The cleavage activity of the corresponding RNA was detected under the conditions of MgCl2, 40 mM MOPS, 7.5, and 37 °C. All substrates used were ssDNA substrates with the sequence SEQ ID NO:35 and a -Cy5 tag at the 3' end. Extension was performed in the TRS region of DEAR1, such as... Figure 21 As shown in Figure C, it can be seen that the TRS still retains DNA cleavage activity even when extended to 12 nt. The 6 nt TRS region exhibits the highest cleavage activity in the original version. This indicates that the TRS region has high modifiability.
[0346] Furthermore, plasmid cleavage experiments in bacteria also demonstrated that the TRS-extended DEAR1 still retains cleavage activity. Following the experimental method in step 2 of Example 4, the following TRS were synthesized: 0-nt TRS (i.e., TRS deleted from the full-length DEAR sequence), 2-nt TRS (i.e., TRS replaced with GA in the full-length DEAR sequence), 4-nt TRS (i.e., TRS replaced with AGAC in the full-length DEAR sequence), 6-nt TRS (i.e., the original version of the full-length DEAR sequence), 8-nt TRS (i.e., TRS replaced with GUAAGACA in the full-length DEAR sequence), 10-nt TRS (i.e., TRS replaced with CGGUAAGACA (SEQ ID NO: 92) in the full-length DEAR sequence), 12-nt TRS (i.e., TRS replaced with CCCGGUAAGACA (SEQ ID NO: 93) in the full-length DEAR sequence), 14-nt TRS (i.e., TRS replaced with AACCCGGUAAGACA (SEQ ID NO: 94) in the full-length DEAR sequence), and 16-nt TRS (i.e., TRS replaced with CCAACCCGGUAAGACA (SEQ ID NO: 94) in the full-length DEAR sequence). The corresponding DNA sequence of DEAR1 (NO:95) was extracted and constructed into a DEAR expression plasmid in E. coli cells. Following the experimental method in step 4 of Example 4, the plasmid interference ability of DEAR1 molecules of different TRS lengths was tested. The targeting plasmid was the ccdB toxic gene-induced expression plasmid described in step 1 of Example 4 (addgene sequence number: 69056; DEAR1 molecules of different TRS lengths can all target the ori of this plasmid). Figure 21 In the D, it can be observed that DEAR1, which undergoes TRS extension, still retains cleavage activity in bacteria at 4-10 nt.
[0347] These experiments show that, under both in vivo and in vitro conditions, TRS can be preferentially extended to 7–10 nt, and with improved specificity, it retains basic cleavage activity against both DNA and bacterial plasmids in vitro. Of course, as previously demonstrated, extensions to 12 nt, 14 nt, etc., also exhibit cleavage activity with increased specificity.
[0348] Example 9: Enhancing the cleavage activity and specificity of the DEAR nucleic acid manipulation system by adding a recruitment sequence at the 3' end.
[0349] For the DEAR nucleic acid manipulation system, its 3' end is near the catalytically active pocket of DEAR. Therefore, this embodiment designs a modification method to improve its substrate (target nucleic acid) recognition specificity by designing a DNA sequence that is specifically complementary to the substrate (target nucleic acid), thereby improving cleavage activity. Figures 22-24As shown, this embodiment tested two schemes: 1) by deleting the VI domain (D6) in DEAR and adding a recruiter sequence; or 2) by directly adding a recruiter sequence after DVI, thereby increasing substrate recognition specificity and improving cleavage activity.
[0350] (1) Deleting the DEAR6 domain VI and adding recruitment sequences to enhance cleavage activity.
[0351] First, in this embodiment, the above-mentioned modifications were made to DEAR6, and the following DNA sequences were synthesized: 1) the corresponding DNA sequence of DEAR6 with the VI domain (551-595) deleted (V1); 2) the corresponding DNA sequence of DEAR6 with the VI domain (551-595) deleted and the recruitment sequence CCTACGCACTACCCAGTAAA (SEQ ID NO:58) added to the 3' end (V2). Figure 22 In the diagram, A represents two modified versions and the original DEAR nucleic acid manipulation system. Figure 22 B in the diagram illustrates how the recruitment sequence helps identify the substrate sequence. The recruitment sequence is located at the 3' end of DEAR and can hybridize with the recruitment-binding sequence in the substrate. The TRS (substrate recognition sequence, ACAUCA for DEAR6) can hybridize with the substrate-binding sequence in the substrate. There is a gap between the substrate-binding sequence and the recruitment-binding sequence, called the linker sequence. The corresponding RNA was prepared according to the method in Example 2. Substrate ssDNA with different lengths of linker sequences labeled with Cy5 at the 3' end was cleaved (sequences are shown in Table 8 below; substrate-binding sequences are bolded, linker sequences are italicized, and recruitment-binding sequences are underlined). Following the experimental methods in Examples 3-6, the cleavage activity of the modified DEAR6 molecule against substrates with different lengths of linker sequences was detected under the conditions of 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, and 37°C.
