Application of FIP1 gene in regulating plant blast resistance

Abstract

The present invention discloses the use of the FIP1 gene in regulating plant resistance to rice blast, belonging to the field of molecular biology. The present invention provides the use of the FIP1 gene in regulating plant resistance to rice blast. Experiments have confirmed that mutant plants after silencing the FIP1 gene exhibit greater disease resistance, with significant differences in leaf lesion area compared to wild-type plants. The present invention provides a technical foundation for breeding new rice blast-resistant varieties and has broad application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to application of a FIP1 gene in regulating plant resistance to rice blast. Background Art

[0002] Rice blast, a fungal disease, is a widespread global disease. It can occur throughout the rice plant's growth cycle and can be categorized as seedling blast, leaf blast, node blast, panicle blast, stalk blast, and grain blast, depending on the site of occurrence. Rice blast can result in yield reductions at the mildest level and total crop failure at the worst. Seedling blast occurs before the three-leaf stage and is caused by the infection of rice seeds. The diseased rice seedlings are gray-black in the lower part and brown in the upper part, then curl and die. In humid climates, a large amount of gray-black mold forms on the diseased parts. Therefore, studying the genetic regulation of rice blast during the seedling stage is of great theoretical and practical significance.

[0003] Alternative polyadenylation (APA) is a widespread post-transcriptional gene regulation mechanism that contributes to plant physiological and pathological processes by producing transcripts with varying 3' UTR lengths or proteins with diverse properties. Studies have shown that APA factors contribute to plant stress resistance by regulating the APA activity of numerous downstream genes. One such factor, FIP1, has a 4140-bp CDS containing 10 exons. It forms a complex with the 3' end CPSF to perform splicing and tailing. This factor consists of 1379 amino acids and contains a typical Fip1 motif. This protein participates in the recognition of APA sites, thereby influencing 3' end processing of mRNAs. However, the function of this factor in rice blast remains unclear. Therefore, by reducing the expression level of the FIP1 gene in rice and characterizing the blast phenotype of knockdown rice, we will lay an important foundation for studying the functional role of FIP1 in rice blast.

[0004] Precise targeting is a prerequisite for specific silencing of the FIP1 gene. To ensure precise targeting, the design and preparation of sgRNA that accurately and specifically targets the FIP1 gene in rice has become a key technology for silencing the gene, providing an important theoretical basis for the discovery of rice blast-resistant materials. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of the FIP1 gene in regulating plant blast resistance, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is the use of the FIP1 gene in regulating plant resistance to rice blast.

[0008] The second technical solution of the present invention is the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the FIP1 gene in regulating plant resistance to rice blast.

[0009] The third technical solution of the present invention is a method for regulating plant resistance to rice blast, silencing or knocking out the FIP1 gene to improve the plant's resistance to rice blast.

[0010] A fourth technical solution of the present invention is the use of the FIP1 gene or a recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the FIP1 gene in breeding new plant varieties resistant to rice blast.

[0011] A fifth technical solution of the present invention is a method for cultivating new rice blast-resistant plant varieties, which utilizes a recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the FIP1 gene to silence or knock out the FIP1 gene.

[0012] Based on the above technical solution, the present invention has the following technical effects:

[0013] The present invention provides the use of the FIP1 gene for regulating plant resistance to rice blast. Experiments have confirmed that mutant plants silencing the FIP1 gene exhibit increased resistance to the disease, with significant differences in leaf lesion area compared to wild-type plants. This invention provides a technical foundation for breeding new blast-resistant rice varieties and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0015] Figure 1 The target site of the rice FIP1 gene of the present invention. Sequence_0 is the CDS sequence, Sequence_2 is the genomic sequence. The red line indicates the sgRNA target sequence.

[0016] Figure 2 It is the position of the target sequence of the FIP1 gene in the gene structure of the transgenic rice of the present invention.

[0017] Figure 3 This is a peak diagram of the FIP1 gene target sequence in the transgenic rice of the present invention. The first row is the wild-type rice sequence, and the second row is the transgenic rice FIP1 sequence.

[0018] Figure 4 Phenotypic identification of transgenic rice plants infected with rice blast. DETAILED DESCRIPTION

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0021] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0022] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.