[0352] Table 8:
[0353]
[0354] like Figure 22 As shown in C and D, compared to the original DEAR6 (DEAR6 WT), DEAR6 with the VI domain removed (DEAR6_△DVI), and DEAR6 with the VI domain removed and a recruitment sequence added (DEAR6_△DVI-recruitment sequence), showed a significant improvement in substrate cleavage activity (the figure shows the gel map and cleavage efficiency diagram for the 20nt linkage sequence substrate at different time points: 0h, 0.5h, 1h, 2h, 4h, 8h, 12h, 24h).
[0355] Furthermore, this embodiment explores the impact of different connection sequence lengths on the cutting efficiency, such as... Figure 23 As shown, Figure 23 In the diagram, A represents the substrate ssDNA. Figure 23 In the diagram, B represents DEAR6 WT, DEAR6_△DVI, and DEAR6_△DVI-recruitment sequences, respectively, illustrating the cutting efficiency of substrates with different connection sequence lengths after 24 hours of cutting. Figure 23 In the diagram, C, D, and E represent DEAR6 WT, DEAR6_△DVI, and DEAR6_△DVI, respectively, illustrating the cutting efficiency of the recruitment sequence for substrates of different connection sequence lengths at different time points. Figure 23 F in the table represents the cleavage efficiency of the experimental groups mentioned above. The results show that the suitable length range for the ligation sequence is 20-50 nt, with 30-nt being the preferred length.
[0356] (2) Recruitment sequence length test
[0357] Furthermore, the same modification strategy was tested on DEAR1 in this embodiment. The corresponding DNA sequence of DEAR1 was synthesized with the VI domain (601-637) deleted and the recruitment sequence ATGAGCATGATTAGGCCTAG (SEQ ID NO: 66) added to the 3' end. The corresponding RNA was prepared according to the method in Example 2. Using the original DEAR1 RNA as a control, the substrate ssDNA (sequence: […]) with a 3' end labeled with -Cy5 and a ligation sequence length of 12 nt was cleaved under the conditions of 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, and 37°C, according to the experimental methods in Examples 3-6. Substrate-binding sequences are bolded and underlined, ligation sequences are italicized, and recruitment and binding sequences are underlined. Results show that deleting domain VI and adding the recruitment sequence also enhances DEAR1's cleavage of the substrate ssDNA. Figure 24 As shown in A in the diagram.
[0358] To explore suitable recruitment sequence lengths, this example synthesized the corresponding DNA sequences of DEAR1 with 14nt recruitment sequences (sequence ATGAGCATGATTAG (SEQ ID NO: 68)), 20nt recruitment sequences (sequence ATGAGCATGATTAGGCCTAG (SEQ ID NO: 66)), and 26nt recruitment sequences (sequence ATGAGCATGATTAGGCCTAGCTCTTC (SEQ ID NO: 96)) added to the 3' end. The corresponding RNA was prepared according to the method in Example 2. The substrate ssDNA (sequence of -Cy5-tagged at the 3' end) was cleaved under the conditions of 10mM KCl, 50mM MgCl2, 40mM MOPS 7.5, and 37°C. The substrate binding sequence is highlighted in bold and underlined, while the recruitment and binding sequences are displayed in italics. For the 14nt recruitment sequence, the dotted underlined portion can be identified; for the 20nt recruitment sequence, both double and dotted underlines can be identified; and for the 26nt recruitment sequence, single, double, and dotted underlines can be identified. Figure 24 As shown in Figure B, DEAR1 with 14nt, 20nt, and 26nt recruitment sequences at the 3' end exhibits similar cleavage efficiency. Therefore, recruitment sequence lengths of 14nt-26nt are all optional, with 20nt being the preferred length (a 6nt TRS combined with a 20nt recruitment sequence, totaling 26nt of recognition sequence, already meets the requirements for recognizing most specific sites on the genome; the spacer length of commonly used SpyCas9 and AsCas12a gRNAs is around 20nt).
[0359] Through modification tests on DEAR1 and DEAR6, this embodiment found that both directly adding the recruitment sequence and deleting D6 and then adding the recruitment sequence can improve its cleavage activity against DNA substrates. Since all DEAR systems have a similar D6, this modification is applicable to all DEARs. Therefore, the recruitment sequence binding sequence is located at the 3' end of the substrate binding sequence, and the length of the connecting sequence in between is preferably selected in the range of 20-50 nt. Figure 23 The highest cutting rate is achieved at approximately 30 nt: the length of the recruitment sequence is preferably in the range of 14-26 nt. Furthermore, generally, the recruitment sequence preferably does not contain any sequences that can be identified by TRS and cut by DEAR. In some preferred embodiments, the recruitment sequence is designed with a Gibbs free energy of less than 7 for its secondary structure.
[0360] Example 10. Improving substrate recognition specificity by modifying originally homodimer DEARs into heterodimer DEARs.
[0361] The results of cryo-electron microscopy analysis show that ( Figure 19 DEAR1 can form homodimers under natural conditions. Figure 21 In the diagram, A represents a schematic of the DEAR1 homodimer. Furthermore, this dimerization depends on the dimerization motif of its III domain (D3) (positions 361-366, sequence UCUAGA). Therefore, this embodiment mediates the formation of heterodimers (e.g., DEAR1 molecules with two different dimerization motifs and two different TRS, referred to as monomer 1 and monomer 2, respectively, and their TRS referred to as TRS1 and TRS2, respectively) by designing and modifying their dimerization motifs into two different sequences capable of hybridization. Figure 25 As shown in A), this improves the specificity of its substrate recognition, changing it from recognizing only 6nt DNA sequences to recognizing 12nt sequences.
[0362] The sequences of the DEAR1 heterodimer constructed in this embodiment are as follows:
[0363] Monomer 1 (SEQ ID NO:69):
[0364]
[0365] Monomer 2 (SEQ ID NO:70):
[0366]
[0367] In both monomers, TRS1 and TRS2 are highlighted in bold and underlined, and the dimerization motifs in both monomers are indicated in italics and underlined. Their corresponding DNA sequences were synthesized, and the corresponding RNAs were prepared according to the method described in Example 2.
[0368] A. Monomer 1 (1 mM); B. Monomer 2 (1 mM); C. Equal amounts of Monomer 1 (500 nM) and Monomer 2 (500 nM) were incubated for 30 min under 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, and 25 °C, respectively. Then, they were passed through a micro Superose 6 molecular sieve at 4 °C, with a sample volume of 50 μL. Figure 25As shown in B, it can be observed that monomer 1 and monomer 2 can still form heterodimers after the dimerization motif is changed. The peak position of monomer 1 or monomer 2 alone is later, while the peak position is earlier after the heterodimer is formed (the earlier the peak position, the larger the molecular volume). In the schematic diagram of the two-dimensional clustering results of cryo-electron microscopy, it can also be seen that monomer 1 and monomer 2 do form monomers when they exist alone, but they can form dimers after co-incubating the two.
[0369] Based on its structural analysis, it can be seen that DEAR exhibits three possible recognition modes for double-stranded DNA substrates (such as plasmids, bubble DNA, etc.), forming 5' overhangs, blunt ends, and 3' overhangs, respectively. The cleavage products produced differ in these three cases, such as... Figure 25 As shown in Figure C, the DEAR1 heterodimer is represented by a butterfly-shaped cartoon. TRS1, TRS2, and their corresponding substrate-binding sequences are shown in the figure, and the cleavage sites are represented by triangles. Using this heterodimer, this embodiment cleaves different types of DNA substrates, including substrates with 5' protruding ends, blunt ends, and 3' protruding ends at different cleavage distances. The sequences of the two strands of different substrates are shown in Table 9 below. All substrates used are vesicular double-stranded DNA, where the 3' end of the sense strand is labeled with -Cy5 and carries the TRS1 target (shown in bold in the table below); the 3' end of the antisense strand is labeled with FAM and carries the TRS2 target (shown underlined in the table below); the corresponding complementary pairing regions of the sense and antisense strands are shown in italics.