[0023] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0024] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the field, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0025] The embodiments of the present invention provide the use of the FIP1 gene in regulating plant blast resistance.

[0026] In some specific embodiments, the plant comprises rice.

[0027] In some specific embodiments, silencing or knocking out the FIP1 gene improves the plant's resistance to blast disease.

[0028] The embodiments of the present invention also provide the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the FIP1 gene in regulating plant resistance to rice blast.

[0029] The present invention also provides a method for regulating plant resistance to rice blast, which silences or knocks out the FIP1 gene to improve the plant's resistance to rice blast.

[0030] The embodiments of the present invention also provide the use of the FIP1 gene or a recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the FIP1 gene in cultivating new plant varieties resistant to rice blast.

[0031] The embodiment of the present invention also provides a method for breeding new rice blast-resistant plant varieties, which uses a recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the FIP1 gene to silence or knock out the FIP1 gene.

[0032] Example 1

[0033] Obtaining the target sequence of the rice FIP1 gene

[0034] The rice FIP1 gene LOC_Os03g25960 sequence was found and downloaded from the MSU database. The 5'-NGG-3' PAM sequence of the FIP1 gene was searched using the online CRISPRdirect website software http: / / crispr.mit.edu / and optimized based on the target site, mismatch position, and number of base mismatches. Finally, the antisense strand (SEQ ID NO. 1) "GTGGTTGGTGTCGACCCGAC" was selected as the target sequence. Figure 1 and Figure 2 .

[0035] Example 2

[0036] Construction of rice gene editing vector

[0037] (1) sgRNA sense sequence: After reverse complementation of the target sequence, the 5' end sequence NGG was removed to obtain the sgRNA sequence (SEQ ID NO. 2) "GTCGGGTCGACACCAACCAC".

[0038] (2) sgRNA anti-sense reverse complementary sequence: The sgRNA sequence was reversely complemented to obtain the reverse complementary sequence (SEQ ID NO.3) "GTGGTTGGTGTCGACCCGAC".

[0039] (3) Based on the restriction enzyme cleavage site of the selected vector, three additional bases CAG were introduced at the 5' end of the sgRNA sequence to obtain SEQ ID NO. 4 (CAGGTCGGGTCGACACCAACCAC); three additional bases CAA were introduced at the 5' end of the sgRNA reverse complementary sequence to obtain SEQ ID NO. 5 (AACGTGGTTGGTGTCGACCCGAC). The sequences were synthesized by Shanghai Bioengineering Technology Co., Ltd. and named UPOligo and LowOligo, respectively.

[0040] (4) Preparation of Oligo Dimer:

[0041] The synthesized Oligo was diluted with water to 10 μM, and the reaction system of 18 μL of Buffer Aneal, 1 μL of UPOligo, and 1 μL of LOWOligo was mixed. The mixture was heated at 95°C for 3 minutes, and then the temperature was slowly decreased to 20°C at a rate of about 0.2°C / s.

[0042] (5) Insertion of oligo dimer into vector

[0043] Add 1 μL of saCas9 / gRNA Vector, 1 μL of oligo dimer, 1 μL of Solution, 1 μL of Solution 21 μL, and add ddH2O to 10 μL. Incubate at 16°C for 2 hours.

[0044] (6) Transformation of Escherichia coli

[0045] Add 10 μL of the final product from the previous step to 50 μL of freshly thawed DH5a competent cells, flick gently to mix, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, and place on ice again for 2 minutes. Then add 500 μL of antibiotic-free LB and shake in a 37°C incubator at 170 rpm for 1 hour. Then, coat the plate with kanamycin resistance. The recombinant plasmid obtained by PCR was tested, and the recombinant plasmid that was correct by PCR was sent to Shanghai Bioengineering Co., Ltd. for sequencing and sequence verification to obtain the recombinant vector.

[0046] Example 3

[0047] Transformation of Agrobacterium with recombinant vector

[0048] (1) Preparation of competent Agrobacterium

[0049] First, pick a single colony of Agrobacterium EHA105 and inoculate it into 5 ml YEB medium, shake culture at 28 ° C overnight, inoculate it into 50 ml YEB medium at a volume ratio of 1:100 for expansion culture, and then continue to culture at 28 ° C for about 6-7 hours until the OD 600= 0.4-0.6. Next, place the bacterial solution on ice for 30 minutes; centrifuge at 5000 rpm at 4°C for 5 minutes, discard the supernatant, and resuspend the cells in 10 ml of 0.15 M NaCl. Centrifuge at 5000 rpm at 4°C for 5 minutes, discard the supernatant, and gently resuspend the cells in 1 ml of 20 mM CaCl2 at 4°C. Aliquot 200 μL per tube.

[0050] (2) Transformation and identification of Agrobacterium

[0051] Add 10 μl of plasmid DNA to 200 μl of competent Agrobacterium cells, mix thoroughly, place on ice for 30 minutes, freeze in liquid nitrogen for 5 minutes, and warm in a 37°C water bath for 5 minutes. Add 1 ml of YEB medium and incubate at 28°C with shaking for 4 hours. Centrifuge at 10,000 rpm for 30 seconds at room temperature, discard the supernatant, resuspend the cells in 200 μl of YEB medium, spread evenly on YEB medium, and incubate at 28°C for 2 days. Extract Agrobacterium plasmid DNA using alkaline lysis, and retransform the plasmid into Escherichia coli DH5a. After overnight incubation, single colonies were selected for liquid culture, plasmid extraction, and PCR analysis.

[0052] Example 4

[0053] Agrobacterium transformation of rice

[0054] (1) Rice pretreatment

[0055] After husking dry rice seeds, soak them in 70% ethanol for 1 minute, sterilize them in 50% bleach for 20 minutes, and rinse them four times with sterile water. The entire seed is transferred to a plate of MD2 medium and incubated in the dark at 26°C for 4 days. When yellow callus appears on the hypocotyl, remove the root and endosperm, and transfer the hypocotyl to a fresh plate of NBD2 medium, blunt-side up, and incubate at 26°C in the dark for 7-10 days.

[0056] (2) Pick a single colony of EHA105 Agrobacterium and culture it vigorously in 100 ml of YEB medium containing the corresponding resistance for about 16 hours at 200 rpm and 28°C until the OD 600 It is 0.6-0.8.

[0057] (3) Centrifuge at 3000 rpm for 10 minutes and resuspend the pellet in AAM-AS liquid medium to an OD of 600 It is 0.6-0.8.

[0058] (4) Soak 300 embryos with callus tissue in the bacterial suspension for 20 minutes with shaking.

[0059] (5) Collect the embryos from the suspension and blot dry between two pieces of sterile filter paper.

[0060] (6) Place sterile filter paper on the surface of the NBD2-AS culture medium plate, place the embryos on the filter paper surface, and culture in a dark box at 26°C for 2 days.

[0061] (7) Remove the root of the embryo and place the embryo on a new NBD2 culture medium plate containing cephalosporin and hygromycin, with the cut surface facing downward, and culture in a dark box at 26°C for 12 days.

[0062] (8) Then transfer the cells to a fresh NBD2 culture medium containing cephalosporin and hygromycin and culture in a dark box at 26°C for 13-15 days. During this time, new calli can be seen growing.

[0063] (9) Place the resistant calli on a plate of Pre-MS predifferentiation medium and culture in a dark box at 26°C for 8 days.

[0064] (10) Place the callus on a budding medium (MS-H differentiation medium) plate and culture at 26°C with 12 hours of light and 12 hours of darkness. When green shoots appear, transfer them to a fresh MS-H culture plate without adding hygromycin. New rootless seedlings will form within 10 days.

[0065] (11) The rootless seedlings were transferred to MSNH regeneration medium to induce root formation.

[0066] (12) After the roots are formed, the culture bottles are opened and 7 days later the seedlings are moved into the greenhouse.

[0067] Example 5

[0068] Identification and analysis of transgenic plants

[0069] (1) DNA extraction

[0070] Place the selected rice leaves in a 1.5ml centrifuge tube, add 400μL of CTAB extraction buffer, grind with a grinding rod, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), mix vigorously, and centrifuge at 12,000 rpm for 10 minutes. Transfer the supernatant to a new centrifuge tube, add 2 volumes of anhydrous ethanol and 0.1 volumes of 3M sodium acetate, pH 5.2, mix vigorously to pellet the DNA, and place in a -20°C refrigerator to precipitate for 2 hours. Centrifuge at 12,000 rpm for 10 minutes. Discard the supernatant, wash the pellet once with 70% ethanol, let it dry at room temperature, and dissolve it in an appropriate amount of ultrapure water.