[0370] Table 9:
[0371]
[0372]
[0373]
[0374] Equal amounts of sense and antisense strands were mixed and denatured / annealed to form bubbly double-stranded DNA. A 1.5 μM equimolar concentration of DEAR1 monomer was incubated at room temperature for 30 minutes to form a heterodimer, which was then cleaved with 100 nM double-stranded DNA substrate under conditions of 50 mM MgCl2, 10 mM KCl, 40 mM MOPS at 7.5°C and 37°C. Time points: 0, 3, 6, and 18 h. Fluorescence images obtained from scanning the corresponding fluorescence channels in Cy5 and FAM were merged using ImageJ software. Figure 25As shown in D, this heterodimer effectively cleaves both strands of different types of double-stranded DNA substrates. This indicates that the modification of the heterodimer has biochemical activity.
[0375] The DEAR heterodimer was used for cleavage in bacteria, demonstrating that it still retains its cleavage effect. The expression of monomers 1 and 2 (both monomers have the same TRS AAGACA, and the dimerization motif is consistent with the biochemical experiment described above, i.e., monomer 1 is UCUCCU and monomer 2 is AGGAGA) of the DEAR1 heterodimer was initiated using two tandem J23119 promoters. The construction method is as follows: the J23119 promoters were linked to DEAR1 monomer 1 and DEAR1 monomer 2, respectively. Then, the two coding frames were sequentially linked, and the entire assembly was inserted into the pCDFDuet1 plasmid vector (Novagen catalog number: 71340-3) via homologous recombination, completely replacing the 410–3765 region sequence of the plasmid. The cleavage activity of the DEAR heterodimer in bacteria was tested according to the method described in Example 4. Figure 26 As shown, this indicates that this design also possesses plasmid interference activity within bacteria. Furthermore, it is understandable that DEAR is effective in editing in both eukaryotic cells and bacteria. Figure 12-17 Therefore, these modification methods that improve specificity and activity are also applicable to the editing of eukaryotic cells and bacteria.
[0376] It should be noted that although the technical solution of the present invention has been described with specific examples, those skilled in the art will understand that the present invention should not be limited thereto.
[0377] The various embodiments of the present invention have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.
Claims
1. An engineered DEAR nucleic acid manipulation system, which is obtained by engineering a primary DEAR nucleic acid manipulation system, wherein the primary DEAR nucleic acid manipulation system comprises a RNA molecule of a C-type group-II intron derived from a bacterium, the RNA molecule comprises a substrate recognition region hybridizing to a target sequence in a target nucleic acid, the RNA molecule comprises a I domain to a VI domain, and the nucleotide sequence of the RNA molecule is selected from any one of (i) to (ii) : (i) a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 9; (ii) a nucleotide sequence of the reverse complement sequence of the sequence as set forth in any one of SEQ ID NOs: 1 to 9; wherein the engineering method comprises at least one selected from (a) to (c) : (a) lengthening the substrate recognition region in the RNA molecule of the primary DEAR nucleic acid manipulation system to a length of 7 to 14 nucleotides to obtain a lengthened substrate recognition region; (b) adding a recruiting sequence to the 3’ end of the RNA molecule of the primary DEAR nucleic acid manipulation system, and the recruiting sequence hybridizes to at least a part of the target nucleic acid, wherein the length of the recruiting sequence is 10 to 40 nucleotides, and the part of the target nucleic acid hybridizing to the recruiting sequence and the target sequence in the target nucleic acid hybridizing to the substrate recognition region are located at different positions in the target nucleic acid; (c) the primary DEAR nucleic acid manipulation system is capable of forming a homodimer in a natural condition through a dimerization motif of the III domain in the RNA molecule thereof, the two monomers in the formed dimer are a first RNA molecule and a second RNA molecule, in the III domain in the first RNA molecule and the second RNA molecule, a first dimerization motif and a second dimerization motif are respectively arranged, the first dimerization motif and the second dimerization motif hybridize to each other, so that the first RNA molecule and the second RNA molecule form a heterodimer.
2. The engineered DEAR nucleic acid manipulation system of claim 1, wherein, In (a), the substrate recognition region in the RNA molecule is lengthened to a lengthened substrate recognition region of 7 to 12 nucleotides.
3. The engineered DEAR nucleic acid manipulation system of claim 2, wherein, The substrate recognition region in the RNA molecule is lengthened to a lengthened substrate recognition region of 7 to 10 nucleotides.
4. The engineered DEAR nucleic acid manipulation system of claim 1, wherein, The length of the recruiting sequence is 14 to 26 nucleotides.
5. The engineered DEAR nucleic acid manipulation system as claimed in claim 1, wherein, The part of the target nucleic acid hybridizing to the recruiting sequence and the target sequence in the target nucleic acid hybridizing to the substrate recognition region are spaced apart by 10 to 60 nucleotides.
6. The engineered DEAR nucleic acid manipulation system of claim 5, wherein, The part of the target nucleic acid hybridizing to the recruiting sequence and the target sequence in the target nucleic acid hybridizing to the substrate recognition region are spaced apart by 20 to 50 nucleotides.
7. The engineered DEAR nucleic acid manipulation system of claim 1, wherein, In (b), further comprising deleting the VI domain of the RNA molecule of the primary DEAR nucleic acid manipulation system.
8. The engineered DEAR nucleic acid manipulation system of claim 1, wherein, In (c) : the length of the first dimerization motif and the second dimerization motif is the same, and / or, the first substrate recognition region of the first RNA molecule and the second substrate recognition region of the second RNA molecule recognize the same part of the target nucleic acid, or respectively recognize different parts of the target nucleic acid.
9. The engineered DEAR nucleic acid manipulation system of claim 8, wherein, The length of the first dimerization motif and the second dimerization motif is 4 to 10 nucleotides.
10. The engineered DEAR nucleic acid manipulation system of claim 9, wherein, The first dimerization motif and the second dimerization motif have a length of 5 to 9 nucleotides.
11. The engineered DEAR nucleic acid manipulation system of claim 10, wherein, The first dimerization motif and the second dimerization motif have a length of 6 nucleotides.
12. The engineered DEAR nucleic acid manipulation system of any one of claims 1-11, wherein, The engineered DEAR nucleic acid manipulation system has improved specificity and / or cleavage activity compared to the original DEAR nucleic acid manipulation system.
13. The engineered DEAR nucleic acid manipulation system of any one of claims 1-11, wherein, The substrate recognition region of the RNA molecule of the original DEAR nucleic acid manipulation system has a length of 6 nucleotides.
14. The engineered DEAR nucleic acid manipulation system of claim 13, wherein the substrate recognition region is programmable to hybridize to different target sequences.
15. The engineered DEAR nucleic acid manipulation system of any one of claims 1-11, wherein, The target nucleic acid is DNA or RNA.
16. The engineered DEAR nucleic acid manipulation system of any one of claims 1-11, wherein, The primary cleavage site of the original DEAR nucleic acid manipulation system is 0 1 nucleotide.
17. A method for preparing an engineered DEAR nucleic acid manipulation system, the method comprising at least one selected from (a) to (c): (a) lengthening a substrate recognition region in a RNA molecule of an original DEAR nucleic acid manipulation system to have a length of 7 to 14 nucleotides, to obtain a lengthened substrate recognition region; (b) adding a recruitment sequence to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system, and the recruitment sequence hybridizes to at least a portion of the target nucleic acid, wherein, The length of the recruitment sequence is 10 to 40 nucleotides, and the part of the target nucleic acid hybridized to the recruitment sequence and the target sequence in the target nucleic acid hybridized to the substrate recognition region are located at different positions of the target nucleic acid. (c) the original DEAR nucleic acid manipulation system is capable of forming a homodimer in a natural condition through a dimerization motif of a III domain in a RNA molecule thereof, 2 monomers in the formed dimer are a first RNA molecule and a second RNA molecule, a first dimerization motif and a second dimerization motif are respectively arranged in the III domains in the first RNA molecule and the second RNA molecule, the first dimerization motif and the second dimerization motif hybridize to each other, so that the first RNA molecule and the second RNA molecule form a heterodimer; The original DEAR nucleic acid manipulation system comprises a RNA molecule of a C-type group II intron derived from a bacterium, the RNA molecule comprises a substrate recognition region hybridized to a target sequence in a target nucleic acid, the RNA molecule comprises a I domain to a VI domain, and the nucleotide sequence of the RNA molecule is selected from any one of the following (i) to (ii): (i) a nucleotide sequence as shown in any one of SEQ ID NOs: 1 to 9; (ii) a nucleotide sequence of an inverse complement sequence of the sequence as shown in any one of SEQ ID NOs: 1 to 9.
18. The method of making according to claim 17, wherein, In (a), the substrate recognition region in the RNA molecule is lengthened to a lengthened substrate recognition region having a length of 7 to 12 nucleotides.
19. The method of making according to claim 18, wherein, The substrate recognition region in the RNA molecule is lengthened to a lengthened substrate recognition region having a length of 7 to 10 nucleotides.