[0071] (2) Identification of rice mutant plants

[0072] Using the extracted DNA as a template, use the following primers:

[0073] FIP1-F1(SEQ ID NO.6):CGCCCGCACCAAACCCTA;

[0074] FIP1-R1 (SEQ ID NO. 7): GCCCGCTACACCCCCCAT.

[0075] PCR amplification of the FIP1 fragment was performed. The 25 μL PCR system was as follows: 2.5 μL PCR buffer (10*), 0.5 μL Taq enzyme, 2 μL cDNA template, 0.5 μL 10 mM dNTP, 1 μL 10 μM FIP1-F primer, 1 μL 10 μM FIP1-R′ primer, and sterile water was used to make up to 25 μL.

[0076] The reaction conditions were as follows: 94°C, 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 60 s; and 10 min at 72°C.

[0077] The PCR products were sent to Shanghai Bioengineering Technology Co., Ltd. for sequencing and sequence analysis. Figure 3 .

[0078] (3) Phenotypic identification of FIP1 rice mutants infected with rice blast

[0079] Preparation of spore suspension: Drop 1-2 ml of sterile water containing 0.025% Tween 20 onto DCR culture medium; scrape the mycelium and spores from the culture medium directly into a small beaker using a glass slide; filter the scraped culture medium through three layers of lens paper, retaining only the mycelium and spores in the filtrate to minimize impurities; drop the filtrate onto a hemocytometer, observe under a microscope, and add an appropriate amount of sterile water to prepare a spore suspension.

[0080] Rice blast stress treatment: Mature seeds were placed in petri dishes, sterilized with 2% NaClO, soaked at 28°C for 48 hours, and then placed in hydroponic boxes. All seedlings were placed in an incubator with a 14-hour day / 10-hour night photoperiod and a 28 / 24°C temperature cycle. When the rice plants reached the three-leaf stage, a spore suspension of the rice blast fungus was applied as a stress treatment. Spraying was carried out evenly, until the suspension began to drip from the leaves. The inoculated rice seedlings were incubated in a dark room at 25°C and 85% humidity for 24 hours, followed by incubation in a dark room at 26 / 24°C for 14 hours with a 10-hour photoperiod of 85% humidity. Young rice leaves were harvested at 12, 24, 36, and 48 hours, with three biological replicates collected for each treatment. The seeds were frozen in liquid nitrogen and stored at -80°C until further use.

[0081] Phenotypic identification: Four mutant plants, osFIP1-1 and osFIP1-2, and the wild-type Nipponbare WT were used as test materials and inoculated with rice blast fungus using the spray method. The results showed that, in addition to the slower growth trend of the mutants, the osFIP1 mutant plants showed greater disease resistance, with a significant difference in the area of ​​lesions on the leaves compared to the wild-type ( Figure 4 ).

[0082] Obviously, the above embodiments of the present invention are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the implementation methods of the present invention. A person skilled in the art will be able to make other variations or modifications based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the claims of the present invention.

Claims

1. FIP1 The invention relates to a method for regulating plant resistance to rice blast disease, wherein the method comprises: The plant is rice; Silence or knockout FIP1 Genes that improve plant resistance to rice blast.

2. Targeting FIP1 The invention relates to an application of an sgRNA of a gene in regulating plant resistance to rice blast disease, characterized in that: The sequence of the sgRNA is shown in SEQ ID NO. 2; the sgRNA is used to silence or knock out FIP1 Genes to improve rice's resistance to rice blast.

3. A method for regulating plant blast resistance, characterized in that: Silence or knockout FIP1 genes that increase plant resistance to rice blast; The plant is rice.

4. Targeting FIP1 The application of sgRNA of a gene in breeding new plant varieties resistant to rice blast is characterized in that, The plants include rice.

5. A method for cultivating new rice blast-resistant plant varieties, characterized in that: Using targeted FIP1 sgRNA for gene silencing or knockout FIP1 Gene; The plant is rice.

Images