20. The method of making according to claim 17, wherein, The length of the recruitment sequence is 14 to 26 nucleotides.
21. The method of making according to claim 17, wherein, The part of the target nucleic acid hybridized to the recruitment sequence and the target sequence in the target nucleic acid hybridized to the substrate recognition region are spaced apart by 10 to 60 nucleotides.
22. The method of making according to claim 21, wherein, The part of the target nucleic acid hybridized to the recruitment sequence and the target sequence in the target nucleic acid hybridized to the substrate recognition region are spaced apart by 20 to 50 nucleotides.
23. The method of making according to claim 17, wherein, In (b), the VI domain of the RNA molecule of the original DEAR nucleic acid manipulation system is further deleted.
24. The method of manufacturing according to claim 17, wherein, In (c), the first dimerization motif and the second dimerization motif are of the same length, and / or, the first substrate recognition region of the first RNA molecule and the second substrate recognition region of the second RNA molecule recognize the same portion of the target nucleic acid, or recognize different portions of the target nucleic acid, respectively.
25. The method of manufacturing according to claim 24, wherein, the first dimerization motif and the second dimerization motif are 4-10 nucleotides in length.
26. The method of manufacturing according to claim 25, wherein, the first dimerization motif and the second dimerization motif are 5-9 nucleotides in length.
27. The method of manufacturing according to claim 26, wherein, the first dimerization motif and the second dimerization motif are 6 nucleotides in length.
28. The method of making according to any one of claims 17-27, wherein, the engineered DEAR nucleic acid manipulation system has improved specificity and / or cleavage activity compared to the original DEAR nucleic acid manipulation system.
29. The method of making according to any one of claims 17-27, wherein, the substrate recognition regions of the RNA molecules of the original DEAR nucleic acid manipulation system are 6 nucleotides in length.
30. The method of manufacturing according to claim 29, wherein, the substrate recognition regions are programmable to hybridize to different target sequences.
31. The method of making according to any one of claims 17-27, wherein, the target nucleic acid is DNA or RNA.
32. The method of making according to any one of claims 17-27, wherein, the primary cleavage site of the original DEAR nucleic acid manipulation system is 0-1 nucleotides downstream of the 3' end of the target sequence in the target nucleic acid.
33. An isolated polynucleotide, wherein, the polynucleotide comprises a nucleotide sequence encoding the engineered DEAR nucleic acid manipulation system of any one of claims 1-16.
34. A nucleic acid construct, wherein, the nucleic acid construct comprises the isolated polynucleotide of claim 33.
35. A vector, wherein, the vector comprises the isolated polynucleotide of claim 33, or the nucleic acid construct of claim 34.
36. A cell, wherein, the cell comprises the engineered DEAR nucleic acid manipulation system of any one of claims 1-16, the isolated polynucleotide of claim 33, the nucleic acid construct of claim 34, or the vector of claim 35, the cell includes plant cells and animal cells, and the cell does not include animal breeds and plant breeds.
37. An agent, wherein, the reagent comprises the engineered DEAR nucleic acid manipulation system of any one of claims 1-16, the isolated polynucleotide of claim 33, the nucleic acid construct of claim 34, the vector of claim 35, or the cell of claim 36.
38. A kit, wherein, the kit comprises the engineered DEAR nucleic acid manipulation system of any one of claims 1-16, the isolated polynucleotide of claim 33, the nucleic acid construct of claim 34, the vector of claim 35, or the cell of claim 36.
39. A pharmaceutical composition, wherein, the pharmaceutical composition comprises the engineered DEAR nucleic acid manipulation system of any one of claims 1-16, the isolated polynucleotide of claim 33, the nucleic acid construct of claim 34, the vector of claim 35, or the cell of claim 36; and a pharmaceutically acceptable carrier.
40. A method of modifying a target nucleic acid, the method comprising the step of contacting the target nucleic acid with the DEAR nucleic acid manipulation system of any one of claims 1-16, the isolated polynucleotide of claim 33, the nucleic acid construct of claim 34, the vector of claim 35, the cell of claim 36, the reagent of claim 37, or the kit of claim 38.
41. Use of the DEAR nucleic acid manipulation system of any one of claims 1-16, the isolated polynucleotide of claim 33, the nucleic acid construct of claim 34, the vector of claim 35, or the cell of claim 36 in modifying a target nucleic acid or in the manufacture of a reagent or kit for modifying a target nucleic acid.
Citation Information
Patent Citations
DEAR nucleic acid control system based on RNA ribozyme and application of DEAR nucleic acid control system
CN118813611A